Multivalent binding nucleic acid agents

By designing a multivalent binding nucleic acid agent, using its nucleic acid chain to bind to the TDP-43 protein and inhibiting its aggregate formation, the problem of TDP-43 protein aggregation is solved and the potential therapeutic effect on neurodegenerative diseases is achieved.

CN120693403APending Publication Date: 2025-09-23INSTITUTE OF SCIENCE TOKYO
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202480013236.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-02-16
Filing Date
2024-02-16
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

Existing technologies are difficult to effectively inhibit the aggregation of TDP-43 proteins, especially the aggregation of mutant TDP-43 proteins, which leads to the occurrence of neurodegenerative diseases.

Method used

A multivalent binding nucleic acid agent has been developed, which contains two or more nucleic acid chains, each of which has a TDP-43 binding sequence and is connected by a linker or adapter sequence. It can form a multi-chain structure between TDP-43 proteins and inhibit the formation of their aggregates.

Benefits of technology

It significantly inhibited the aggregation of TDP-43 protein, stabilized its dimer, reduced its aggregation in the cytoplasm, and reduced neurotoxicity, and has potential application in the treatment of neurodegenerative diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005551270500000261
    Figure BDA0005551270500000261
  • Figure BDA0005551270500000301
    Figure BDA0005551270500000301
  • Figure BDA0005551270500000302
    Figure BDA0005551270500000302
Patent Text Reader

Abstract

The purpose of the present invention is to provide a novel nucleic acid agent capable of efficiently inhibiting TDP-43 protein aggregation. Provided are: a multivalent binding nucleic acid agent that binds to a TDP-43 protein or a fragment thereof, said multivalent binding nucleic acid agent comprising two or more nucleic acid chains, each of the two or more nucleic acid chains comprising a TDP-43 binding sequence capable of binding to a TDP-43 protein or a fragment thereof; the more than two nucleic acid chains are as follows: (1) the nucleic acid chains are combined through a linker; or (2) comprises an adapter sequence capable of forming a multiple strand between the two or more nucleic acid strands.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a multivalent binding nucleic acid agent that binds to a TDP-43 protein or a fragment thereof, and a pharmaceutical composition for preventing or treating a neurodegenerative disease. Background Art

[0002] Amyotrophic lateral sclerosis (ALS) is a chronic neurological disease characterized by the degeneration of motor neurons, leading to a decrease in muscle strength throughout the body. Its primary symptoms are muscle atrophy and decreased strength. As the disease progresses, limb and trunk dysfunction, gait problems, and dysarthria and swallowing disorders can develop in the brain and nervous system, ultimately leading to respiratory impairment caused by paralysis of the respiratory muscles.

[0003] RNA-binding proteins such as TDP-43 are known to be involved in ALS. In particular, while approximately 90% of TDP-43 is located in the nucleus in normal neurons, in degenerated ALS neurons, it accumulates almost entirely in cytoplasmic inclusion bodies and disappears from the nucleus. Therefore, it is believed that in degenerated ALS neurons, TDP-43 aggregates exert toxic effects in the cytoplasm while simultaneously losing their function in the nucleus.

[0004] Previous studies using transgenic mice have shown that overexpression of wild-type human TDP-43 protein leads to motor neuron degeneration and the development of symptoms similar to ALS. Similarly, expression of mutant TDP-43 protein, a form of hereditary ALS, has also been associated with ALS-like symptoms. These results suggest that overexpression of both wild-type and mutant TDP-43 protein leads to toxicity in motor neurons and other tissues.

[0005] Patent Documents 1 and 2 disclose that TDP-43 protein is an RNA-binding protein. Based on this, UGGAA repeats and UG repeats were discovered as base sequences that bind to TDP-43 protein. Decoy nucleic acids containing these repeats can effectively inhibit the aggregation of TDP-43 protein.

[0006] New technologies are needed to further enhance the aggregation inhibition effect of TDP-43 protein based on high-affinity binding sequences.

[0007] Prior art literature

[0008] Patent Literature

[0009] Patent Document 1: WO 2016 / 088797

[0010] Patent Document 2: WO 2020 / 027311 Summary of the Invention

[0011] Problems to be solved by the invention

[0012] The purpose is to provide a novel nucleic acid agent that can effectively inhibit TDP-43 protein aggregation.

[0013] Technical solutions to solve problems

[0014] To address the above-mentioned issues, the present inventors have developed a bivalent binding nucleic acid agent that introduces a spacer between two TDP-43 binding sequences that can control the interaction between TDP-43 proteins. The bivalent binding nucleic acid agent of the present invention can effectively inhibit the formation of aggregates of TDP-43 proteins based on the spacer disposed between the TDP-43 binding sequences, and also exhibits a significant effect of inhibiting aggregation of mutant TDP-43 proteins that are prone to aggregation due to their inability to form dimers. It was further discovered that the two TDP-43 binding sequences that make up the nucleic acid agent of the present invention cooperate with each other to help TDP-43 proteins form dimers, and this cooperative effect is enhanced by the presence of the spacer introduced between the two.

[0015] The present invention is based on the above findings and provides the following.

[0016] (1) A multivalent binding nucleic acid agent that binds to a TDP-43 protein or a fragment thereof, wherein:

[0017] The nucleic acid agent comprises two or more nucleic acid chains, each of the two or more nucleic acid chains comprises a TDP-43 binding sequence capable of binding to a TDP-43 protein or a fragment thereof,

[0018] The two or more nucleic acid chains: (a) are connected by a linker; or (b) contain an adapter sequence capable of forming a multiplex chain between the two or more nucleic acid chains.

