Method for detecting rabbit-derived components and application
Through RAA and RPA technologies, specific primers and nuclease exonuclease probes were designed, combined with rapid nucleic acid extraction, to achieve efficient and accurate detection of rabbit-derived ingredients, solve the problem of rabbit meat counterfeiting, and ensure food safety.
Patent Information
- Application Number
- CN202510919933.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-03
- Publication Date
- 2025-09-23
AI Technical Summary
Existing technology has not yet established an efficient and accurate method for detecting rabbit-derived ingredients, which has led to unscrupulous businesses selling rabbit meat as rabbit meat, threatening food safety and public health.
Recombinase-assisted amplification (RAA) and recombinase polymerase amplification (RPA) technologies based on exo probes are used to design specific primers and exonuclease probes, combined with rapid nucleic acid extraction technology to achieve rapid detection of rabbit-derived components.
DNA extraction is completed within 5 minutes. The detection method has high specificity and good stability, with a detection limit of 0.2%. It is suitable for rapid testing in food safety supervision and eliminates the dependence on expensive temperature-variable instruments.
Smart Images

Figure CN120683265A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of rapid food detection, and in particular to a method and application for detecting rabbit-derived ingredients. Background Art
[0002] Rabbit meat, known as "healthy meat" and "the vegetarian option among meats," is highly sought after due to its high protein, low fat, low cholesterol, and easy digestibility. However, with the globalization of the meat trade, unscrupulous vendors are counterfeiting other meats as rabbit meat to maximize profits. This practice not only seriously infringes on consumer rights and causes economic losses, but also poses food safety risks and threatens public health. Therefore, establishing efficient and accurate methods for detecting rabbit-derived ingredients is crucial to regulating the market and protecting public health.
[0003] Recombinase polymerase amplification (RPA) technology, developed by TwistDx in Cambridge, UK, and recombinase-assisted amplification (RAA) technology, developed by Qitian Gene Biotechnology in Jiangsu, China, are emerging nucleic acid amplification methods in recent years, characterized by ease of use, rapid reaction times, strong specificity, and high sensitivity. Both RPA and RAA technologies primarily utilize three key factors: recombinase, single-stranded DNA binding protein (SSB), and DNA polymerase (Bsu) to recognize homologous DNA. Compared to loop-mediated isothermal amplification (LAMP) technology, which requires four to six primers, this technique requires only one pair of primers and an exonuclease (exo) probe, reducing the complexity of primer design. Moreover, both RPA and RAA methods can achieve rapid accumulation of target products within 20 minutes under a constant temperature of 37-42°C, and get rid of the dependence of traditional polymerase chain reaction (PCR) or real-time fluorescence quantitative PCR on expensive variable temperature instruments.
[0004] Currently, RPA and RAA technologies are widely used to detect ingredients derived from cattle, duck, and camel, but have not yet been reported for rabbit meat. Therefore, establishing an exo-probe-based RAA or RPA method for detecting rabbit-derived ingredients is crucial for providing rapid and reliable technical support for food safety regulation, regulating the market, and protecting public health. Summary of the Invention
[0005] The purpose of the present invention is to provide a method and application for detecting rabbit-derived components. The DNA lysis solution can shorten the extraction time to within 5 minutes. The method for detecting rabbit-derived components has high specificity and good stability, and the detection limit for rabbit-derived components is 0.2%.
[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0007] The present invention provides a method for detecting rabbit-derived components, comprising the following steps:
[0008] (1) Using DNA lysis buffer to extract the DNA of the sample to be tested;
[0009] (2) performing real-time fluorescent recombinase-assisted amplification or recombinase polymerase amplification on the sample DNA using a primer pair consisting of an upstream primer as shown in SEQ ID No. 1 and a downstream primer as shown in SEQ ID No. 2 and an exonuclease probe as shown in SEQ ID No. 3;
[0010] (3) Determine whether the sample contains rabbit-derived components based on the presence or absence of fluorescence value.
[0011] Preferably, the DNA lysis solution in step (1) consists of Tris-HCl, lithium chloride, ethylenediaminetetraacetic acid, ethylphenyl polyethylene glycol, 3-sulfopropyl hexadecyl dimethyl betaine, and ammonium sulfate.
