KASP marker combination and KASP marker primer for construction of longan DNA fingerprint database and application of KASP marker combination and KASP marker primer

Abstract

The invention belongs to the technical field of gene detection, and particularly relates to a KASP marker combination and a KASP marker primer for construction of a longan DNA fingerprint database and application of the KASP marker combination and the KASP marker primer. The 24 KASP markers provided by the invention have relatively good polymorphism and typing effects, and a DNA fingerprint spectrum database constructed based on the KASP markers can more accurately and efficiently distinguish longan germplasm.

Description

Technical Field

[0001] The invention belongs to the technical field of gene detection, and particularly relates to a KASP marker combination for constructing a longan DNA fingerprint library, a KASP marker primer and an application thereof. Background Art

[0002] DNA fingerprinting, due to its rich polymorphism, high specificity, and stability, has been widely used in forensic medicine, paleontology, and plant and animal germplasm resources. In the identification of fruit tree germplasm resources, significant progress has been made in constructing DNA fingerprints for apples, grapes, pears, citrus, peaches, and bayberries. Due to their excellent stability, consistency, and specificity, they have become important evidence for DUS testing and the primary basis for protecting new variety rights. However, compared to other fruit trees, longan DNA fingerprinting research is still in its infancy and lacks in-depth research. To date, no DNA fingerprints have been reported for practical application.

[0003] SNP (Single Nucleotide Polymorphism) refers to the variation of a single nucleotide (A, T, C, or G) at a specific position in the genome, including the substitution, insertion, or deletion of a single base. This variation is very common in the genome, with high density and high polymorphism, making it an ideal marker for constructing DNA fingerprints. However, SNPs identified based on sequencing data have a large number of false-positive sites, and experimental verification of SNPs is usually required. Semagn et al. (2014) developed a high-throughput SNP detection technology based on competitive allele-specific PCR (KASP), which can perform genotyping through differences in fluorescent signals. KASP technology is a major technology for experimental detection of SNPs due to its high throughput, simple operation, rapid detection, and accuracy. It has been widely used in the fields of germplasm resource identification, kinship identification, molecular marker-assisted breeding, and genetic map construction. However, no related application reports have been found in longan. Summary of the Invention

[0004] Based on this, the present invention constructs a longan DNA fingerprint by developing a KASP molecular marker combination to achieve molecular identification of longan germplasm resources.

[0005] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0006] In one aspect, the present invention provides a KASP marker combination for constructing a longan DNA fingerprint library. The positions and genotypes of the KASP markers are as follows:

[0007]

[0008]

[0009] Another aspect of the present invention provides a KASP marker primer for constructing a longan DNA fingerprint library. The KASP marker primer is used to amplify and detect the KASP marker in the present invention.

[0010] Preferably, among the above-mentioned KASP marker primers, the primer sequences for amplifying KASP marker 1 to KASP marker 24 are respectively as follows:

[0011]

[0012]

[0013]

[0014] Preferably, the 5' ends of the forward primer 1 and the forward primer 2 for amplifying the primer sequences of KASP marker 1 to KASP marker 24 are independently connected to different linker sequences matching the fluorescent labeled probe to distinguish different genotypes.

[0015] More preferably, the forward primer 1 detects genotype 1 in the allele, and the forward primer 1 is connected to the linker matching the fluorescent labeled probe FAM, and its sequence is: gaaggtgaccaagttcatgct; the forward primer 2 detects genotype 2 in the allele, and the forward primer 2 is connected to the linker matching the fluorescent labeled probe HEX, and its sequence is: gaaggtcggagtcaacggatt.

[0016] In another aspect, the present invention provides a detection product, which includes the KASP labeled primer of the present invention.

[0017] Preferably, the above-mentioned detection product includes a detection kit or a detection reagent.

[0018] In another aspect, the present invention provides a longan DNA fingerprint library, which is composed of the KASP marker combination of the present invention.