[0019] (2) The nucleic acid agent according to (1), wherein the linker has rigidity and / or length capable of inhibiting the formation of aggregates of two or more monomeric TDP-43 proteins bound to the TDP-43 binding sequences of the two or more nucleic acid chains.

[0020] (3) The nucleic acid agent according to (2), wherein the inhibition of the formation of the aggregate is achieved by inhibiting the binding between the C-terminal regions of the TDP-43 protein and / or promoting the phase separation thereof.

[0021] (4) The nucleic acid agent according to any one of (1) to (3), wherein the linker comprises a nucleic acid, a peptide, a polyether group, and / or a hydrocarbon group.

[0022] (5) The nucleic acid agent according to (4), wherein the nucleic acid consists of one or 2 to 50 nucleosides linked by internucleoside bonds.

[0023] (6) The nucleic acid agent according to (5), wherein the nucleoside includes natural nucleosides and / or non-natural nucleosides.

[0024] (7) The nucleic acid agent according to (4), wherein the nucleic acid is a peptide nucleic acid.

[0025] (8) The nucleic acid agent according to (4), wherein the polyether group is a polyethylene glycol group.

[0026] (9) The nucleic acid agent according to (4), wherein the hydrocarbon group is an optionally substituted hydrocarbon group having 2 to 30 carbon atoms.

[0027] (10) The nucleic acid agent according to any one of (1) to (9), wherein the linker includes a region consisting of a single-stranded nucleic acid.

[0028] (11) The nucleic acid agent according to (10), wherein the region consisting of the single-stranded nucleic acid contains a hairpin structure.

[0029] (12) The nucleic acid agent according to (10) or (11), wherein the nucleic acid agent further comprises a complementary chain, the complementary chain comprising a base sequence complementary to at least a portion of the region consisting of the single-stranded nucleic acid, and the region consisting of the single-stranded nucleic acid and the complementary chain form a multi-stranded structure.

[0030] (13) The nucleic acid agent according to (12), wherein the region consisting of the single-stranded nucleic acid contains non-complementary bases and / or insertion sequences and / or deletions of one or more bases relative to the complementary chain.

[0031] (14) The nucleic acid agent according to (13), wherein the region consisting of the single-stranded nucleic acid contains 1 to 3 of the non-complementary bases.

[0032] (15) The nucleic acid agent according to (13), wherein the insertion sequence consists of 1 to 8 bases.

[0033] (16) The nucleic acid agent according to (13), wherein the deletion consists of 1 to 4 consecutive bases.

[0034] (17) The nucleic acid agent according to any one of (12) to (16), wherein the complementary chain contains natural nucleosides and / or non-natural nucleosides.

[0035] (18) The nucleic acid agent according to (1), wherein the adaptor sequence is 8 to 50 bases long.

[0036] (19) The nucleic acid agent according to any one of (1) to (18), wherein the TDP-43 binding sequence binds to the RNA recognition motif (RRM) of the TDP-43 protein.

[0037] (20) The nucleic acid agent according to any one of (1) to (19), wherein the TDP-43 binding sequence consists of a repeating sequence represented by the following formula (I):

[0038] (X0GX1X2X3...X m ) n (I)

[0039] In formula (I), X0 is T or U; X1, X2, X3...X m It may exist or not. If it exists, X1, X2, X3...X m It is independently any one of A, C, G, T or U, which may be the same or different; m is 1 to 10; n represents the number of repetitions, which is 2 to 50.

[0040] (21) The nucleic acid agent according to any one of (1) to (19), wherein the TDP-43 binding sequence consists of a repeating sequence represented by the following formula (IV):

[0041] (XG) n (IV)

[0042] In formula (IV), X represents T or U; and n is 3 or greater.

[0043] (22) The nucleic acid agent according to (21), wherein each of the TDP-43 binding sequences is capable of binding to one TDP-43 protein or a fragment thereof.

[0044] (23) The nucleic acid agent according to (22), wherein n is less than or equal to 6.

[0045] (24) The nucleic acid agent according to any one of (21) to (23), wherein the repetitive sequence comprises natural ribonucleosides and / or non-natural ribonucleosides.

[0046] (25) The nucleic acid agent according to (24), wherein the non-natural ribonucleoside is a 2'-O-methyl modified nucleoside, a 2'-O-methoxyethyl modified nucleoside, or a 2'-O-[2-(N-methylcarbamoyl)ethyl] modified nucleoside.

[0047] (26) The nucleic acid agent according to any one of (1) to (25), which is used for inhibiting the aggregation of TDP-43 protein and / or its fragment.

[0048] (27) A pharmaceutical composition comprising the nucleic acid agent according to any one of (1) to (26) as an active ingredient.

[0049] (28) The pharmaceutical composition according to (27), which is used for preventing or treating neurodegenerative diseases.

[0050] (29) The pharmaceutical composition according to (28), wherein the neurodegenerative disease is TDP-43 proteinopathy.

[0051] (30) A pharmaceutical composition according to (28) or (29), wherein the neurodegenerative disease is selected from the group consisting of the following diseases: amyotrophic lateral sclerosis (ALS), i.e., sporadic amyotrophic lateral sclerosis or familial amyotrophic lateral sclerosis; frontotemporal lobar degeneration (FTLD); Alzheimer's disease; dementia with Lewy bodies; Huntington's disease; Parkinson's disease; argyrophilic grain dementia (Grain disease); Perry syndrome; progressive supranuclear palsy; corticobasal degeneration; and multiple system atrophy.

