Primer probe group, composition and kit for detecting bodinisia bodinieri as well as identification method and application of bodinisia bodinieri

Abstract

The invention provides a primer probe group, a composition and a kit for detecting Bowdenia, and an identification method and application thereof, and belongs to the technical field of biological detection. The primer probe group comprises a forward primer F1, a reverse primer R1 and a fluorescent probe P1. According to the invention, a primer probe group capable of specifically detecting the Neydenia is designed on the basis of taking an ITS sequence of the Neydenia as a target. The primer probe group disclosed by the invention can be used for specifically detecting the borers, and the detection sensitivity of the primer probe group to plasmids containing ITS sequences of the borers reaches 2.93 * 10 < 1 > copies / mu L. The detection method provided by the invention has relatively strong specificity and repeatability, provides an effective technical means for detection and monitoring of the Bowden insect disease of a farmer in the aquatic animal breeding process, and fills the blank in the existing aquatic animal disease detection method aiming at the Bowden insect detection method.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and in particular relates to a primer probe set, a composition, a kit for detecting Benedenia, and an identification method and application thereof. Background Art

[0002] Benedenia, commonly known as "white termite" by coastal fishermen, is a major pathogen of marine aquaculture fish. It has a wide distribution and has been reported in marine aquaculture fish species worldwide. Taxonomically, Benedenia belongs to the phylum Platyhelminthes, class Monogenea, family Capsalidae, subfamily Benedeniinae, in the kingdom Animalia. Benedenia primarily parasitizes the body surface and eyes of fish, typically feeding on the host fish's mucus and epithelial tissues, crawling across the fish's body using its anterior and posterior suckers. Benedenia primarily harms marine aquaculture fish. The disease can occur year-round, with peak prevalence in late spring, early summer, and autumn.

[0003] Real-time PCR (Quantitative Real-time PCR) is a method that adds fluorescent dyes or fluorescent probes to conventional PCR technology, using the accumulated fluorescent signal to monitor the entire PCR process in real time and quantitatively analyze templates of unknown concentrations using a standard curve. As an internationally recognized standard for nucleic acid quantification, real-time PCR is the preferred method for rapidly measuring gene expression levels. It not only represents a significant leap from qualitative to quantitative PCR, but also offers greater sensitivity, specificity, reproducibility, and automation compared to conventional PCR.

[0004] Currently, research on Benedenia is relatively insufficient, and detection methods for it are even more scarce. Developing a simple, rapid, sensitive, accurate, and practical Benedenia detection method using fluorescent quantitative PCR technology to help farmers detect and monitor Benedenia diseases during aquaculture, and to address the lack of Benedenia detection methods in existing aquatic animal disease detection methods, is an urgent issue. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide a kind of primer probe group, composition, kit and its identification method and application for detecting Benedenia.The present invention is based on the ITS sequence of Benedenia as target, designs a primer probe group that can specifically detect Benedenia.Use the primer probe group of the present invention to specifically detect Benedenia.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a primer probe set for detecting Benedenia, wherein the primer probe set comprises a forward primer F1, a reverse primer R1, and a fluorescent probe P1;

[0008] The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO: 1, the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO: 2, and the nucleotide sequence of the fluorescent probe P1 is shown in SEQ ID NO: 3.

[0009] Preferably, the 5' end of the fluorescent probe P1 is labeled with a fluorescent group FAM, and the 3' end is labeled with a quenching group MGB.

[0010] The present invention provides the use of the primer probe group in preparing a preparation for detecting Benedenia in aquatic animals.

[0011] The present invention provides a kit for detecting Benedenia, which comprises the primer probe set.

[0012] Preferably, the kit further comprises a PCR reaction premix, a positive control reference substance, and a negative control reference substance.

[0013] The present invention also provides a method for identifying Benedenia for purposes other than disease diagnosis and treatment, comprising the following steps:

[0014] (1) Extracting DNA from samples;

[0015] (2) performing a PCR reaction on the sample DNA using the primer probe set;

[0016] (3) If the sample detection Ct value is ≥40 or no Ct value, and there is no "S"-shaped amplification curve, it is determined that the sample does not contain Benedenia; if the sample detection Ct value is <40, and the curve is an "S"-shaped amplification curve, it is determined that the sample contains Benedenia.

[0017] Preferably, the sample is an aquatic animal.