[0019] Preferably, the longan DNA fingerprint library information is as follows Figures 7a to 7g shown.

[0020] In another aspect, the present invention provides an application of the KASP labeled primer of the present invention, the detection product of the present invention, or the longan DNA fingerprint library of the present invention, wherein the application includes identification and differentiation of longan germplasm.

[0021] The beneficial effects of the present invention include: the combination of 24 KASP markers provided by the present invention has good polymorphism and typing effect, and the DNA fingerprint library constructed based on this group of KASP markers can distinguish longan germplasm more accurately and efficiently. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Simplified the quality and coverage of genome sequencing data for 209 longan accessions;

[0023] Figure 2 The quantitative distribution of 59,658 SNPs in 209 longan materials within 100Kbp on 15 chromosomes;

[0024] Figure 3 The distribution characteristics of SNPs; (a) is the SNP distribution area; (b) is the effect of exon SNP on the encoded amino acid; (c) is the SNP genotype and Ts / Tv value distribution of 209 longan germplasms;

[0025] Figure 4 The KASP marker genotyping results of 79 longan germplasms; red dots represent samples with genotype 0 / 0, blue dots represent samples with genotype 1 / 1, green dots represent samples with genotype 0 / 1, gray crosses represent samples with missing genotype * / *, and black squares represent negative controls;

[0026] Figure 5 It is the differential KASP marker locus between longan germplasms;

[0027] Figure 6 DNA fingerprints of 79 longan germplasms constructed based on 24 KASP markers;

[0028] Figure 7 shows the fingerprint codes of various DNA fingerprints. DETAILED DESCRIPTION

[0029] The examples are provided to better illustrate the present invention, but are not intended to limit the present invention to the examples. Therefore, non-essential improvements and adjustments to the embodiments made by those skilled in the art based on the above-mentioned invention still fall within the scope of protection of the present invention.

[0030] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "comprise" and the like are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0031] In order to better understand the present invention, the content of the present invention is further explained below with reference to specific examples, but the content of the present invention is not limited to the following examples.

[0032] In the following example, the 209 longan germplasms used for simplified genome sequencing were mainly derived from the National Tropical Fruit Germplasm Resource Garden, some wild resources were collected in the wild, and some local varieties and hybrid germplasms were introduced from research institutes such as the National Longan and Loquat Germplasm Resource Garden, the Guangdong Longan Germplasm Resource Garden, and South China Agricultural University (Table 1).

[0033] 209 longan accessions for simplified genome sequencing and phenotypic analysis

[0034]

[0035]

[0036]

[0037]

[0038] In the following example, 79 longan germplasms used for KASP marker verification were obtained from the National Tropical Fruit Germplasm Resource Center (Table 2).

[0039] Table 279 longan germplasms verified using KASP markers

[0040]

[0041]

[0042] In the following examples, the CTAB Plant Genomic DNA Rapid Extraction Kit was from Beijing Adlai Biotechnology Co., Ltd., catalog number DN1402; the SNP typing kit was from Wuhan Jingpeptide Biotechnology Co., Ltd., 2×PAMR8 Pro PCRMix; the UV spectrophotometer was from ThermoFisher Scientific, ND-ONE; and the real-time fluorescence quantitative PCR was from QuantStudio3, Thermo Fisher Scientific.

[0043] 1. Sample Collection

[0044] The complete leaves of the newly grown and mature longan germplasm trees were collected and quickly frozen in liquid nitrogen at -80℃ for storage.

[0045] 2. DNA Extraction

[0046] Approximately 3.5 g of healthy, pest-free young leaves were selected from each test material. After freezing in liquid nitrogen, genomic DNA from each material was extracted using the CTAB Plant Genomic DNA Rapid Extraction Kit (refer to the kit instructions for the extraction method). After extraction, the concentration of each DNA was measured using an ultraviolet spectrophotometer. The DNA concentration of qualified samples was diluted to 100 ng / ul and stored in a refrigerator at 4°C until use. DNA quality was tested by 1% agarose gel electrophoresis.