[0052] This specification incorporates the disclosure of Japanese Patent Application No. 2023-022549, which is the basis of priority for this application.

[0053] Effects of the Invention

[0054] According to the present invention, a multivalent binding nucleic acid agent capable of inhibiting TDP-43 protein aggregation is provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 The structures of various bait nucleic acids are shown. Figure 1 A represents a monovalent decoy nucleic acid containing one TDP-43 binding sequence used as a control, and a bivalent decoy nucleic acid containing two TDP-43 binding sequences and no spacer. Figure 1 B represents a bivalent decoy nucleic acid comprising two TDP-43 binding sequences and a spacer consisting of a nucleic acid therebetween.

[0056] Figure 2 This is a method for evaluating the aggregation rate of TDP-43 protein. Figure 2 A represents the steps of adding bait nucleic acid to a TDP-43 protein solution and then separating the solution into a precipitate fraction containing aggregated TDP-43 protein and a supernatant fraction containing non-aggregated TDP-43 protein. Figure 2 B represents a method for measuring the amount of TDP-43 protein in the supernatant fraction (S) and the precipitate fraction (P), and calculating the aggregation rate based on the measured amount of TDP-43 protein in each fraction.

[0057] Figure 3 The graph shows the inhibitory effects of various decoy nucleic acids on TDP-43 protein aggregation. Figure 3 A represents the results of Western blotting. For each bait nucleic acid, "S" represents the lane loaded with the supernatant fraction, and "P" represents the lane loaded with the precipitate fraction. Figure 3 B shows the aggregation rate of TDP-43 protein when using each bait nucleic acid. Error bars indicate standard error.

[0058] Figure 4 Figure 5. Inhibitory effect on the aggregation of the 6M mutant TDP-43 protein, which does not form dimers. Error bars indicate standard error. ***: P < 0.001; **: P < 0.01; *: P < 0.05; ns: not significant (Tukey's multiple comparison test).

[0059] Figure 5 The graph shows the results of detecting monomers and dimers of wild-type and 6M mutant TDP-43 proteins in the presence of various bait nucleic acids.

[0060] Figure 6 Indicates based on Figure 5 The band intensities in the indicated Western blots quantify the ratio of dimers to monomers. Figure 6 A shows the results of wild-type TDP-43 protein. Figure 6 B shows the results of 6M mutant TDP-43 protein.

[0061] Figure 7 It represents a divalent decoy nucleic acid containing triethylene glycol (TEG), hexaethylene glycol (HEG), or an alkylene chain having 12 carbon atoms as a spacer.

[0062] Figure 8 The results show the inhibitory effects of various decoy nucleic acids on TDP-43 protein aggregation. Error bars indicate standard deviation.

[0063] Figure 9 The structures of various bait nucleic acids are shown. Figure 9 A represents the divalent bait nucleic acid A 12 、A 24 and A 48 structure. Figure 9 B represents trivalent bait nucleic acid A 12 The structure of the trivalent.

[0064] Figure 10 The structures of various bait nucleic acids are shown. Figure 10 A represents the divalent bait nucleic acid A 12 / t 12 、A 24 / t 24 and A 48 / t 48structure. Figure 10 B represents trivalent bait nucleic acid A 12 / t 12 The structure of the trivalent.

[0065] Figure 11 The structures of the bivalent bait nucleic acid complexes Adapter1 / C1 and Adapter2 / C2 are shown.

[0066] Figure 12 The results of in vitro aggregation experiments and dimer quantification are shown. Figure 12 A represents the inhibitory effect of various decoy nucleic acids on TDP-43 protein aggregation. Figure 12 B shows the results of quantification of wild-type TDP-43 dimers in the presence of various decoy nucleic acids. Error bars represent standard error. No significant difference was detected between the two groups indicated as "n / A" (P < 0.05), and no significant difference was detected between the two groups indicated as "n / A" (Tukey's multiple comparison test, one-way ANOVA).

[0067] Figure 13 The results of in vitro aggregation experiments and dimer quantification are shown. Figure 13 A represents the inhibitory effect of various decoy nucleic acids on TDP-43 protein aggregation. Figure 13 B shows the results of quantifying the dimer of wild-type TDP-43 protein in the presence of various bait nucleic acids. Error bars indicate standard error.

[0068] Figure 14 The correlation between the quantitative values ​​of dimerization and the aggregation rate in in vitro aggregation experiments is shown.

[0069] Figure 15 The structures of various bait nucleic acids are shown.

[0070] Figure 16 The structures of various bait nucleic acids are shown.

[0071] Figure 17 The results of in vitro aggregation experiments and dimer quantification are shown. Figure 17 A represents the inhibitory effect of various decoy nucleic acids on TDP-43 protein aggregation. Figure 17 B shows the results of quantification of wild-type TDP-43 dimers in the presence of various decoy nucleic acids. Error bars represent standard error. No significant difference was detected between the two groups indicated as "n / A" (P < 0.05), and no significant difference was detected between the two groups indicated as "n / A" (Tukey's multiple comparison test, one-way ANOVA).