[0012] Further preferably, the volume molar concentration of the Tris-HCl is 0.8 to 1.2 M, and the pH of the Tris-HCl is 7.8 to 8.2; the volume molar concentration of the lithium chloride is 0.8 to 1.2 M, the volume molar concentration of the ethylenediaminetetraacetic acid is 0.4 to 0.6 M, the volume fraction of the ethylphenyl polyethylene glycol is 0.8 to 1.2%, the volume molar concentration of the 3-sulfopropyl hexadecyl dimethyl betaine is 0.4 to 0.6 M, and the volume molar concentration of the ammonium sulfate is 0.8 to 1.2 M.
[0013] Still further preferably, the volume ratio of Tris-HCl, lithium chloride, ethylenediaminetetraacetic acid, ethylphenyl polyethylene glycol, 3-sulfopropyl hexadecyldimethyl betaine, and ammonium sulfate is 4-6:2-4:1:1-2:1-2:1.
[0014] Preferably, the temperature of the real-time fluorescent recombinase-assisted amplification or recombinase polymerase amplification in step (2) is 30-35° C., and the time of the real-time fluorescent recombinase-assisted amplification or recombinase polymerase amplification is ≤30 min.
[0015] Preferably, the detection limit of the real-time fluorescent recombinase-assisted amplification or recombinase polymerase amplification in step (2) is 0.15-0.25%.
[0016] Preferably, the molar concentration of the exonuclease probe in step (2) is 100 to 140 nmol / L.
[0017] Preferably, the molar concentrations of the upstream primer and the downstream primer in step (2) are both 180-220 nmol / L.
[0018] The present invention also provides application of the method in detecting rabbit-derived components.
[0019] The beneficial effects of the present invention compared with the prior art are:
[0020] Based on the conserved region of the rabbit mitochondrial cytochrome COI gene, the present invention designed specific primers and exo probes, and constructed recombinase-mediated RAA and RPA isothermal amplification detection systems, respectively. By optimizing the reaction conditions, the F1R1 primer pair was determined to be the optimal amplification combination, the optimal exo probe concentrations of real-time fluorescence RAA and RPA were 100nmol / L and 140nmol / L, respectively, and the optimal reaction temperature was 33°C. The experimental results showed that under the optimized reaction conditions, the real-time fluorescence RAA and RPA methods had no cross-reactions with other species, the detection limits were as low as 0.2%, and the two detection methods had good stability, and 40 cycles of amplification reactions could be completed within 30 minutes. At the same time, the present invention also combines the independently developed rapid nucleic acid extraction technology, so that the entire detection process can be shortened to within 40 minutes. Its detection results for actual samples and simulated samples are highly consistent with real-time fluorescence PCR, and it has gotten rid of the dependence of traditional PCR on variable temperature instruments.
[0021] The real-time fluorescence RAA and RPA isothermal amplification detection methods constructed in this invention are sensitive, specific, and stable, making them suitable for rapid on-site detection in the field of food safety supervision. With the development of portable fluorescence detection instruments, real-time fluorescence RAA and RPA methods have broad application prospects in the field of rapid on-site detection, providing a new, efficient and convenient method for screening and monitoring rabbit-derived ingredients. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0023] Figure 1The figure shows the results of screening primer-probe combinations using the RAA method;
[0024] Figure 2 The figure shows the results of screening primer-probe combinations using the RPA method;
[0025] Figure 3 This is the result of screening probe concentration using the RAA method;
[0026] Figure 4 This is the result of screening probe concentration using the RPA method;
[0027] Figure 5 This is the result of specificity determination using the RAA method;
[0028] Figure 6 The figure shows the results of specificity determination using the RPA method;
[0029] Figure 7 The results of the RAA method for the determination of simulated samples with different rabbit meat mass fractions are shown;
[0030] Figure 8 The results of the RPA method for the determination of simulated samples with different rabbit meat mass fractions are shown;
[0031] Figure 9 The results of the RAA method for the determination of a simulated sample with a rabbit meat content of 0.2%;
[0032] Figure 10 The results of the RPA method for the determination of a simulated sample with a rabbit meat content of 0.2%;
[0033] Figure 11 The results of the RAA method for the determination of a simulated sample with a rabbit meat content of 0.1%;
[0034] Figure 12 The results are shown in the RPA method for the determination of a simulated sample with a rabbit meat mass fraction of 0.1%. DETAILED DESCRIPTION
[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0036] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0037] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0038] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.