[0047] 3. Simplifying genome sequencing

[0048] After passing the concentration and quality inspection, the extracted DNA from 209 longan materials was sent to Beijing Novogene Technology Co., Ltd. for simplified genome sequencing using the HiSeq2500 sequencing platform. The sequencing data was cleaned using Fastp software to remove adapter sequences and low-quality bases to obtain clean reads for each sequencing material.

[0049] Total DNA was extracted from 209 longan samples. After quality testing, the concentration and integrity met the requirements for library construction and sequencing. A total of 167Gb of raw data was obtained by sequencing, and 161Gb of clean reads were obtained after quality filtering, with an average of 772Mb per sample. The average effective read rate was 96.67%, the Q20 range was 93.03% to 97.53%, the average Q20 was 96.12%, the Q30 range was 85.03% to 94.01%, and the average Q30 was 91.16%, indicating that the sequencing data was relatively accurate and the base error rate was low ( Figure 1 Clean reads were mapped to the longan reference genome, with an average mapping rate of 90.19% and an average coverage of 68.08%, respectively. The data met the requirements for variation analysis.

[0050] 4. SNP site identification and filtering

[0051] Clean reads from each sequencing material were mapped to the longan reference genome using samtools. The resulting Bam files were used for variant analysis using GATK. Bi-allelic SNPs located on the chromosomes were extracted, and SNPs with QD < 2, MQ < 40, FS > 60, SOR > 5, MQRankSum < -8.0, and ReadPosRankSum < -4.0 were filtered out. Linkage disequilibrium analysis was performed using plink2, and loci with low allele frequency (maf < 0.05), low genotype frequency (geno < 0.5), and linkage (indep-pairwise 50100.1) were filtered out.

[0052] Through variation analysis, a total of 12,463,156 variant sites on chromosomes were identified, including 11,250,245 SNP sites, of which 1,1094,725 were biallelic SNP sites. After removing low-quality sites, 8,826,918 SNP sites remained. After filtering out sites with low allele frequency (maf<0.05) and low genotype frequency (geno<0.5), 1,178,832 SNP sites remained. Through linkage disequilibrium analysis, after filtering out possible linked sites, 59,658 biallelic SNP sites annotated to chromosomes were finally obtained (Table 3). These SNP sites are evenly distributed on the chromosome, with an overall distribution density of 133 bp / Mbp, and the distribution density within each chromosome varies slightly ( Figure 2 ).

[0053] Table 3 Identification and filtering of SNPs

[0054]

[0055]

[0056] In addition, the obtained SNP sites were annotated and statistically analyzed using snpEff software in combination with genome annotation information. The details are as follows: SnpEff software was used to annotate the 59,658 SNP sites obtained in combination with the reference genome gene annotation information. The results showed that 40.93% of SNPs were located in intergenic regions, 22.73% and 23.99% of SNPs were located near genes (5Kb upstream and 5Kb downstream), 6.95% were located in gene introns, and 5.17% were located in exons ( Figure 3a). Of these variant sites on the exons, 59.47% are missense mutations that result in amino acid substitutions, 38.55% are silent mutations that do not result in amino acid changes, and 1.98% are nonsense mutations that result in frameshifts. ( Figure 3 b), the ratio of missense mutation to silent mutation was 1.54. Among the 209 longan resources, the proportion of homozygous genotypes consistent with the reference gene was 35.65% to 67.38%, with an average of 49.23%, the proportion of homozygous genotypes consistent with the minor allele was 4.69% to 33.82%, with an average of 21.67%, and the proportion of heterozygous genotypes was 4.70% to 19.92%, with an average of 11.72% ( Figure 3 c), indicating that the selected SNP polymorphism is good. There are 6 types of SNP mutations: A / G, C / T, A / C, A / T, C / G, and G / T. Among them, purine (A / G) is replaced by purine, or pyrimidine (C / T) is replaced by pyrimidine. This type of mutation is called transitions (Ts). Purine is replaced by pyrimidine (A / C and A / T), or pyrimidine is replaced by purine (C / G and G / T). This type of mutation is called transversion. Ts / Tv is an important indicator for evaluating the quality of SNP detection. In the 209 longan sequencing populations, Ts / Tv ranged from 2.23 to 3.02, with an average of 2.76 ( Figure 3 c), which is slightly higher than the SNPTs / Tv value identified based on resequencing data, but is within the normal range, indicating that the false positive rate of the identified SNP sites is low.