[0072] Figure 18 The results of in vitro aggregation experiments and dimer quantification are shown. Figure 18A represents the inhibitory effect of various decoy nucleic acids on TDP-43 protein aggregation. Figure 18 B shows the results of quantification of wild-type TDP-43 dimers in the presence of various decoy nucleic acids. Error bars represent standard error. No significant difference was detected between the two groups indicated as "n / A" (P < 0.05), and no significant difference was detected between the two groups indicated as "n / A" (Tukey's multiple comparison test, one-way ANOVA).

[0073] Figure 19 The graph shows the inhibitory effects of various decoy nucleic acids or decoy nucleic acid complexes on the aggregation of 6M mutant TDP-43 protein. Figure 19 A represents bait nucleic acid A 12 、A 24 、A 48 , and A 12 The result of the trivalent. Figure 19 B represents bait nucleic acid A 12 / t 12 、A 24 / t 24 、A 48 / t 48 , and A 12 / t 12 The result of the trivalent. Figure 19 C represents the results for the bait nucleic acid complex Adapter1 / C1. Error bars indicate standard error. No significant differences were detected between the two groups indicated as "n / a" (P < 0.05), and no significant differences were detected between the two groups indicated as "n / a" (Tukey's multiple comparison test, one-way ANOVA).

[0074] Figure 20 Indicates the evaluation results of the toxicity of the bait nucleic acid. Figure 20 A represents the acute toxicity assessment result. Figure 20 B shows the quantitative results of the relative expression level of TNF-α mRNA, an inflammatory marker. Figure 20 C shows the quantitative results of the relative expression level of IL-1β mRNA, an inflammatory marker. Figure 20 D represents the quantitative results of the relative expression level of GFAP mRNA, a gliosis marker. Error bars represent standard errors. "ns" indicates that no significant difference was detected relative to the PBS-administered group (Tukey's multiple comparison test, one-way analysis of variance).

[0075] Figure 21 Indicates that vehicle (PBS) or bait nucleic acid A was administered intracerebroventricularly 12 Analysis results of the survival rate of ALS model mice expressing Spacer-9 or Spacer-9.

[0076] Figure 22Indicates that vehicle (PBS) or bait nucleic acid A was administered into the brain ventricle using the rotarod assay. 12 or Spacer-9 in ALS model mice. DETAILED DESCRIPTION

[0077] 1. Multivalent Binding Nucleic Acid Agents

[0078] 1-1. Overview

[0079] A first aspect of the present invention is a multivalent binding nucleic acid agent that binds to a TDP-43 protein or a fragment thereof. The multivalent binding nucleic acid agent of the present invention comprises two or more nucleic acid chains, each of which comprises a TDP-43 binding sequence capable of binding to a TDP-43 protein or a fragment thereof. The multivalent binding nucleic acid agent of the present invention can inhibit the aggregation of the TDP-43 protein and stabilize TDP-43 protein dimers.

[0080] 1-2. Definition of Terms

[0081] As used herein, "aggregation" of polypeptides refers to the aggregation of two or more polypeptides of the same or different species. A collection of polypeptides that have aggregated into a mass is referred to herein as an "aggregate." Generally, when polypeptides undergo denaturation, the hydrophobic amino acids encapsulated within their three-dimensional structure become exposed on the surface, facilitating the association of polypeptide molecules. As a result, multiple polypeptide molecules aggregate, often forming large aggregates. These aggregates can sometimes damage cells, leading to decreased cellular function.

[0082] In this specification, "TDP-43 protein [Transactivation responsive region (TAR) DNA-binding protein 43; transactivation response region DNA-binding protein 43]" refers to a protein that belongs to the hnRNP family, binds to RNA, and is responsible for important RNA metabolic functions such as RNA splicing, miRNA synthesis, and RNA transport. The TDP-43 protein comprises, from the N-terminal side, the N-terminal domain, RNA recognition motif 1 (RRM1), RNA recognition motif 2 (RRM2), and a glycine-rich region. It is known that TDP-43 protein generally forms dimers to perform normal functions in the nucleus, while its monomers are more likely to aggregate than dimers and are associated with pathological states. It is known that in degenerating neurons of ALS, the proportion of monomers increases and concentrates in the cytoplasm, thereby exhibiting molecular pathologies such as aggregate formation, fragmentation, and phosphorylation. In the two interactions of dimerization and aggregation of monomers of TDP-43 protein, different regions within the TDP-43 protein are crucial. That is, the dimerization of TDP-43 protein is mediated by the binding of the N-terminal domains to each other. In contrast, in the aggregation of monomers, the glycine-rich domain located on the C-terminal side forms the core of the aggregate, but there are also reports that weaker multivalent interactions in the C-terminal region promote liquid-liquid phase separation (LLPS) to maintain liquid properties (Grese, XR, et al., EMBO Rep, 2021, 22, e53632). Familial mutations in the TDP-43 gene mainly occur in the glycine-rich region, and the occurrence of mutations will increase the aggregation of TDP-43 protein. However, whether wild-type or mutant, when TDP-43 protein is overexpressed, TDP-43 protein will aggregate in the cytoplasm and exert toxicity. Overexpression in neurons leads to neurodegeneration and thus neurodegenerative diseases. Diseases caused by the degeneration or aggregation of TDP-43 protein, or diseases accompanied by the degeneration or aggregation of TDP-43 protein, are called "TDP-43 proteinopathy."

