SNP (Single Nucleotide Polymorphism) molecular marker related to flavone content of mung bean seeds and application of SNP molecular marker

Abstract

The invention discloses an SNP molecular marker related to the flavone content of mung bean seeds and application of the SNP molecular marker, and belongs to the technical field of molecular genetic breeding. The SNP molecular marker is located on Chr215977183 on a second chromosome of a mung bean genome and has a base polymorphic site T / C; the flavone content of individuals with genotypes of TT and CT is higher than that of individuals with genotypes of CC. The KASP marker associated with the flavone content of the mung bean seeds is developed and subjected to genetic typing, the sample genetic typing effect is obvious, the flavone content of the mung bean seeds can be sensitively and efficiently predicted at low cost, large-scale molecular marker screening and cultivation of mung beans with high flavone content in the field are facilitated, functional molecular breeding of the mung beans is assisted, and the breeding process is further shortened.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetic breeding, in particular to a SNP molecular marker related to the flavonoid content of mung bean seeds and an application thereof. Background Art

[0002] Mung bean (Vigna radiata L.) is an important coarse grain crop and a food and medicine crop. Mung bean seeds are rich in active substances, such as flavonoids, polyphenols, and pigments. Flavonoids are a large family of over 5,000 polyphenolic compounds, including flavones, flavonols, flavanols, anthocyanins, catechins, and isoflavones.

[0003] The medicinal uses of flavonoids have attracted considerable attention. They have been shown to slow the aging of the nervous system, immune organs, reproductive system, liver, and skin, and to help prevent osteoporosis, cardiovascular disease, Alzheimer's disease, and breast cancer. However, flavonoids cannot be directly synthesized in the human body and must be obtained through food, making the study of flavonoids in food particularly important. Mung beans are commonly consumed as bean sprouts, mung bean soup, and bean flour. In recent years, the flavonoids in mung beans have been extracted and identified, including isoflavones such as daidzein and genistein, as well as vitexin and isovitexin. Therefore, screening mung bean germplasm with high flavonoid content can increase the trading value of mung beans and increase farmers' economic benefits. Summary of the Invention

[0004] The present invention aims to provide SNP molecular markers associated with the flavonoid content of mung bean seeds and their applications to address the aforementioned problems of the prior art. By conducting genome-wide association analysis on the flavonoid content of mung bean seed populations across multiple years and locations, the present invention discovered a SNP locus significantly associated with seed flavonoid content and developed a corresponding KASP marker. This marker was used to accurately genotype mung bean materials with varying seed flavonoid content. The sample genotyping results were significant, providing mung bean researchers with molecular markers that can be used in marker-assisted selection, accelerating the process of marker-assisted breeding of new varieties.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] One of the technical solutions of the present invention is a SNP molecular marker related to the flavonoid content of mung bean seeds, wherein the SNP molecular marker is located at Chr2_15977183 on chromosome 2 of the mung bean genome and has a base polymorphic site T / C;

[0007] The flavonoid content in individuals with genotypes TT and CT was higher than that in individuals with genotype CC.

[0008] The second technical solution of the present invention is a specific primer, which includes forward primers as shown in SEQ ID NO.2 and SEQ ID NO.3 and a reverse primer as shown in SEQ ID NO.4.

[0009] The third technical solution of the present invention is a product for identifying the flavonoid content of mung bean seeds, comprising the specific primers.

[0010] A fourth technical solution of the present invention is the use of the SNP molecular marker or the specific primer in identifying the flavonoid content of mung bean seeds.

[0011] The fifth technical solution of the present invention is a method for identifying the flavonoid content of mung bean seeds using the SNP molecular marker, extracting the mung bean genomic DNA to be tested, and using the specific primers to detect the genotype of the SNP molecular marker. The flavonoid content in individuals with genotypes TT and CT is higher than that in individuals with genotype CC.

[0012] The sixth technical solution of the present invention is the use of the SNP molecular marker or the specific primer in cultivating mung bean varieties with high flavonoid content.

[0013] The seventh technical solution of the present invention is a method for cultivating a mung bean variety with a high flavonoid content, which comprises extracting genomic DNA of the mung bean to be tested, detecting the genotype of the SNP molecular marker using the specific primers, and selecting individuals with genotypes of TT and CT for breeding.

