KASP molecular marker, primer group and kit related to drought-enduring character of mung bean in germination period, and application of KASP molecular marker, primer group and kit
By developing KASP molecular markers related to drought tolerance during the germination period of mung bean and designing specific primers using SNP sites for PCR detection, the shortcomings of research on drought tolerance during the germination period of mung bean were solved, and efficient identification and breeding improvement were achieved.
Patent Information
- Application Number
- CN202510871637.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-26
- Publication Date
- 2025-09-23
AI Technical Summary
The existing technology lacks effective genetic markers for studying drought tolerance of mung bean during the germination period, resulting in a significant decrease in the germination rate of mung bean seeds under drought stress, affecting mung bean production.
Develop KASP molecular markers related to drought tolerance during the germination period of mung bean, design specific primers using single nucleotide polymorphism sites for competitive allele-specific PCR detection, and achieve efficient identification of drought tolerance during the germination period of mung bean.
The KASP molecular marker can be used to quickly and accurately identify the drought tolerance of mung beans during the germination period, which improves the efficiency of molecular marker-assisted selection, simplifies the mung bean breeding process, and improves the efficiency of screening and improving drought-tolerant varieties.
Smart Images

Figure CN120683299A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of crop molecular breeding, and in particular to a KASP molecular marker, a primer set, a kit and applications thereof related to the drought-resistance trait of mung bean during germination. Background Art
[0002] How crops adapt to soil environments in the context of global climate change is one of the world's major scientific challenges. Drought is the world's most widespread and destructive natural disaster, directly impacting crop germination, growth, development, and yield. According to statistics, arid and semi-arid areas worldwide account for approximately 33% of the Earth's total land area, and in my country, these areas account for approximately 52.5% of the country's total land area. Crop yield reductions and losses due to drought stress rank first among all natural disaster losses. Furthermore, as global temperatures continue to rise, soil aridity is intensifying.
[0003] Mung bean (Vigna radiata (L.) R. Wilczek) is one of the most important coarse grain crops. Its seeds are consumed directly or as sprouts and are deeply loved by Chinese consumers. my country is the world's largest producer of mung beans. However, the main areas of mung bean cultivation are Northeast China, the Yellow River and Huaihe River basins, which contain large areas of arid and semi-arid land. The germination period of mung bean seeds marks the beginning of its life cycle and is also the period when it is most sensitive to the environment. Drought stress can significantly reduce the germination rate of mung bean seeds, bringing huge impacts and losses to mung bean production. However, research on stress tolerance of mung bean during the germination period is relatively limited, and no relevant genetic markers have been used for molecular breeding of mung bean. Summary of the Invention
[0004] In response to the shortcomings of the existing technology, the present invention aims to use GWAS technology to explore SNP sites related to drought tolerance of mung bean during the germination period, and provides a KASP molecular marker, primer set, kit and application related to the drought tolerance trait of mung bean during the germination period, which can be used to identify or assist in the identification of drought tolerance of mung bean during the germination period and simplify the traditional breeding process of mung bean.
[0005] To achieve the above object, the present invention provides the following technical solutions:
[0006] Single nucleotide polymorphisms (SNPs) refer to base transversions, transitions, insertions, and deletions that occur as point mutations in the genome. Designing specific primers based on SNP sites and performing competitive allele-specific PCR (KASP) testing can efficiently identify different genotypes. KASP is a simple and flexible genotyping platform. By designing KASP markers for SNPs associated with drought tolerance during the germination period of mung beans, it can be used to identify or assist in the identification of drought tolerance during the germination period of mung beans, thereby improving the efficiency of molecular marker-assisted selection for mung beans.
[0007] In a first aspect, the present invention provides a KASP molecular marker related to the drought tolerance trait of mung bean during the germination period. The KASP molecular marker related to the drought tolerance trait of mung bean during the germination period is Chr3_7230267, and the base of Chr3_7230267 is A or G.
[0008] As an implementable embodiment, the haplotype of the KASP molecular marker is A, which represents drought resistance in the germination period of mung beans.
[0009] In a second aspect, the present invention provides a primer set for identifying the KASP molecular marker related to the drought resistance trait of mung bean during the germination period, comprising two specific forward primers F1 and F2 and a reverse primer R; the nucleotide sequences of the specific forward primers F1 and F2 are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively, and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO: 4.
[0010] As an implementation method, the 5' end of the specific forward primer F1 is connected to the FAM fluorescent tag sequence GAAGGTGACCAAGTTCATGCT; the 5' end of the specific forward primer F2 is connected to the HEX fluorescent tag sequence GAAGGTCGGAGTCAACGGATT.
[0011] In a third aspect, the present invention provides a kit for identifying KASP molecular markers related to the drought tolerance trait of mung bean during germination, characterized in that it comprises the primer set.