[0083] In this specification, "fragments thereof" of the TDP-43 protein refer to any polypeptide fragment or peptide fragment comprising a portion of the TDP-43 protein. For example, fragments that have the same aggregation properties as the full-length TDP-43 protein can be cited, and specific examples include fragments containing RNA recognition motifs (RRMs) and / or glycine-rich regions, as well as C-terminal fragments. The "C-terminal fragment" of the TDP-43 protein refers to a fragment containing a region on the C-terminal side of the TDP-43 protein. For example, fragments that are located on the C-terminal side of the TDP-43 protein and contain a glycine-rich domain that is a core capable of forming aggregates can be cited. In patients with sporadic amyotrophic lateral sclerosis (ALS) and some familial amyotrophic lateral sclerosis, a C-terminal fragment with a molecular weight of 25 to 35 kDa derived from the TDP-43 protein has been confirmed in brain tissue, and it is known to be associated with the disease. This C-terminal fragment has the same aggregation properties as the full-length TDP-43 protein, and will aggregate together with the full-length TDP-43 protein to exert toxicity.

[0084] In this specification, "inhibition of aggregation" or "inhibition of aggregate formation" of TDP-43 protein or its fragments refers not only to 100% inhibition relative to the case where no nucleic acid agent such as decoy nucleic acid is introduced, but also to inhibition of 75% or more, 50% or more, 20% or more, or 10% or more. The aggregation level of TDP-43 protein or its fragments can be assessed, for example, by mixing the nucleic acid agent and TDP-43 protein or its fragments, shaking as needed, followed by sedimentation, centrifugation, filtration, etc., and measuring the amount of TDP-43 protein or its fragments in the non-aggregated fraction and aggregated fraction thus separated, and calculating the ratio of TDP-43 protein or its fragments contained in the aggregated fraction as the aggregation rate ( Figure 2 ).

[0085] As used herein, "stabilizing TDP-43 protein dimers" means that the ratio of dimers to monomers is improved relative to a situation where no nucleic acid agent, such as a decoy nucleic acid, is introduced. Therefore, the dimer ratio can be stabilized not only to 100%, but also maintained at 75% or greater, 50% or greater, 20% or greater, or 10% or greater. The dimer to monomer ratio can be assessed, for example, by mixing the nucleic acid agent and TDP-43 protein or a fragment thereof, shaking as needed, and then performing a cross-linking reaction using a cross-linking agent such as glutaraldehyde. The monomers and dimers are separated and detected based on molecular weight using a method such as Western blotting, and the ratio of dimers to the sum of the monomers and dimers is calculated.

[0086] In this specification, "TDP-43 binding sequence" refers to any nucleic acid sequence, nucleoside sequence or base sequence that can bind to the TDP-43 protein or a fragment thereof. The TDP-43 binding sequence can be a sequence that binds to any region of the TDP-43 protein, or it can be any of a sequence that binds to the RNA recognition motif (RRM) of the TDP-43 protein or a sequence that binds to a region other than the RRM. The sequence that binds to the RRM of the TDP-43 protein is a known sequence. The TDP-43 binding sequence can use a known sequence, or a sequence that can bind to the TDP-43 protein or its RRM can be found through binding experiments such as gel shift experiments. In addition, an aptamer (nucleic acid aptamer) that binds to the TDP-43 protein can also be used as a TDP-43 binding sequence.

[0087] In this specification, "multiplex" refers to a complex or structure formed by two or more nucleic acid chains bound to each other, such as a double strand formed by the hybridization of two nucleic acid chains or a triple strand formed by the bonding of three nucleic acid chains.

[0088] In this specification, "bait nucleic acid" refers to a nucleic acid that specifically binds to a specific target molecule in vivo to modify the function of the target molecule. The target that interacts with the bait is also called "prey."

[0089] As used herein, the term "nucleic acid" or "nucleic acid molecule" may refer to a monomeric nucleotide or nucleoside, an oligonucleotide composed of multiple monomers, or a polymer, a polynucleotide. "Natural nucleic acid" refers to nucleic acids found in nature. Natural nucleic acids include the natural nucleosides and natural nucleotides described below. "Non-natural nucleic acid" or "artificial nucleic acid" refers to any nucleic acid other than a natural nucleic acid. Non-natural nucleic acids or artificial nucleic acids include the non-natural nucleosides and non-natural nucleotides described below.

[0090] As used herein, a "nucleic acid chain" or simply a "chain" refers to two or more nucleosides linked by internucleoside bonds, and may be, for example, an oligonucleotide or a polynucleotide. Nucleic acid chains can be produced, for example, by chemical synthesis using an automated synthesis apparatus, or by enzymatic engineering using polymerases, ligases, or restriction reactions to produce full-length or partial chains. Nucleic acid chains may include natural nucleotides and / or non-natural nucleotides.

[0091] "Nucleoside" refers to a molecule generally composed of a base and a sugar. The sugar portion of a nucleoside is not limited and is generally composed of pentofuranosyl sugar, with specific examples including ribose and deoxyribose. The base portion (nucleobase) of a nucleoside is generally a heterocyclic base portion. The base portion is not limited and may include adenine, cytosine, guanine, thymine, or uracil, as well as modified nucleic acid bases (modified bases) other than the above.

[0092] "Nucleotide" refers to a molecule in which a phosphate group is covalently bound to the sugar portion of the nucleoside described above. In the case of a nucleotide comprising a pentofuranosyl sugar, the phosphate group is typically linked to the hydroxyl group at the 2', 3', or 5' position of the sugar.