[0039] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0040] The present invention provides a method for detecting rabbit-derived components, comprising the following steps:
[0041] (1) Using DNA lysis buffer to extract the DNA of the sample to be tested;
[0042] (2) performing real-time fluorescent recombinase-assisted amplification or recombinase polymerase amplification on the sample DNA using a primer pair consisting of an upstream primer as shown in SEQ ID No. 1 and a downstream primer as shown in SEQ ID No. 2 and an exonuclease probe as shown in SEQ ID No. 3;
[0043] (3) Determine whether the sample contains rabbit-derived components based on the presence or absence of fluorescence value.
[0044] In the present invention, the DNA lysis solution in step (1) is composed of Tris-HCl, lithium chloride, ethylenediaminetetraacetic acid, ethylphenyl polyethylene glycol, 3-sulfopropyl hexadecyl dimethyl betaine, and ammonium sulfate; the volume molar concentration of the Tris-HCl is preferably 0.8-1.2M, more preferably 0.9-1.1M, and further preferably 1.0M; the pH of the Tris-HCl is preferably 7.8-8.2, more preferably 7.9-8.1, and further preferably 8.0; the volume molar concentration of the lithium chloride is preferably 0.8-1.2M, more preferably 0.9-1.1M, and further preferably 1.0M; the volume molar concentration of the ethylenediaminetetraacetic acid is preferably 0.4-0.6M, and further preferably 0.9-1.1M. The first step is preferably 0.5M; the volume fraction of the ethylphenyl polyethylene glycol is preferably 0.8-1.2%, more preferably 0.9-1.1%, and more preferably 1.0%; the volume molar concentration of the 3-sulfopropyl hexadecyl dimethyl betaine is preferably 0.4-0.6M, more preferably 0.5M; the volume molar concentration of the ammonium sulfate is preferably 0.8-1.2M, more preferably 0.9-1.1M, and more preferably 1.0M; the volume ratio of the Tris-HCl, lithium chloride, ethylenediaminetetraacetic acid, ethylphenyl polyethylene glycol, 3-sulfopropyl hexadecyl dimethyl betaine, and ammonium sulfate is preferably 4-6:2-4:1:1-2:1-2:1, and more preferably 5:3:1:2:2:1.
[0045] In the present invention, the nucleotide sequence of the upstream primer in step (2) is AGCCAGGGACTCTACTCGGGGATGATCAAATC (SEQ ID No. 1), the nucleotide sequence of the downstream primer is ACAAGCCAGTTCCCGAAGCCTCCAATTATA (SEQ ID No. 2), and the nucleotide sequence of the exonuclease probe is AATCGTCACCGCACATGCCTTTGTAATAATC-FAMdT-T-THF-BHQ1dT-TT ATAGTCATGCCTA (SEQ IDNo.3); the temperature of the real-time fluorescent recombinase-assisted amplification or recombinase polymerase amplification is preferably 30-35°C, more preferably 32-34°C, and even more preferably 33°C; the time of the real-time fluorescent recombinase-assisted amplification or recombinase polymerase amplification is ≤30 min, more preferably ≤25 min, and even more preferably ≤20 min; the detection limit of the real-time fluorescent recombinase-assisted amplification or recombinase polymerase amplification is preferably 0.15-0.25%, more preferably 0.18-0.22%, and even more preferably 0.20%; the molar concentration of the nuclease exonuclease probe is preferably 100-140 nmol / L, more preferably 110-130 nmol / L, and even more preferably 120 nmol / L; the molar concentrations of the upstream primer and the downstream primer are preferably 180-220 nmol / L, more preferably 190-210 nmol / L, and even more preferably 200 nmol / L.
[0046] The present invention also provides application of the method in detecting rabbit-derived components.