[0012] As an implementable embodiment, it also includes KASP 2×Master Mix 5μL and ddH2O 2.0μL; the concentration of forward primer F1, forward primer F2 and reverse primer R is 10μM, the volume ratio is 1:1:3, and the total volume is 1μL; the concentration of the mung bean sample DNA template detected by the kit is 30-50ng / μL, and the addition amount is 2μL.
[0013] As an implementable embodiment, fluorescent PCR is used for detection, and the reaction procedure of the fluorescent PCR is as follows: pre-denaturation at 94°C, reaction for 15 minutes, and one cycle; denaturation at 4°C for 20 seconds, annealing at 61-55°C for 60 seconds, the annealing temperature is reduced by 0.6°C each time a cycle is performed, and 10 cycles are performed; denaturation at 94°C for 20 seconds, annealing at 55°C for 60 seconds, and 26 cycles are performed.
[0014] In a fourth aspect, the present invention provides a method for identifying the drought resistance of mung bean during the germination period, comprising: extracting DNA from a mung bean sample to be tested; using the DNA as a template, performing PCR amplification using the primer set, and performing fluorescence detection based on the obtained PCR amplification product to determine the genotype and drought resistance of the mung bean during the germination period; if the genotype of the KASP molecular marker of the mung bean sample is AA, the mung bean sample is drought-resistant during the germination period; if the genotype of the KASP molecular marker of the mung bean sample is GG, the mung bean sample is drought-sensitive during the germination period.
[0015] In a fifth aspect, the present invention provides applications of the KASP molecular marker related to the drought tolerance trait of mung bean during germination, including any one of the following applications:
[0016] Application in detecting or predicting drought resistance of mung bean during germination period;
[0017] Application in identifying or screening drought-tolerant varieties of mung bean during the germination period;
[0018] Application in molecular marker-assisted breeding of mung bean;
[0019] Application in improving drought-tolerant mung bean germplasm resources.
[0020] In a sixth aspect, the present invention provides applications of the primer set or kit, including any one of the following applications:
[0021] Application in the preparation of reagents for detecting or predicting drought resistance of mung beans during germination period;
[0022] Application in the preparation of reagents for identifying or screening drought-resistant varieties of mung beans during the germination period;
[0023] Application in the preparation of mung bean molecular marker-assisted breeding reagents;
[0024] Application in the preparation of reagents for improving drought-resistant mung bean germplasm resources.
[0025] The beneficial effects of the present invention are as follows: the present invention develops a KASP molecular marker associated with drought tolerance during the germination period of mung bean and performs genotyping, which helps to quickly and efficiently perform genotyping and haplotype typing of this site in the mung bean population, and plays an important role in predicting, identifying or assisting in identifying new mung bean varieties that are drought-tolerant during the germination period for the drought tolerance of mung bean population seeds during the germination period. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 This is a diagram showing the results of genome-wide association analysis of drought tolerance of mung beans during the germination period of the present invention.
[0027] Figure 2 This is a diagram showing the detection results of the KASP molecular marker of the present invention for the drought-resistant related allele type of mung bean during the germination period.
[0028] Figure 3 This is a comparison chart of the drought resistance differences during the germination period of mung bean materials with different genotypes of the present invention. DETAILED DESCRIPTION
[0029] The present invention will be further described in detail below with reference to specific embodiments.
[0030] It should be noted that these embodiments are only used to illustrate the present invention, rather than to limit the present invention. Simple improvements to the method based on the concept of the present invention fall within the scope of protection claimed by the present invention.
[0031] Example 1
[0032] Discovering loci significantly associated with drought tolerance during germination in mung bean through genome-wide association analysis
[0033] The 413 representative mung bean germplasm resources and high-quality, whole-genome SNP molecular markers used in this study were provided by the mung bean research group at the Institute of Economic Crops, Jiangsu Academy of Agricultural Sciences. These 413 mung bean samples were planted in 2023 at the Nanjing Experimental Base (E1) and the Hainan Experimental Base (E2). Each sample was planted in 20 holes, with 5-6 seeds per hole. A randomized block design was used, and normal field management was followed. Seeds were harvested at maturity.
[0034] Under the same environmental conditions, germination experiments were carried out under normal treatment and drought stress, with 35 seeds per culture dish and 3 replicates. The germination potential (GP) on the 2nd day and the germination rate (GR) on the 5th day were respectively counted for the mung bean materials harvested under the two environmental conditions (E1 and E2). The present invention uses the ratio of germination potential and germination rate under drought treatment and normal treatment for subsequent analysis. Descriptive statistical analysis was carried out for relative germination potential (RGP) and relative germination rate (RGR). As can be seen from Table 1, the relative germination potential of mung bean seeds harvested under the growth conditions of Nanjing (E1) and Hainan (E2) varied from 0% to 80.88% and 0% to 94.30% respectively, and the relative germination rate varied from 0% to 100.00% and 0% to 100.00% respectively, and the coefficient of variation was greater than 30%, indicating that there was a large variation in the relative germination potential (RGP) and relative germination rate (RGR) under the two environments (E1 and E2), and genome-wide association analysis could be performed.