[0093] "Oligonucleotide" refers to a linear oligomer formed by covalently linking several to dozens of hydroxyl groups and phosphate groups on the sugar moieties between adjacent nucleotides. Furthermore, "polynucleotide" refers to a linear polymer comprising more nucleotides than an oligonucleotide, i.e., dozens or more, preferably hundreds or more, linked by such covalent bonds. Within an oligonucleotide or polynucleotide structure, phosphate groups are generally considered to form internucleoside bonds.

[0094] As used herein, "natural nucleosides" refer to nucleosides found in nature. Examples include ribonucleosides composed of ribose and a base such as adenine, cytosine, guanine, or uracil; and deoxyribonucleosides composed of deoxyribose and a base such as adenine, cytosine, guanine, or thymine. It should be noted that ribonucleosides found in RNA and deoxyribonucleosides found in DNA are often referred to herein as "DNA nucleosides" and "RNA nucleosides," respectively.

[0095] As used herein, "natural nucleotides" refer to naturally occurring nucleotides, i.e., molecules in which a phosphate group is covalently bound to the sugar moiety of a natural nucleoside. Examples include ribonucleotides, which are known as building blocks of RNA, and deoxyribonucleotides, which are known as building blocks of DNA, and phosphate groups are bound to deoxyribonucleotides.

[0096] In this specification, "non-natural nucleotides" refer to any nucleotide other than natural nucleotides, including modified nucleotides and nucleotide mimetics. In this specification, "modified nucleotides" refer to nucleotides having one or more of a modified sugar moiety, a modified internucleoside bond, and a modified nucleobase. The "nucleotide mimetics" described herein include structures used to replace nucleosides and bonds at one or more positions in an oligomeric compound. Examples of nucleotide mimetics include peptide nucleic acids or morpholino nucleic acids [morpholino groups bound by -N(H)-C(=O)-O- or other non-phosphodiester bonds]. Peptide nucleic acids (PNA) are nucleotide mimetics having a backbone bonded by amino groups with N-(2-aminoethyl)glycine instead of sugar. In most cases, the nucleic acid chains comprising non-natural oligonucleotides in this specification have desirable properties such as enhanced cellular uptake, enhanced affinity for nucleic acid targets, increased stability in the presence of nucleases, or increased blocking activity. Therefore, they are more preferred than natural nucleotides.

[0097] As used herein, "non-natural nucleosides" refer to any nucleoside other than natural nucleosides. Examples include modified nucleosides and nucleoside mimetics. As used herein, "modified nucleosides" refer to nucleosides having modified sugar moieties and / or modified nucleobases.

[0098] In this specification sheets, "simulations" refers to the functional group of a substituted sugar, core base and / or internucleoside bond. Simulations are generally used to replace the combination of sugar or sugar-internucleoside bonds, and the core base maintains hybridization with the target of selection. "Nucleoside simulations" described herein include structures that are used to replace sugars at one or more positions of oligomeric compounds, or to replace sugars and bases, or to replace the bonds between monomeric subunits that constitute oligomeric compounds. "Oligomeric compounds" refers to a polymer that is connected by monomeric subunits and can hybridize with a certain region of nucleic acid molecules. Nucleoside simulations, for example, can include morpholinyl, cyclohexenyl, cyclohexyl, tetrahydropyranyl, dicyclo or tricyclic sugar simulations, for example, nucleoside simulations with non-furanose units.

[0099] "Modified sugar" refers to a sugar having a substitution and / or arbitrary change from a natural sugar moiety [i.e., a sugar moiety identified in DNA (2'-H) or RNA (2'-OH)]; "sugar modification" refers to a substitution and / or arbitrary change from a natural sugar moiety. Depending on the circumstances, a nucleic acid chain may also contain one or more modified nucleosides containing a modified sugar. "Sugar-modified nucleoside" refers to a nucleoside having a modified sugar moiety. The sugar-modified nucleoside can impart enhanced nuclease stability, enhanced binding affinity, or other beneficial biological properties to the nucleic acid chain. In a specific embodiment, the nucleoside contains a chemically modified furanose ring moiety. Examples of chemically modified furanose rings are not limited and include: the addition of substituents (including 5' and 2' substituents), the formation of bicyclic nucleic acids (bridged nucleic acids, BNA) caused by cross-linking of non-geminal ring atoms, the addition of ribose ring oxygen atoms to S, N (R) or C (R1) (R2) (R, R1 and R2 independently represent H, C1-C 12 alkyl or protecting group), and combinations thereof.

[0100] Examples of sugar-modified nucleosides are not limited, and include nucleosides containing the following groups: 5'-vinyl, 5'-methyl (R or S), 5'-allyl (R or S), 4'-S, 2'-F (2'-fluoro), 2'-OCH3 (2'-O-Me or 2'-O-methyl), 2'-O-[2-(N-methylcarbamoyl)ethyl] (2'-O-MCE), and 2'-O-methoxyethyl (2'-O-MOE or 2-O(CH2)2OCH3) substituents. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, -O-allyl, -O-C1-C 10Alkyl, -OCF3, -O(CH2)2SCH3, -O(CH2)2-ON(Rm)(Rn) and O-CH2-C(=O)-N(Rm)(Rn), each Rm and Rn is independently H, or substituted or unsubstituted C1-C 10 Alkyl. "2'-modified sugar" refers to a furanosyl sugar modified at the 2' position. Nucleosides containing a 2'-modified sugar are sometimes also referred to as "2'-modified nucleosides" or "2'-sugar modified nucleosides."