[0018] Preferably, the PCR reaction procedure is: 50°C for 5 min, 1 cycle; 95°C for 5 min, 1 cycle; 95°C for 15 s, 60°C for 30 s, 40 cycles, and collecting the fluorescence signal at 60°C for 30 s.

[0019] Preferably, the PCR reaction system, based on 25 μL, includes the following components: 12.5 μL of reaction premix, 11 μL of forward primer F, 11 μL of reverse primer R, 10.5 μL of fluorescent probe P, 5 μL of sample DNA to be tested, and 5 μL of ddH2O.

[0020] Compared with the prior art, the present invention has the following advantages: the present invention discloses a primer probe set, composition, kit, identification method, and application thereof for detecting Benedenia. The present invention designs a primer probe set capable of specifically detecting Benedenia based on the ITS sequence of Benedenia as a target. The primer probe set of the present invention can specifically detect Benedenia, with a detection sensitivity of 2.93×10 1 The detection method of the present invention has strong specificity and repeatability, and provides an effective technical means for farmers to detect and monitor Benedenia diseases during aquatic animal breeding, filling the gap in existing aquatic animal disease detection methods for Benedenia detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The amplification results of different Benedenia primer-probe sets in Example 1 are shown;

[0022] Figure 2 For the specific detection of Benedenia primer-probe set, negative controls include: Ichthyophthirius multifida, Cryptocaryon irritans, Coccidia spp., Vibrio alginolyticus, Vibrio harveyi, Vibrio parahaemolyticus, Streptococcus agalactiae, and Streptococcus iniae; blank control: ddH2O;

[0023] Figure 3 This is the sensitivity test result of the Benedenia primer-probe set;

[0024] Figure 4 This is the negative stability test result of the Benedenia primer-probe set;

[0025] Figure 5 These are the detection results of Benedenia in 24 actual samples. DETAILED DESCRIPTION

[0026] The present invention provides a primer probe set for detecting Benedenia, wherein the primer probe set comprises a forward primer F1, a reverse primer R1, and a fluorescent probe P1;

[0027] The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO: 1, and is as follows:

[0028] GATGGCGCCCTGTTTGC;

[0029] The nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO: 2, and is as follows:

[0030] TGAACCAAGTGATCCACTACATGA;

[0031] The nucleotide sequence of the fluorescent probe P1 is shown in SEQ ID NO: 3, and is as follows:

[0032] AGGAAGCCATTAACTATC.

[0033] In the present invention, the 5' end of the fluorescent probe P1 is labeled with a fluorescent group FAM, and the 3' end is labeled with a quenching group MGB.

[0034] The present invention provides the use of the primer probe group in preparing a preparation for detecting Benedenia in aquatic animals.

[0035] The present invention provides a kit for detecting Benedenia, which comprises the primer probe set.

[0036] In the present invention, the kit further includes a PCR reaction premix, a positive control reference substance, and a negative control reference substance. The positive control reference substance is a plasmid containing the Benedenia ITS sequence, and the negative control reference substance is ddH2O.

[0037] The present invention also provides a method for identifying Benedenia for purposes other than disease diagnosis and treatment, comprising the following steps:

[0038] (1) Extracting DNA from samples;

[0039] (2) performing a PCR reaction on the sample DNA using the primer probe set;

[0040] (3) If the sample detection Ct value is ≥40 or no Ct value, and there is no "S"-shaped amplification curve, it is determined that the sample does not contain Benedenia; if the sample detection Ct value is <40, and the curve is an "S"-shaped amplification curve, it is determined that the sample contains Benedenia.

[0041] In the present invention, the sample is an aquatic animal.

[0042] In the present invention, the PCR reaction procedure is: 50°C for 5 min, 1 cycle; 95°C for 5 min, 1 cycle; 95°C for 15 s, 60°C for 30 s, 40 cycles, and collecting the fluorescence signal at 60°C for 30 s.

[0043] In the present invention, the PCR reaction system is 25 μL and includes the following components: 12.5 μL of reaction premix, 11 μL of forward primer F, 11 μL of reverse primer R, 10.5 μL of fluorescent probe P, 5 μL of sample DNA to be tested, and 5 μL of ddH2O.

[0044] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0045] Example 1 Effect of primer probe set on detection of Benedenia

[0046] 1. Experimental methods

[0047] 1.1 Plasmid DNA synthesis

[0048] The gene sequence (SEQ ID NO: 7) designed with primers for Benedenia was connected to the pUC57 vector to construct a plasmid. The plasmid was constructed by Sangon Biotech (Shanghai) Co., Ltd.