[0047] Example 1
[0048] A method for detecting rabbit-derived components, comprising the following steps:
[0049] (1) 30 mg of the sample to be tested was mixed with 500 μL of DNA lysis buffer, fully ground for 1 min, centrifuged at 12000 r / min for 1 min, the supernatant was taken, 1 ml of ethanol was added, and the mixture was centrifuged at 12000 r / min for 1 min. The supernatant was removed, and the mixture was washed twice with 75% ethanol by volume, dried, and 80 μL of sterile water was added to obtain the sample DNA to be tested. The absorbance was measured at 260 nm and 280 nm using an ultramicro spectrophotometer. The absorbance ratio A was calculated as 260 / 280 =1.7-2.0 target DNA was diluted to 10 ng / μL and stored at -20℃ for later use;
[0050] The DNA lysis solution is composed of the following components: 1.0M pH 8.0 Tris-HCl, 1.0M lithium chloride, 0.5M ethylenediaminetetraacetic acid, 1.0% by volume of ethylphenyl polyethylene glycol, 0.5M 3-sulfopropyl hexadecyl dimethyl betaine, and 1.0M ammonium sulfate;
[0051] (2) Amplification was performed using a fluorescent RAA nucleic acid amplification kit (purchased from Hangzhou Zhongce Biotechnology Co., Ltd.) at 33°C. The total volume of the reaction system during amplification was set to 50 μL, which contained 1 μL of each 10 μmol / L upstream and downstream primers, 0.5 μL of 10 μmol / L probe, 25 μL of hydration buffer, 2.5 μL of 280 mmol / LMgAc buffer solution, 1 μL of the sample DNA to be tested, and the volume was filled to 50 μL with ddH2O; the upstream and downstream primers were shown in SEQ ID No. 1 and SEQ ID No. 2, respectively, and the probe was shown in SEQ ID No. 3. The amplification program was 30 s / cycle, 40 cycles; the amplification time was ≤ 30 min;
[0052] (3) Determine whether the sample contains rabbit-derived components based on the presence or absence of fluorescence value.
[0053] Example 2
[0054] A method for detecting rabbit-derived components, comprising the following steps:
[0055] (1) 30 mg of the sample to be tested was mixed with 500 μL of DNA lysis buffer, fully ground for 1 min, centrifuged at 12000 r / min for 1 min, the supernatant was taken, 1 ml of ethanol was added, and the mixture was centrifuged at 12000 r / min for 1 min. The supernatant was removed, and the mixture was washed twice with 75% ethanol by volume, dried, and 80 μL of sterile water was added to obtain the sample DNA to be tested. The absorbance was measured at 260 nm and 280 nm using an ultramicro spectrophotometer. The absorbance ratio A was calculated as 260 / 280 =1.7 The target DNA was diluted to 10 ng / μL and stored at -20℃ for later use;
[0056] The DNA lysis solution is composed of the following components: 0.8M pH 7.8-8.2 Tris-HCl, 1.2M lithium chloride, 0.4M ethylenediaminetetraacetic acid, 1.2% by volume of ethylphenyl polyethylene glycol, 0.4M 3-sulfopropyl hexadecyl dimethyl betaine, and 1.2M ammonium sulfate;
[0057] (2) Amplification was performed using a TwistAmp™ exo kit (purchased from TwistDx) at 33°C. The total volume of the reaction system during amplification was set to 50 μL, containing 1 μL each of 10 μmol / L upstream and downstream primers, 0.7 μL of 10 μmol / L probe, 25 μL of hydration buffer, 2.5 μL of 280 mmol / L MgAc buffer solution, 1 μL of the sample DNA to be tested, and the volume was filled to 50 μL with ddH2O. The upstream and downstream primers were shown in SEQ ID No. 1 and SEQ ID No. 2, respectively, and the probe was shown in SEQ ID No. 3. The amplification program was 30 s / cycle, 40 cycles, and the amplification time was ≤ 30 min.
[0058] (3) Determine whether the sample contains rabbit-derived components based on the presence or absence of fluorescence value.