[0101] "Bicyclic nucleoside" refers to a modified nucleoside that contains a bicyclic sugar moiety. Nucleic acids containing a bicyclic sugar moiety are generally referred to as bridged nucleic acids (BNA). Nucleosides containing a bicyclic sugar moiety are sometimes also referred to as "bridged nucleosides," "bridged non-natural nucleosides," or "BNA nucleosides."

[0102] Bicyclic sugars can be sugars in which the carbon atom at the 2' position and the carbon atom at the 4' position are bridged by two or more atoms. Examples of bicyclic sugars are well known to those skilled in the art. A subgroup of nucleic acids (BNAs) or BNA nucleosides comprising bicyclic sugars can be described as having a 4'-(CH2) p -O-2', 4'-(CH2) p -CH2-2', 4'-(CH2) p -S-2', 4'-(CH2) p -OCO-2'、4'-(CH2) n -N(R3)-O-(CH2) m-2' [wherein, p, m and n represent integers 1 to 4, integers 0 to 2 and integers 1 to 3, respectively; R3 represents a hydrogen atom, an alkyl group, an alkenyl group, a cycloalkyl group, an aryl group, an arylalkyl group, an acyl group, a sulfonyl group and a unit substituent (a fluorescent or chemiluminescent labeling molecule, a functional group with nucleic acid cleavage activity, a signal peptide located intracellularly or intranuclearly, etc.)] cross-linked carbon atoms at the 2' position and the 4' position. In addition, with respect to BNA or BNA nucleoside according to a specific embodiment, in the OR2 substituent on the carbon atom at the 3' position and the OR1 substituent on the carbon atom at the 5' position, R1 and R2 are typically hydrogen atoms, but may be the same as or different from each other, and may also be a protecting group for a hydroxyl group used for nucleic acid synthesis, an alkyl group, an alkenyl group, a cycloalkyl group, an aryl group, an aralkyl group, an acyl group, a sulfonyl group, a silyl group, a phosphate group, a phosphate group protected by a protecting group for nucleic acid synthesis, or P(R4)R5 [here, R4 and R5 may be the same as or different from each other and each represent a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a thiol group, a thiol group protected by a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 5 carbon atoms, an alkylthio group having 1 to 5 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or an amino group substituted with an alkyl group having 1 to 5 carbon atoms]. Non-limiting examples of such BNAs include methyleneoxy (4'-CH2-O-2') BNA (LNA (locked nucleic acid (registered trademark)), also known as 2',4'-BNA) (e.g., α-L-methyleneoxy (4'-CH2-O-2') BNA or β-D-methyleneoxy (4'-CH2-O-2') BNA), ethyleneoxy (4'-(CH2)2-O-2') BNA (also known as ENA), β-D-thio (4'-CH2-S-2') BNA, aminooxy (4'-CH2-ON(R3)-2') BNA, oxyamino (4'-CH2-N(R3)-O-2') BNA (also known as 2',4'-BNA NC It is known that R=H is 2',4'-BNA NC [NH], R=Me is 2',4'-BNA NC [N-Me]), 2',4'-BNA coc, 3'-amino-2',4'-BNA, 5'-methyl BNA, (4'-CH(CH3)-O-2')BNA (also known as cEt BNA), (4'-CH(CH2OCH3)-O-2')BNA (also known as cMOE BNA), amide BNA (amide-bridged nucleic acid), or (4'-C(O)-N(R)-2')BNA (R=H, Me) (also known as AmNA; R=H is AmNA[NH], R=Me is AmNA[N-Me]), guanidine BNA (GuNA (for example, R=H is also known as GuNA[NH], R=Me is also known as GuNA[N-Me])), amine BNA (also known as 2'-amino-LNA) (for example, 3-(bis(3-aminopropyl)amino)propionyl substituents), 2'-O,4'-C-spirocyclopropene bridged nucleic acid (also known as scpBNA), and other BNAs known to those skilled in the art. Non-limiting examples of such BNA nucleosides include: methyleneoxy (4'-CH2-O-2') BNA nucleosides (LNA nucleosides, also known as 2',4'-BNA nucleosides) (e.g., α-L-methyleneoxy (4'-CH2-O-2') BNA nucleosides, β-D-methyleneoxy (4'-CH2-O-2') BNA nucleosides), ethyleneoxy (4'-(CH2)2-O-2') BNA nucleosides (also known as ENA nucleosides), β-D-thio (4'-CH2-S-2') BNA nucleosides, aminooxy (4'-CH2-ON(R3)-2') BNA nucleosides, oxyamino (4'-CH2-N(R3)-O-2') BNA nucleosides (also known as 2',4'-BNA NC Nucleosides are known; R=H is 2',4'-BNA NC [NH] nucleoside, R=Me is 2',4'-BNA NC [N-Me] nucleosides), 2',4'-BNA cocnucleoside, 3'-amino-2',4'-BNA nucleoside, 5'-methyl BNA nucleoside, (4'-CH(CH3)-O-2')BNA nucleoside (also known as cEt nucleoside), (4'-CH(CH2OCH3)-O-2')BNA nucleoside (also known as cMOE nucleoside), amide BNA nucleoside or (4'-C(O)-N(R)-2')BNA nucleoside (R=H, Me) (also known as AmNA nucleoside; R=H is AmNA[NH] nucleoside, R=Me

[0014] Nucleosides include, but are not limited to, AmNA[N-Me] nucleosides), guanidine BNA nucleosides (also known as GuNA nucleosides (e.g., R═H is GuNA[NH] nucleoside, R═Me is GuNA[N-Me] nucleoside)), amine BNA nucleosides (also known as 2'-amino-LNA nucleosides) (e.g., 3-(bis(3-aminopropyl)amino)propanoyl-substituted nucleosides), 2'-O,4'-C-spirocyclopropene-bridged nucleosides (also known as scpBNA nucleosides), and other BNA nucleosides known to those skilled in the art.