[0057] 5. KASP Marker Development

[0058] SNPs with a polymorphism greater than 40% and no other variants within 100 bp upstream and downstream of the locus were screened. Sequences within the 100 bp upstream and downstream of the locus (including the locus) were used as template sequences for batch primer design using Primer3. Primer design criteria included a GC content of 40%-60%, a primer length of 20-30 bp, and a TM value of 58-62°. A set of KASP primers was designed for each locus, consisting of two forward competitive primers and one reverse universal primer. The 3'-terminal base of one forward primer must correspond to the reference locus, and the 3'-terminal base of the other forward primer must correspond to the allele locus. The product length was 100-120 bp. Fluorescent probe-matching adapters (gaaggtgaccaagttcatgc and gaaggtcggagtcaacggatt) were added to the 5' ends of the two forward primers, respectively. A random sample of 124 primers meeting these criteria were commissioned for synthesis by Sangon Biotech (Shanghai) Co., Ltd.

[0059] 79 representative longan varieties from 209 natural populations were selected as validation materials for KASP markers. Genomic DNA was extracted according to the above method, and the DNA concentration of each sample was measured using a microspectrophotometer. Allele amplification reaction system consisted of 0.72 μL DNA template, 0.06 μL FAM primer (hereinafter referred to as FAM primer, which can amplify allele type 1 and contains an adapter sequence that matches the fluorescent probe FAM) (10 μmol / L), 0.06 μL HEX primer (hereinafter referred to as HEX primer, which can amplify allele type 2 and contains an adapter sequence that matches the fluorescent probe HEX) (10 μmol / L), 0.16 μL reverse primer (COM) (10 μmol / L), and 2 μL 2× PAMR8Pro PCR reagent, supplemented with ultrapure water to 4 μL. Before spotting, the primers and ultrapure water were premixed according to the reaction system ratio to reduce the number of spotting times. A negative control (NTC) with ultrapure water as the DNA template was designed for each primer set and the spots were performed using a micropipette.

[0060] After loading, the 384-well PCR plate was sealed and placed in an ABI QuantStudio 6Flex fluorescent quantitative PCR instrument for amplification using the following protocol: pre-denaturation at 95°C for 15 minutes; 10 cycles of denaturation at 94°C for 10 seconds, annealing and extension at 61–55°C for 1 minute, with the temperature decreasing by 0.6°C each cycle; and 28 cycles of denaturation at 95°C for 20 seconds and annealing at 55°C for 1 minute. Fluorescence detection was performed after the PCR reaction.

[0061] Genotyping was performed using QuantStudio software, which comes with the fluorescence quantitative PCR instrument. Markers that displayed only one genotype or that failed to type in more than 20% of samples were removed. Data were clustered using red, green, and blue colors, with red indicating the homozygous reference genotype as 1, blue indicating the homozygous allele as 2, and green indicating the heterozygous genotype as 3. Missing bases or sites that could not be typed were marked as 0. The genotypes of each sample were statistically analyzed, and markers that performed well for all samples were selected as candidate core markers.