[0014] Based on the above technical solution, the present invention has the following technical effects:

[0015] This study used 389 natural mung bean populations as test subjects and, using whole-genome analysis, identified a significantly associated single-nucleotide polymorphism (SNP) site, Chr2_15977183. A primer set was designed based on the target SNP site, and a KASP molecular marker, associated with the flavonoid content of mung bean seeds, was developed. This marker, applied to the breeding of high-flavonoid varieties, can be used to identify or assist in the identification of flavonoid content in mung bean seeds. The KASP molecular marker of the present invention enables high-throughput detection of multiple samples, with significant genotyping efficiency, facilitating marker-assisted screening of high-flavonoid breeding materials in the field and accelerating the mung bean breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0017] Figure 1This is the result of genome-wide association analysis of flavonoid content in mung bean seeds at multiple locations over multiple years.

[0018] Figure 2 This is the result of detecting the allele type related to flavonoid content in different genotype materials using KASP molecular markers.

[0019] Figure 3 This is a comparison chart of the differences in flavonoid content in seeds of mung bean materials with different genotypes. DETAILED DESCRIPTION

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0022] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0023] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the present invention. The present description and examples are intended to be illustrative only.

[0024] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0025] Unless otherwise specified, the technical solutions described in the present invention are all conventional solutions in the field, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0026] The embodiment of the present invention provides a SNP molecular marker related to the flavonoid content of mung bean seeds. The SNP molecular marker is located on Chr2_15977183 on chromosome 2 of the mung bean genome and has a base polymorphic site T / C.

[0027] The flavonoid content in individuals with genotypes TT and CT was higher than that in individuals with genotype CC.

[0028] The embodiment of the present invention also provides specific primers, including forward primers shown as SEQ ID NO.2 and SEQ ID NO.3 and a reverse primer shown as SEQ ID NO.4.

[0029] The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO. 2, and the nucleotide sequence of the forward primer F2 is shown in SEQ ID NO. 3.

[0030] In some specific embodiments, the 5' end of the forward primer F1 is connected to the FAM fluorescent tag sequence "GAAGGTGACCAAGTTCATGCT"; the 5' end of the forward primer F2 is connected to the HEX fluorescent tag sequence "GAAGGTCGGAGTCAACGGATT";

[0031] The embodiment of the present invention also provides a product for identifying the flavonoid content of mung bean seeds, including the specific primers.

[0032] The embodiment of the present invention also provides the use of the SNP molecular marker or the specific primer in identifying the flavonoid content of mung bean seeds.

[0033] The embodiment of the present invention also provides a method for identifying the flavonoid content of mung bean seeds using the SNP molecular marker. The genomic DNA of the mung bean to be tested is extracted, and the genotype of the SNP molecular marker is detected using the specific primer. The flavonoid content in individuals with genotypes TT and CT is higher than that in individuals with genotype CC.

[0034] The embodiment of the present invention also provides the use of the SNP molecular marker or the specific primer in cultivating mung bean strains with high flavonoid content.

[0035] The embodiment of the present invention also provides a method for cultivating a mung bean strain with a high flavonoid content, which comprises extracting genomic DNA of the mung bean to be tested, detecting the genotype of the SNP molecular marker using the specific primers, and selecting individuals with genotypes of TT and CT for breeding.

[0036] The present invention relates to a KASP marker associated with the flavonoid content of mung bean seeds. The nucleotide sequence of the KASP marker is shown in SEQ ID NO. 1. A primer set is designed based on a target single nucleotide polymorphism (SNP) site, comprising forward primers F1 and F2, and a reverse primer R. The SNP site exhibits a nucleic acid polymorphism T / C, with T being the superior haplotype. The present invention develops a KASP marker associated with the flavonoid content of mung bean seeds and performs genotyping. The sample genotyping results are significant, enabling sensitive, efficient, and low-cost prediction of the flavonoid content of mung bean seeds. This facilitates large-scale molecular marker screening and cultivation of high-flavonoid-content mung beans in the field, assists in functional molecular breeding of mung beans, and further shortens the breeding process.