[0049] 1.2 Primer design

[0050] The complete genome sequence of Benedenia (LC718918.1) was searched from Genbank and compared by BLAST analysis. The ITS sequence was used as the target gene. Specific primers and probes were designed according to the principles of real-time fluorescence PCR primer and probe design using PrimerExpress primer design software.

[0051] Gene sequences used for primer design of Benedenia:

[0052] TAGATAAGAGCTGTACTATGTATGGCACTGTTGATGGCCACGTTGCAAGCCATACTATATAAATGAATGTACATTTACTGCACAATATAATGTTGTGTGATGGCGCCCTGTTTGCAGGGAGGAAGCCATTAACTATCACTTCATGTAGTGGATCACTTGGTTCACACTTCGATGAAGAGTGCTGCAAAACGTGATATTTTATT GCGAATTGCACACTGCTTCGAACATCGAAATCTTGAACGCACATGTCAGTCTTAGTGAAAGCTTAGACTACGTTTGCTCGAGTGCTGGCTAAACATTGATCAATACGCTATTAGTATTGCGTGCCAGTATTGCTAGTGCTACATGTAAGTGTGTTTATTGTAATAAAACGCACGTAGCATTGGCCTACTGGTTAAATG(SEQ ID NO: 7);

[0053] Benedenia primer probe set 1 (Y1):

[0054] Forward primer BM-M1-F (forward primer F1): 5′-GATGGCGCCCTGTTTGC-3′ (SEQ ID NO: 1);

[0055] Reverse primer BM-M1-R (reverse primer R1):

[0056] 5'-TGAACCAAGTGATCCACTACATGA-3' (SEQ ID NO: 2);

[0057] Fluorescent probe BM-M1-P (fluorescent probe P1): 5'-AGGAAGCCATTAACTATC-3' (SEQ ID NO: 3);

[0058] The 5' end of the fluorescent probe BM-M1-P is labeled with the fluorescent group FAM, and the 3' end is labeled with the quencher group MGB.

[0059] Benedenia primer probe set 2 (Y2):

[0060] Forward primer BM-M2-F (forward primer F2):

[0061] 5'-CGAAATCTTGAACGCACATGTC-3' (SEQ ID NO: 4);

[0062] Reverse primer BM-M2-R (reverse primer R2):

[0063] 5'-TTTAGCCAGCACTCGAGCAA-3' (SEQ ID NO: 5);

[0064] Fluorescent probe BM-M2-P (fluorescent probe P2):

[0065] 5'-TTAGTGAAAGCTTAGACTACG-3' (SEQ ID NO: 6);

[0066] The 5' end of the fluorescent probe BM-M2-P is labeled with the fluorescent group FAM, and the 3' end is labeled with the quencher group MGB.

[0067] 1.3 Perform PCR reaction

[0068] The reaction system is shown in Table 1.

[0069] Table 1 Real-time fluorescence PCR reaction system

[0070]

[0071] The reaction program was as follows: decontamination program at 50°C for 5 min, 1 cycle; holding stage program at 95°C for 5 min, 1 cycle; cycling stage program at 95°C for 15 s, 60°C for 30 s, 40 cycles, collecting fluorescence signals at 60°C for 30 s, and observing the reaction results using a fluorescence PCR instrument.

[0072] 2. Experimental results

[0073] Depend on Figure 1 As can be seen, all primers were able to amplify, the Ct value of primer probe set 1 was small and the reproducibility was good, and there was no nonspecific amplification in the negative control group. Primer probe set 1 is the optimal primer probe set.

[0074] Example 2 A kit for detecting Benedenia in aquatic animals

[0075] 1. Composition of the kit for detecting Benedenia in aquatic animals

[0076] 1.1 Primer and probe sets for detecting Benedenia

[0077] Forward primer BM-M1-F (forward primer F1): 5′-GATGGCGCCCTGTTTGC-3′ (SEQ ID NO: 1);

[0078] Reverse primer BM-M1-R (reverse primer R1):

[0079] 5'-TGAACCAAGTGATCCACTACATGA-3' (SEQ ID NO: 2);

[0080] Fluorescent probe BM-M1-P (fluorescent probe P1): 5'-AGGAAGCCATTAACTATC-3' (SEQ ID NO: 3);

[0081] The 5' end of the fluorescent probe BM-M1-P is labeled with the fluorescent group FAM, and the 3' end is labeled with the quencher group MGB.