[0059] Example 3
[0060] A method for detecting rabbit-derived components, comprising the following steps:
[0061] (1) 30 mg of the sample to be tested was mixed with 500 μL of DNA lysis buffer, fully ground for 1 min, centrifuged at 12000 r / min for 1 min, the supernatant was taken, 1 ml of ethanol was added, and the mixture was centrifuged at 12000 r / min for 1 min. The supernatant was removed, and the mixture was washed twice with 75% ethanol by volume, dried, and 80 μL of sterile water was added to obtain the sample DNA to be tested. The absorbance was measured at 260 nm and 280 nm using an ultramicro spectrophotometer. The absorbance ratio A was calculated as 260 / 280 =2.0 target DNA was diluted to 10 ng / μL and stored at -20℃ for later use;
[0062] The DNA lysis solution is composed of the following components: 1.2M Tris-HCl at pH 7.8-8.2, 0.8M lithium chloride, 0.6M ethylenediaminetetraacetic acid, 0.8% by volume of ethylphenyl polyethylene glycol, 0.6M 3-sulfopropyl hexadecyl dimethyl betaine, and 0.8M ammonium sulfate;
[0063] (2) Amplification was performed using a fluorescent RAA nucleic acid amplification kit (purchased from Hangzhou Zhongce Biotechnology Co., Ltd.) at 33°C. The total volume of the reaction system during amplification was set to 50 μL, which contained 1 μL of each 10 μmol / L upstream and downstream primers, 0.5 μL of 10 μmol / L probe, 25 μL of hydration buffer, 2.5 μL of 280 mmol / LMgAc buffer solution, 1 μL of the sample DNA to be tested, and the volume was filled to 50 μL with ddH2O; the upstream and downstream primers were shown in SEQ ID No. 1 and SEQ ID No. 2, respectively, and the probe was shown in SEQ ID No. 3. The amplification program was 30 s / cycle, 40 cycles; the amplification time was ≤ 30 min;
[0064] (3) Determine whether the sample contains rabbit-derived components based on the presence or absence of fluorescence value.
[0065] Example 4 Design of specific primers and probes
[0066] According to the rabbit gene sequence published in the GenBank database, multiple sequence alignment was performed using Snap Gene software to identify the conserved region of the rabbit cytochrome oxidase subunit I (COI) gene (GenBank No.: FJ958343.1). Based on the conserved region sequence, Snap Gene software was used to design three pairs of primers and one exonuclease (exo) probe according to the Rt-RAA working principle and probe primer design rules. BLAST searches were performed in the National Center for Biotechnology Information (NCBI) database to preliminarily verify the specificity of the primer and probe sequences. All primer and probe sequences were synthesized by Sangon Biotech Co., Ltd. The sequences of the primers and probes are shown in Table 1.
[0067] Table 1 Sequences of primers and probes
[0068]
[0069] Unless otherwise specified, the beef, mutton, pork, chicken, duck, horse, goose, donkey, and camel meat used in the present invention are all commonly used laboratory quality control samples; dog quality control, cat quality control, fox quality control, and mink quality control are all purchased from Dongguan Yuanjia Experimental Technology Co., Ltd.; mice are purchased from Guangdong Medical Laboratory Animal Center; rabbit meat (whole), red deer meat, and sika deer meat are purchased online.
[0070] Experimental Example 1 Screening of RAA / RPA Primers
[0071] Compared to nuclear DNA, mitochondrial DNA exists in cells at high copy numbers and is highly conserved and polymorphic across species. This not only increases the availability of nucleic acids but also provides an effective molecular basis for species identification. Therefore, six primer sequences were designed based on the rabbit mitochondrial COI gene and combined into nine primer-exo probe pairs to screen for reactivity with rabbit DNA.
[0072] The details are as follows:
[0073] The primers in Table 1 were randomly combined into 9 pairs of primers. Commercially available rabbit meat was tested according to the method in Example 1 at a final probe concentration of 120 nmol / L to screen the primer combinations. Figure 1 and Figure 2 shown.
[0074] The results showed that all primer-exo probe combinations produced amplification curves, with primer pair F1R1 (COI-F1 and COI-R1) exhibiting the lowest amplification cycle threshold (Ct) values under both RAA and RPA techniques. Therefore, the F1R1 primer pair was used for further optimization and validation in subsequent experiments.
[0075] Experimental Example 2 Screening of probe concentration
[0076] Under the condition of a final primer concentration of 200 nmol / L, the effect of the exo probe reaction final concentration in the range of 40 nmol / L-200 nmol / L on the real-time fluorescence RAA and RPA amplification signals was investigated. The details are as follows:
[0077] The probes were prepared at concentrations of 40, 60, 80, 120, 140, 160, 180, and 200 nmol / L and tested on commercial rabbit meat according to the method in Example 1. Figure 3 and Figure 4 shown.
[0078] The results showed that under real-time fluorescence RAA and real-time fluorescence RPA amplification, when the exo probe concentration reached 100 nmol / L and 140 nmol / L, respectively, the fluorescence intensity and reaction efficiency gradually increased with the increase of exo probe concentration. Therefore, 100 nmol / L was selected as the ideal concentration for subsequent experiments with real-time fluorescence RAA, and 140 nmol / L was selected as the ideal concentration for subsequent experiments with RPA.