[0062] Of the 59,658 SNP sites screened, 19,765 had no other variants within 100 bp upstream and downstream of the site. After polymorphism filtering, 16,628 SNP sites remained, and 4,129 sites met the design criteria for KASP marker primers. 124 primer sets with uniform distribution and high amplification efficiency were randomly selected to detect these gene sites in 79 representative longan accessions. 114 primer sets (92%) were able to detect the target sites. Among them, 24 primer sets (Table 4) amplified samples with fewer missing genotypes, and samples of different genotypes could be well separated ( Figure 4), indicating that these KASP markers had a good typing effect. The PIC of these 24 loci in the tested samples was 0.66-0.80, with good polymorphism (Table 5), and they can be used as alternative core markers for the construction of DNA fingerprints.

[0063] Table 424 groups of KASP marker primers successfully detected

[0064]

[0065]

[0066]

[0067]

[0068] Table 5 KASP marking information

[0069]

[0070]

[0071] 6. Construction of Longan Fingerprint

[0072] Cluster analysis was performed on 79 longan accessions using candidate core markers with good genotyping results and PIC values ​​greater than 0.35 (Table 5). If there were any accessions with identical marker genotypes, additional candidate markers were added until all accessions could be distinguished. Finally, the genotype data for each accession was batch-generated into QR codes using qrencode, resulting in DNA fingerprints for the 79 longan accessions.

[0073] In order to establish an accurate and rapid method for molecular identification of longan germplasm resources, the KASP marker with better typing effect (Table 5 above) was selected to perform statistics on the genotypes of each material. The results showed that the number of differential sites between each material was ≥2 ( Figure 5 ), 24 KASP markers can distinguish all materials and can be used for identification of longan germplasm ( Figure 6 ).

[0074] In addition, to construct the DNA fingerprint of each germplasm, the genotypes of the 24 markers of each germplasm were marked, with the 0 / 0 genotype marked as 1, the 1 / 1 genotype marked as 1, the 0 / 1 genotype marked as 3, and the missing genotype marked as 0. The genotypes of these markers were converted into a 24-bit identity number as the fingerprint code of the DNA fingerprint of each germplasm. The identity number was further generated into a barcode and a QR code for sample management and germplasm informationization (see Figures 7a to 7g ).

[0075] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions of the present invention, which should all be covered by the scope of the claims of the present invention.

Claims

1. The KASP marker combination used for the construction of the longan DNA fingerprint library, the positions and genotypes of each KASP marker are as follows: 。 2. A KASP labeled primer for constructing a longan DNA fingerprint library, characterized in that: The KASP marker primers are used to amplify and detect the KASP marker according to claim 1.

3. The KASP labeled primer according to claim 2, characterized in that The primer sequences for amplifying KASP marker 1 to KASP marker 24 are as follows:

4. The KASP labeled primer according to claim 3, characterized in that The 5' ends of forward primer 1 and forward primer 2 for amplifying KASP marker 1 to KASP marker 24 are independently connected to different adapter sequences matching the fluorescent-labeled probe to distinguish different genotypes.

5. The KASP labeled primer according to claim 4, characterized in that Forward primer 1 detects genotype 1 in the allele. Forward primer 1 is connected to a linker matching the fluorescent labeled probe FAM at the 5' end, and its sequence is: gaaggtgaccaagttcatgct; forward primer 2 detects genotype 2 in the allele. Forward primer 2 is connected to a linker matching the fluorescent labeled probe HEX at the 5' end, and its sequence is: gaaggtcggagtcaacggatt.

6. A detection product, characterized in that: The method comprises the KASP labeled primer according to any one of claims 2 to 5.

7. The detection product according to claim 6, characterized in that: Testing products include testing kits or testing reagents.

8. A longan DNA fingerprint library, characterized in that: It consists of the KASP marker combination described in claim 1.

9. The longan DNA fingerprint library according to claim 8, characterized in that The longan DNA fingerprint library information is shown in Figures 7a to 7g.

10. Use of the KASP labeled primer according to any one of claims 2 to 5, or the detection product according to claim 6 or 7, or the longan DNA fingerprint library according to claim 8 or 9, including identification and differentiation of longan germplasm.

Images