[0037] Example 1

[0038] Discovering significant association loci regulating flavonoid content in mung bean seeds through genome-wide association analysis

[0039] The SNP variant sites associated with the flavonoid content in mung bean seeds of the present invention are obtained by the following steps:

[0040] The mung bean materials and SNP molecular marker materials used in this study were provided by the mung bean research group at the Institute of Economic Crops, Jiangsu Academy of Agricultural Sciences. The 389 mung bean accessions used for genome-wide association analysis were propagated in 2022 and 2023 at the Jiangsu Academy of Agricultural Sciences experimental base in Nanjing and Hainan. A randomized block design was used. Field management practices were followed, including appropriate fertilization and watering, and regular weeding and insecticide control. Mung bean seeds were harvested at maturity for subsequent experiments.

[0041] Mung bean seeds were harvested at maturity, dried, crushed in a grinder, sieved, and stored sealed and dry at 4°C for determination of flavonoid content in the seeds. Flavonoid content was determined using the aluminum chloride-sodium nitrite method, using rutin as the standard. Flavonoid content was calculated in mg / g.

[0042] Using the Sulu 1 reference genome (GenBank accession number: GCA_050395885.1), 389 mung bean accessions were resequenced. Vcftools v0.1.16 was used to remove SNPs with a deletion rate greater than 80% and a minor allele frequency (MAF) less than 5%. A total of 4,875,143 SNPs were included. A significance threshold of P ≤ 1 / 4,875,143 = 2.05E-07 and a -log10(P) ≥ 6.69 were used. SNPs with a -log10(P) ≥ 6.69 were identified as significantly associated loci. Genome-wide association analysis was performed using the R package rMVP on flavonoid content in mung bean seeds from natural populations under multiple environments. A general linear model (GLM) was used to analyze the association. A SNP, Chr2_15977183, was found to be significantly associated with flavonoid content in mung bean seeds. The polymorphism at this site is T / C.

[0043] Among the 389 mung bean accessions (Table 1), 296 individuals with the CC genotype had seed flavonoid contents of 0.96 and 1.44 mg / g in the two environments, respectively, with an average seed flavonoid content of 1.20 mg / g. For 83 individuals with the CT genotype, seed flavonoid contents were 1.10 and 1.60 mg / g in the two environments, respectively, with an average seed flavonoid content of 1.35 mg / g. For 10 individuals with the TT genotype, seed flavonoid contents were 1.51 and 2.10 mg / g in the two environments, respectively, with an average seed flavonoid content of 1.82 mg / g. Accessions with the TT and CT genotypes had higher flavonoid contents than those with the CC genotype.

[0044] Table 1 Seed flavonoid content and genotype of 389 mung bean materials

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055] Example 2

[0056] Development of KASP molecular markers related to flavonoid content in mung bean seeds

[0057] Based on the sequence of the SNP variant site on the genome (located at position 22 of the sequence shown in SEQ ID NO.1), primers for the SNP variant site were designed using Primer Premier 5.0, including forward primer F1 (SEQ ID NO.2), forward primer F2 (SEQ ID NO.3), and reverse primer R (SEQ ID NO.4). F1 and F2 contain FAM and HEX fluorescent linker sequences, respectively, and the sequences are as follows:

[0058] SEQ ID NO.1: GCTGAGCGAATCAACCAATCCT / CAAGGAGCAAAAGTCAAT AATTCGCTAAGCGCACCAGTATTGGTTCCTTTTCTGCTGTAATTCGCTTAGC;

[0059] KASP marker forward primer F1 sequence, SEQ ID NO. 2: 5′-GAAGGTGACCAAGTTCATGCTGCTGAGCGAATCAACCAATCC-3′;

[0060] KASP marker forward primer F2 sequence, SEQ ID NO. 3: 5′-GAAGGTCGGAGTCAACGGATTGCTGAGCGAATCAACCAATCT-3′;

[0061] KASP tag reverse primer R sequence, SEQ ID NO. 4: 5'-CTTTTCTGCTGTAATTCGCT TAGC-3'.

[0062] Note: The bold part in the sequence represents the fluorescent tag sequence.