[0079] Experimental Example 3 Optimization of reaction temperature
[0080] Temperature, a key control parameter in isothermal amplification reactions, directly influences enzyme activity, reaction specificity, and amplification efficiency, and thus plays a decisive role in the overall amplification reaction. Therefore, a temperature gradient of 29°C to 39°C was established, and commercially available rabbit meat was assayed according to the method described in Example 1 to optimize the reaction temperature for real-time fluorescence RAA and RPA amplification. The results are shown in Table 2.
[0081] Table 2 Ct values of rabbit-derived components at different reaction temperatures
[0082]
[0083]
[0084] Table 2 shows that within the 29°C to 33°C range, the Ct values for both real-time fluorescence RAA and RPA assays gradually decreased with increasing temperature. At 35°C and 37°C, the Ct values gradually increased. Although the Ct value at 39°C decreased, it was still higher than that at 33°C. To achieve the best amplification effect of real-time fluorescence RAA and RPA, 33°C was used as the optimal reaction temperature for the RAA and RPA methods. This optimized temperature is significantly lower than the reaction temperature of LAMP (KIM S, LEE S, KIMU, et al. Diverse methods of reducing and confirming false-positive results of loop-mediated isothermal amplification assays: A review [J]. Analytica Chimica Acta, 2023, 1280: 341693.) and cross-priming isothermal amplification (cross priming amplification, CPA, WANGY, SUN L, LI JQ, et al. Label-free cross-priming amplification coupled with endonuclease restriction and nanoparticles-based biosensor for simultaneous detection of nucleic acids and prevention of carryover contamination [J]. Front Chem, 2019, 7: 322.) and other isothermal amplification technologies, whose reaction temperature exceeds 60°C.In addition, we also collaborated with Liu Bang et al. (Liu Bang, Wang Wenjun, Wu Qingqing, et al. Rabbit-specific primers, kits and their applications in identification of rabbit-derived ingredients [P]. Hubei Province: CN201510814626.0, 2019-03-29.), Duan Qingzi et al. (Duan Qingzi, Shang Ke, Sun Honghu, et al. A real-time fluorescence PCR method and kit for simultaneous detection of 9 common animal-derived ingredients [P]. Sichuan Province: CN202410531589.1, 2024-06-14.) and Wu et al. (WU Q, XIAN S, WANG W, et al. Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay [J]. Applied Biochemistry and Compared with traditional PCR and real-time fluorescence PCR established by [Biotechnology, 2018, 185(1): 1-12] for detecting rabbit-derived components, RAA and RPA methods not only achieve rapid target amplification at low temperatures but also do not require expensive temperature-controlled instruments. This indicates that recombinase-mediated amplification systems are highly efficient at low temperatures and open up a new approach for application in resource-constrained settings.
[0085] Test Example 4 Specificity Determination
[0086] Specificity assessment is an important condition before PCR and its derivative technologies are used for nucleic acid amplification detection. Therefore, the present invention amplified the DNA of non-target samples such as beef, mutton, pork, chicken, duck, horse, goose, donkey, camel, dog, cat, fox, mink, red deer, and sika deer, and set rabbit DNA as a positive control and ddH2O as a blank control. The detection was carried out according to the method in Example 1. The results are as follows. Figure 5 and Figure 6 shown.
[0087] The results showed that only rabbit DNA exhibited an amplification curve for both amplification methods, while non-target sample DNA and the blank control showed no fluorescence changes. These results demonstrate that both amplification methods can effectively distinguish rabbit meat from other meats with high specificity.
[0088] Test Example 5 Determination of detection limit
[0089] Duck meat, chicken meat, and cat meat were mixed in equal proportions and ground into powder to serve as the base meat. Commercially available rabbit meat was mixed with the base meat to prepare simulated samples with rabbit meat mass fractions of 50%, 25%, 10%, 5%, 2%, 1%, 0.5%, 0.2%, 0.1%, and 0%, respectively. DNA was extracted from the simulated samples according to the method in Example 1, and real-time fluorescence RAA and RPA were performed to explore the detection limit of real-time fluorescence RAA or RPA. The results are shown in Figure 1. Figure 7 and Figure 8 shown.