[0082] 1.2 PCR Reagents

[0083] PCR reaction premix, positive control reference, negative control reference;

[0084] The positive control reference substance was a plasmid containing the Benedenia ITS sequence (obtained in the manner of Example 1); the negative control reference substance was ddH2O.

[0085] 2. Usage

[0086] Acquisition of DNA from test samples: DNA was extracted from test samples using a commercially available DNA extraction kit (purchased from Guangzhou Double Helix Gene Technology Co., Ltd.), and the purity and concentration of the extracted DNA were determined using a full-wavelength micro-spectrophotometer and stored at -20°C for future use.

[0087] The Benedenia primer-probe set was used to perform PCR reaction on the DNA of the sample to be tested. The reaction system is shown in Table 2.

[0088] Table 2 Real-time fluorescence PCR reaction system

[0089]

[0090] The reaction program was as follows: decontamination program at 50°C for 5 min, 1 cycle; holding stage program at 95°C for 5 min, 1 cycle; cycling stage program at 95°C for 15 s, 60°C for 30 s, 40 cycles, collecting fluorescence signals at 60°C for 30 s, and observing the reaction results using a fluorescence PCR instrument.

[0091] 3. Interpretation method

[0092] If the Ct value of the test sample is ≥40 or no Ct value is found, the curve is a straight line or a slightly slanted line, and there is no "S"-shaped amplification curve, it can be determined that the sample does not contain Benedenia or the content is below the detection limit;

[0093] The Ct value of the test sample is less than 40, and the curve shows an "S"-shaped amplification curve, which can be used to determine that the sample contains Benedenia.

[0094] Example 3 Specificity Experiment

[0095] 3.1 Experimental methods

[0096] DNA was extracted from each sample using a commercially available DNA extraction kit (purchased from Guangzhou Double Helix Gene Technology Co., Ltd.), and the purity and concentration of the DNA were determined using a full-wavelength micro-spectrophotometer and stored at -20°C for future use.

[0097] The samples included: Ichthyophthirius multifida, Cryptocaryon irritans, Coccidia spp., Vibrio alginolyticus, Vibrio harveyi, Vibrio parahaemolyticus, Streptococcus agalactiae, and Streptococcus iniae.

[0098] PCR amplification was performed using the primer and probe set for detecting Benedenia in the kit of Example 2.

[0099] 3.2 Experimental Results

[0100] The specificity experimental results of the primer and probe set for Benedenia showed that no amplified fluorescent signals were detected in the DNA samples of other aquatic animal diseases such as Ichthyophthirius multifleurus. Figure 2 ), indicating that the established real-time fluorescence PCR detection method has good specificity.

[0101] Example 4 Sensitivity and Repeatability Experiment

[0102] 4.1 Experimental methods

[0103] The plasmid DNA synthesized by the method of Example 1 was quantified on a spectrophotometer, and the plasmid concentration was 100 ng / μL. The plasmid was serially diluted, and the DNA concentration was converted into the copy number, which was 2.93×1010 copies / μL, diluted 10-fold with TE buffer to obtain 2.93×10 9 copies / μL, 2.93×10 8 copies / μL, 2.93×10 7 copies / μL, 2.93×10 6 copies / μL, 2.93×10 5 copies / μL, 2.93×10 4 copies / μL, 2.93×10 3 copies / μL, 2.93×10 2 copies / μL, 2.93×10 1 copies / μL, 2.93×10 0 The plasmid with a concentration of 2.93×10 copies / μL was selected. 6 copies / μL, 2.93×10 5 copies / μL, 2.93×10 4 copies / μL, 2.93×10 3 copies / μL, 2.93×10 2 copies / μL, 2.93×10 1 copies / μL, 2.93×10 0 The concentration of the bacteria was 100 copies / μL, 3 replicates were set for each concentration, and the primer and probe set for detecting Benedenia in the kit of Example 2 was used for detection.

[0104] 4.2 Experimental Results

[0105] Figure 3 The results showed that a typical amplification curve appeared, and the detection sensitivity of the method of the present invention for the plasmid containing the ITS sequence of Benedenia reached 2.93×10 1 Seven dilution gradients were used, and three parallel experiments were performed for each dilution gradient. The results showed that the coefficient of variation was between 0.37% and 1.53%, indicating that the real-time fluorescence PCR detection method established in the present invention has good reproducibility (Table 3).