[0035] Table 1 Descriptive statistical analysis of relative germination traits of mung bean seeds under drought stress conditions
[0036]
[0037] Using Sulu No. 1 as the reference genome, 413 mung bean accessions were resequenced. SNPs with a deletion rate greater than 50% and a minor allele frequency (MAF) less than 5% were removed using Vcftools v0.1.16. The significance threshold was determined to be 5.28E-06, or -log(P) = 6.27. A genome-wide association analysis was conducted using the R package rMVP on relative germination potential and relative germination rate under drought stress during the germination period of mung bean under multiple environments. A mixed linear model (MLM) was used for analysis. The results are shown in the table. Figure 1 The results showed that a significantly associated SNP site could be detected at the 7,230,267bp position on chromosome 3, and the site was detected in both Nanjing (EI) and Hainan (E2) environments, as well as in relative germination potential and relative germination rate. There were two haplotypes (A / G) at this site.
[0038] Example 2
[0039] Development of KASP molecular markers related to drought tolerance during germination period in mung bean
[0040] Based on the genomic sequence of the SNP variant site (SEQ ID NO: 1), primers for the SNP variant site were designed using Primer Premier 5.0. These primers included a first upstream primer F1, a second upstream primer F2, and a reverse primer R. F1 and F2 contained FAM and HEX fluorescent linker sequences, respectively. The 5' end of the first upstream primer F1 was linked to the FAM fluorescent tag sequence "GAAGGTGACCAAGTTCATGCT," while the 5' end of the second upstream primer F2 was linked to the HEX fluorescent tag sequence "GAAGGTCGGAGTCAACGGATT."
[0041] The nucleotide sequence of the SNP site is SEQ ID NO: 1:
[0042] AGAAGTTACAAATGAGGATCAAAATA (or G)GATTAAATATTTAAAAAAAAAAATTTAAGGTACAAATATTGTATTTATTGTGT TAAAGAGGAAATGAAAATTTGAAGTAATTATTTATAGAAACCTAAAGTACCACGGTGTG.
[0043] The sequence of the first upstream primer F1 is SEQ ID NO: 2:
[0044] 5'-AGAAGTTACAAATGAGGATCAAAATA-3';
[0045] The sequence of the second upstream primer F2 is SEQ ID NO: 3:
[0046] 5'-GAAGTTACAAATGAGGATCAAAATG-3';
[0047] The sequence of the downstream primer R is SEQ ID NO: 4:
[0048] 5'-TGATGATAACACATTTGACCACTCT-3'.
[0049] Example 3
[0050] Detection of SNP genotypes in different mung bean materials and its application
[0051] The DNA of 36 mung bean leaf tissues was used as a template and PCR amplification was performed using the above primer set. After the set program was completed, the PCR amplification, fluorescence signal collection and genotyping were performed using the Thermo Fisher Scientific real-time fluorescence quantitative instrument QuantStudio 5.
[0052] Preparation of KASP molecular marker primer working solution: To reduce experimental error during sample addition, a primer mix working solution was used for PCR amplification. 10 μM upstream and downstream primers were mixed in a 1:1:3 ratio, for example, 10 μL each of upstream primers F1 and F2 and 30 μL of downstream primer were mixed evenly. This was used as the KASP molecular marker primer working solution. The concentration of mung bean leaf DNA was adjusted to 30-50 ng / μL, and a 10.0 μL reaction system was loaded. The sample volumes added were as follows: 2 μL of mung bean sample DNA template (30-50 ng / μL); 5 μL of KASP 2× Master Mix (LGC Biotechnology, UK); 1 μL of primer set working solution; and 2.0 μL of ddH2O.
[0053] The reaction procedure for KASP molecular marker application is as follows: first, adjust the pre-denaturation to 94°C for 15 minutes, and perform one cycle; then, denaturation at 4°C for 20 seconds, annealing at 61-55°C for 60 seconds, and the annealing temperature is reduced by 0.6°C each cycle, and 10 cycles are performed; then, denaturation at 94°C for 20 seconds, annealing at 55°C for 60 seconds, and 26 cycles are performed. After completion of amplification, the products are directly read for fluorescence signal and genotyping using the Thermo Fisher Scientific real-time fluorescence quantitative instrument QuantStudio 5.