[0090] The results showed that the Ct value increased with increasing rabbit meat mass fraction. The detection limits of both amplification methods were as low as 0.1%. These results indicate that both real-time fluorescence RAA and RPA can detect rabbit meat at relatively low mass percentages.
[0091] Test Example 6 Stability Measurement
[0092] In order to further explore the stability of the detection limit of real-time fluorescence RAA and RPA, this study used RAA and RPA methods to conduct 6 repeated experiments on the simulated samples of rabbit meat with a mass fraction of 0.2% and 0.1% respectively prepared in Experimental Example 5. Figures 9 to 12 shown.
[0093] The results showed that both real-time fluorescence RAA and RPA generated amplification curves for a simulated rabbit meat sample with a mass fraction of 0.2% in repeated experiments. However, amplification was only performed three times for a simulated rabbit meat sample with a mass fraction of 0.1% using RAA, and only twice for a simulated rabbit meat sample with a mass fraction of 0.1% using RPA. Therefore, a mass fraction of 0.2% rabbit meat was selected as the detection limit for both the real-time fluorescence RAA and RPA methods.
[0094] As can be seen from the above examples, the present invention provides a DNA lysis solution, a kit, and a method and application for detecting rabbit-derived components. Both RPA and RAA detection methods can efficiently amplify the target fragment within 30 minutes at 33°C, with high specificity and good stability. The detection limit for rabbit-derived components is 0.2%. The detection results of RPA and RAA methods for commercially available samples and simulated samples are highly consistent with the national standard method. Therefore, the established RPA and RAA detection methods are suitable for the rapid detection of rabbit-derived components in processed meat products.
[0095] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A method for detecting rabbit-derived components, characterized in that: The steps include: (1) Using DNA lysis buffer to extract the DNA of the sample to be tested; (2) performing real-time fluorescent recombinase-assisted amplification or recombinase polymerase amplification on the sample DNA using a primer pair consisting of an upstream primer as shown in SEQ ID No. 1 and a downstream primer as shown in SEQ ID No. 2 and an exonuclease probe as shown in SEQ ID No. 3; (3) Determine whether the sample contains rabbit-derived components based on the presence or absence of fluorescence value.
2. The method according to claim 1, characterized in that The DNA lysis solution in step (1) is composed of Tris-HCl, lithium chloride, ethylenediaminetetraacetic acid, ethylphenyl polyethylene glycol, 3-sulfopropyl hexadecyl dimethyl betaine, and ammonium sulfate.
3. The method according to claim 2, characterized in that The volume molar concentration of the Tris-HCl is 0.8 to 1.2 M, and the pH of the Tris-HCl is 7.8 to 8.2; the volume molar concentration of the lithium chloride is 0.8 to 1.2 M, the volume molar concentration of the ethylenediaminetetraacetic acid is 0.4 to 0.6 M, the volume fraction of the ethylphenyl polyethylene glycol is 0.8 to 1.2%, the volume molar concentration of the 3-sulfopropyl hexadecyl dimethyl betaine is 0.4 to 0.6 M, and the volume molar concentration of the ammonium sulfate is 0.8 to 1.2 M.
4. The method according to claim 3, characterized in that The volume ratio of Tris-HCl, lithium chloride, ethylenediaminetetraacetic acid, ethylphenyl polyethylene glycol, 3-sulfopropyl hexadecyl dimethyl betaine and ammonium sulfate is 4-6:2-4:1:1-2:1-2:
1.
5. The method according to claim 1, wherein The temperature of the real-time fluorescent recombinase-assisted amplification or recombinase polymerase amplification in step (2) is 30-35° C., and the time of the real-time fluorescent recombinase-assisted amplification or recombinase polymerase amplification is ≤30 min.
6. The method according to claim 1, characterized in that The detection limit of the real-time fluorescent recombinase-assisted amplification or recombinase polymerase amplification in step (2) is 0.15-0.25%.
7. The method according to claim 1, characterized in that The molar concentration of the exonuclease probe in step (2) is 100 to 140 nmol / L.
8. The method according to claim 1, characterized in that The molar concentrations of the upstream primer and the downstream primer in step (2) are both 180-220 nmol / L.
9. Use of the method according to any one of claims 1 to 8 in detecting rabbit-derived components.