[0106] Table 3 Repeatability experiments of primer-probe sets for Benedenia

[0107]

[0108] Example 5 Negative stability test

[0109] 1. Experimental methods

[0110] A negative stability experiment was performed using ddH2O as a negative control, repeated 20 times, and three positive control references (plasmids containing the Benedenia ITS sequence obtained by the method of Example 1) were added.

[0111] 2. Experimental results

[0112] Figure 4 The results showed that the real-time fluorescence PCR detection method established by the present invention had good negative stability and no nonspecific amplification occurred.

[0113] Example 6 Detection of Benedenia in actual samples

[0114] 1. Experimental methods

[0115] DNA was extracted from 24 marine fish samples (from Guangdong Xuanda Testing Technology Service Co., Ltd., Table 4), and the kit of Example 2 was used to detect whether they were infected with Benedenia.

[0116] Table 4 Marine fish sample information

[0117] serial number variety Sampling site serial number variety Sampling site 1 Yellowfin snapper Body mucus 13 Golden Pomfret Body mucus 2 Yellowfin snapper Body mucus 14 Golden Pomfret Body mucus 3 Yellowfin snapper Body mucus 15 Golden Pomfret Body mucus 4 Yellowfin snapper Body mucus 16 Golden Pomfret Body mucus 5 Yellowfin snapper Body mucus 17 Golden Pomfret Body mucus 6 Yellowfin snapper Body mucus 18 Large yellow croaker Body mucus 7 Yellowfin snapper Body mucus 19 Large yellow croaker Body mucus 8 Black sea bream Body mucus 20 Large yellow croaker Body mucus 9 Black sea bream Body mucus 21 Large yellow croaker Body mucus 10 Black sea bream Body mucus 22 Large yellow croaker Body mucus 11 Black sea bream Body mucus 23 grouper Body mucus 12 Golden Pomfret Body mucus 24 grouper Body mucus

[0118] 2. Experimental results

[0119] The kit of Example 2 was used to detect the DNA of 24 actual samples extracted. The results are as follows: Figure 5 Among them, 4 actual samples (samples 5, 6, 14 and 15) tested positive for Benedenia DNA, while 20 actual samples tested negative for Benedenia DNA.

[0120] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A primer probe set for detecting Benedenia, characterized in that: The primer probe set includes a forward primer F1, a reverse primer R1, and a fluorescent probe P1; The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO: 1, the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO: 2, and the nucleotide sequence of the fluorescent probe P1 is shown in SEQ ID NO:

3.

2. The primer probe set according to claim 1, characterized in that The 5' end of the fluorescent probe P1 is labeled with a fluorescent group FAM, and the 3' end is labeled with a quenching group MGB.

3. Use of the primer probe set according to claim 1 or 2 in preparing a preparation for detecting Benedenia in aquatic animals.

4. A kit for detecting Benedenia, characterized in that The kit comprises the primer probe set according to claim 1 or 2.

5. The kit according to claim 4, characterized in that The kit also includes a PCR reaction premix, a positive control reference substance, and a negative control reference substance.

6. A method for identifying Benedenia for purposes other than disease diagnosis and treatment, characterized in that: The following steps are involved: (1) Extracting DNA from samples; (2) performing a PCR reaction on the sample DNA using the primer probe set described in claim 1 or 2; (3) If the sample detection Ct value is ≥40 or no Ct value is found and there is no "S"-shaped amplification curve, the sample is judged to be free of Benedenia; if the sample detection Ct value is less than 40 and the curve is an "S"-shaped amplification curve, the sample is judged to be free of Benedenia.

7. The identification method according to claim 6, characterized in that: The sample is an aquatic animal.

8. The identification method according to claim 6, characterized in that: The PCR reaction procedure was as follows: 50°C for 5 min, 1 cycle; 95°C for 5 min, 1 cycle; 95°C for 15 s, 60°C for 30 s, 40 cycles, and collecting the fluorescence signal at 60°C for 30 s.

9. The identification method according to claim 6, characterized in that: The PCR reaction system, based on 25 μL, includes the following components: 12.5 μL of reaction premix, 11 μL of forward primer F, 11 μL of reverse primer R, 10.5 μL of fluorescent probe P, 5 μL of sample DNA to be tested, and 5 μL of ddH2O.

Images