[0054] The KASP labeled primers were used to amplify and genotype 35 mung bean materials (Table 2). The results showed that the KASP marker could distinguish the test materials by two fluorescent colors. The upstream primer F1 containing the FAM fluorescent label could combine to amplify the genotype sequence, and the fluorescent signal was red. The genotype of 11 mung bean samples was AA. The upstream primer F2 containing the HEX fluorescent label could combine to amplify the genotype sequence, and the fluorescent signal was blue. The genotype of 24 mung bean samples was GG. The typing results of the test materials using the KASP marker were consistent with the known sequenced genotypes (Table 2, Figure 2 GraphPad 8.0 software was used to evaluate and analyze the relative germination potential (RGP) and relative germination rate (RGR) of 35 mung bean genotypes. Figure 3 As shown in the data, the relative germination potential (RGP) and relative germination rate (RGR) of the genotype AA material were significantly higher than those of the genotype GG material, indicating that the above-mentioned KASP molecular marker can be used to identify the drought tolerance of mung bean seeds during the germination period.
[0055] Table 2 Relative germination of 35 mung bean seed materials with different genotypes under drought stress conditions
[0056]
[0057]
[0058] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes can be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.
Claims
1. A KASP molecular marker related to drought tolerance during the germination period of mung bean, characterized in that: The KASP molecular marker related to the drought resistance trait of mung bean during the germination period is Chr3_7230267, and the base of Chr3_7230267 is A or G.
2. The KASP molecular marker related to drought tolerance during the germination period of mung bean according to claim 1, characterized in that: The haplotype A of the KASP molecular marker is mung bean that is drought-resistant during the germination period.
3. A primer set for identifying the KASP molecular marker related to the drought tolerance trait of mung bean during germination period according to claim 1, characterized in that: It comprises two specific forward primers F1 and F2 and a reverse primer R; the nucleotide sequences of the specific forward primers F1 and F2 are shown in SEQ ID NO: 2 and SEQ ID NO: 3 respectively, and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO:
4.
4. The primer set according to claim 3, characterized in that The 5' end of the specific forward primer F1 is connected to the FAM fluorescent tag sequence GAAGGTGACCAAGTTCATGCT; the 5' end of the specific forward primer F2 is connected to the HEX fluorescent tag sequence GAAGGTCGGAGTCAACGGATT.
5. A kit for identifying the KASP molecular marker related to the drought tolerance trait of mung bean during germination period according to claim 1, characterized in that: Comprising the primer set according to claim 3 or 4.
6. The kit according to claim 5, characterized in that It also includes KASP 2×Master Mix 5μL and ddH2O 2.0μL; the concentrations of forward primer F1, forward primer F2 and reverse primer R are 10μM, the volume ratio is 1:1:3, and the total volume is 1μL; the concentration of the mung bean sample DNA template detected by the kit is 30-50ng / μL, and the addition amount is 2μL.
7. The kit according to claim 6, characterized in that The kit uses fluorescent PCR for detection, and the reaction procedure of the fluorescent PCR is as follows: pre-denaturation at 94°C, reaction for 15 minutes, for one cycle; denaturation at 4°C for 20 seconds, annealing at 61-55°C for 60 seconds, with the annealing temperature decreasing by 0.6°C each time for 10 cycles; denaturation at 94°C for 20 seconds, annealing at 55°C for 60 seconds, for 26 cycles.
8. A method for identifying drought tolerance of mung bean during germination period, characterized in that: include: Extract DNA from the mung bean sample to be tested; Using DNA as a template, PCR amplification is performed using the primer set according to claim 3 or 4, and fluorescence detection is performed based on the obtained PCR amplification product to determine the genotype of the KASP molecular marker and the drought resistance of the mung bean during the germination period; if the genotype of the KASP molecular marker of the mung bean sample is AA, the mung bean sample is drought-resistant during the germination period; if the genotype of the KASP molecular marker of the mung bean sample is GG, the mung bean sample is drought-sensitive during the germination period.
9. Use of the KASP molecular marker related to drought tolerance during the germination period of mung bean according to claim 1 or claim 2, characterized in that: This includes any of the following applications: Application in detecting or predicting drought resistance of mung bean during germination period; Application in identifying or screening drought-tolerant varieties of mung bean during the germination period; Application in molecular marker-assisted breeding of mung bean; Application in improving drought-tolerant mung bean germplasm resources.
10. Use of the primer set according to claim 3 or 4 or the kit according to any one of claims 5 to 7, characterized in that: This includes any of the following applications: Application in the preparation of reagents for detecting or predicting drought resistance of mung beans during germination period; Application in the preparation of reagents for identifying or screening drought-resistant varieties of mung beans during the germination period; Application in the preparation of mung bean molecular marker-assisted breeding reagents; Application in the preparation of reagents for improving drought-resistant mung bean germplasm resources.