[0063] Example 3

[0064] Application of KASP molecular markers in identification of alleles related to flavonoid content in mung bean seeds

[0065] The CTAB method was used to extract genomic DNA from leaf tissues of 37 mung bean seed materials harvested in Nanjing in 2023. The extracted DNA (30-50 ng / μL) was used as a template for PCR amplification, fluorescence signal collection, and genotyping on the Thermo Fisher Scientific real-time fluorescence quantitative instrument QuantStudio 5.

[0066] The amplification system was a 10.0 μL reaction system: 2 μL mung bean DNA template (30-50 ng / μL), 5 μL 2×KASP MasterMix (LGC Biotechnology, UK), 1 μL primer working solution (F1:F2:R=1:1:3), and 2.0 μL ddH2O.

[0067] Amplification program: The first step is to set the pre-denaturation at 94℃ for 15 minutes, 1 cycle; the second step is to perform 10 cycles of program: denaturation at 94℃ for 20 seconds, annealing at 61-55℃ for 60 seconds, where the annealing temperature is reduced by 0.6℃ for each cycle; the third step is to set the denaturation at 94℃ for 20 seconds, annealing temperature at 55℃ for 60 seconds, and perform 26 cycles; after the fourth cycle, the condition is extended at 30℃ for 60 seconds; finally, after the amplification is completed, the fluorescent signal of the product and genotyping are directly read using the Thermo Fisher real-time fluorescence quantitative instrument QuantStudio5.

[0068] 37 mung bean materials were amplified and genotyped using KASP labeled primers (Table 2). The fluorescence signal collection results showed that 9 mung bean materials clustered and displayed blue, with a genotype of TT; 17 mung bean materials clustered and displayed red, with a genotype of CC, of ​​which 11 mung bean materials clustered and displayed green, with a genotype of CT ( Figure 2 ).

[0069] The flavonoid content in 37 mung bean seeds of different genotypes was evaluated using GraphPad 8.0 software. Figure 3 As shown in the figure, the flavonoid content in the materials with genotypes TT and CT was higher than that in the material with genotype CC, and the difference reached an extremely significant level, indicating that the KASP marker meets the requirements for identifying genotypes with different flavonoid contents in mung bean seeds, and can be used as a molecular marker to assist in the selection and breeding of mung bean varieties with high flavonoid content ( Figure 3 ).

[0070] Table 2 Genotypes and phenotypes of mung bean materials used for KSAP marker typing

[0071]

[0072]

[0073] Obviously, the above embodiments of the present invention are merely examples for the purpose of clearly illustrating the present invention and are not intended to limit the implementation methods of the present invention. A person skilled in the art will be able to make other variations or modifications based on the above description. It is not necessary and impossible to enumerate all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the claims of the present invention.

Claims

1. A SNP molecular marker associated with the flavonoid content of mung bean seeds, characterized in that: The SNP molecular marker is located at Chr2_15977183 on chromosome 2 of the mung bean genome, and has a base polymorphic site T / C; The flavonoid content in individuals with genotypes TT and CT was higher than that in individuals with genotype CC.

2. A specific primer, characterized in that: It includes forward primers as shown in SEQ ID NO.2 and SEQ ID NO.3 and a reverse primer as shown in SEQ ID NO.

4.

3. A product for identifying the flavonoid content of mung bean seeds, characterized in that: The method comprises the specific primer according to claim 2.

4. Use of the SNP molecular marker according to claim 1 or the specific primer according to claim 2 in identifying the flavonoid content of mung bean seeds.

5. A method for identifying the flavonoid content of mung bean seeds using the SNP molecular marker according to claim 1, characterized in that: Extract the mung bean genomic DNA to be tested, and use the specific primers described in claim 2 to detect the genotype of the SNP molecular marker. The flavonoid content in individuals with genotypes TT and CT is higher than that in individuals with genotype CC.

6. Use of the SNP molecular marker according to claim 1 or the specific primer according to claim 2 in breeding mung bean strains with high flavonoid content.

7. A method for cultivating a mung bean strain with high flavonoid content, characterized in that: Extract the mung bean genomic DNA to be tested, use the specific primers described in claim 2 to detect the genotype of the SNP molecular marker, and select individuals with genotypes of TT and CT for breeding.

Images