[0103] In this specification, "modified internucleoside bonds" refer to internucleoside bonds that have substitutions or arbitrary changes from naturally occurring internucleoside bonds (i.e., phosphodiester bonds). Modified internucleoside bonds include internucleoside bonds containing phosphorus atoms and internucleoside bonds that do not contain phosphorus atoms. Representative phosphorus-containing internucleoside bonds include, but are not limited to: phosphodiester bonds, phosphorothioate bonds, phosphorodithioate bonds, phosphotriester bonds, alkyl phosphate bonds, alkylthiophosphate bonds, methylthiophosphate bonds, boranephosphate bonds, internucleoside bonds containing cyclic guanidine moieties, and phosphoramide bonds. Phosphorothioate bonds refer to internucleoside bonds in which the non-bridging oxygen atom of the phosphodiester bond is replaced by a sulfur atom. Methods for preparing phosphorus-containing and non-phosphodiester bonds are well known. Modified internucleoside bonds are preferably bonds with higher nuclease resistance than naturally occurring internucleoside bonds.

[0104] The term "nucleobase" or "base" used in this specification refers to the base component (heterocyclic moiety) of nucleic acid, mainly known to have adenine, guanine, cytosine, thymine and uracil. In this specification, "nucleobase" or "base" also includes any of modified or unmodified nucleobases (bases) unless otherwise specified. Therefore, unless otherwise specified, a purine base can be any of modified or unmodified purine bases. In addition, unless otherwise specified, a pyrimidine base can be any of modified or unmodified pyrimidine bases.

[0105] "Modified nucleobase" or "modified base" refers to all nucleobases other than adenine, cytosine, guanine, thymine, or uracil. "Non-modified nucleobase" or "non-modified base" (natural nucleobase) refers to adenine (A) and guanine (G) as purine bases, and thymine (T), cytosine (C), and uracil (U) as pyrimidine bases. Examples of modified nucleobases include, but are not limited to: hypoxanthine, 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, 5-iodocytosine, or N4-methylcytosine; N6-methyladenine or 8-bromoadenine; 2-thio-thymine; and N2-methylguanine or 8-bromoguanine. The modified nucleobase is preferably 5-methylcytosine.

[0106] The term "complementary" as used in this description refers to the relationship between nucleobases that can form so-called Watson-Crick base pairs (natural bases) or non-Watson-Crick base pairs (Hoosier base pairs, etc.) through hydrogen bonds. In the present invention, the linker sequences that can form multiple chains do not need to be completely complementary, as long as the base sequences have at least 70%, preferably at least 80%, and more preferably at least 90% (for example, 95%, 96%, 97%, 98% or more than 99%) complementarity. The complementarity of base sequences can be determined using BLAST programs, etc. Those skilled in the art can easily determine the conditions (temperature, salt concentration, etc.) under which the two chains can anneal or hybridize, taking into account the complementarity between the chains.

[0107] Hybridization conditions can include various stringency conditions, such as low stringency conditions and high stringency conditions. Low stringency conditions can be relatively low temperature and high salt concentration conditions, such as 30°C, 2×SSC, 0.1% SDS. High stringency conditions can be relatively high temperature and low salt concentration conditions, such as 65°C, 0.1×SSC, 0.1% SDS. By varying conditions such as temperature and salt concentration, the stringency of hybridization can be adjusted. Here, 1×SSC contains 150 mM sodium chloride and 15 mM sodium citrate.

[0108] As used herein, a "subject" refers to a subject to whom the nucleic acid agent or pharmaceutical composition of the present invention is applicable. In addition to individuals, subjects also include organs, tissues, and cells. When the subject is an individual, all animals, including humans, are eligible. For example, in addition to humans, various livestock, poultry, pets, and experimental animals can also be included. The subject is not limited and can be an individual in whom TDP-43 protein-positive aggregates need to be reduced, or an individual in whom central nervous system diseases such as ALS need to be treated or prevented.

[0109] In the present specification, "plurality" refers to an integer of 2 or greater, for example, an integer of 2 to 10, 2 to 7, 2 to 5, 2 to 4, or 2 to 3.

[0110] The term "base identity" as used herein refers to the ratio (%) of the number of identical bases in the total number of bases in two compared nucleic acid sequences when alignment is performed by inserting appropriate gaps in one or both of the sequences as needed.

[0111] 1-3. Composition

[0112] The multivalent binding nucleic acid agent of the present invention (hereinafter sometimes simply referred to as the "nucleic acid agent of the present invention") comprises two or more nucleic acid chains. In the nucleic acid agent of the present invention, each of the two or more nucleic acid chains comprises or consists of a TDP-43 binding sequence capable of binding to a TDP-43 protein or a fragment thereof.

[0113] In this specification, the number of nucleic acid chains in "two or more nucleic acid chains" is not particularly limited and can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 or more, for example, it can be 2 to 5, or 2 or 3.

[0114] In this specification, when referring to each of two or more nucleic acid chains, they are referred to as the first nucleic acid chain, the second nucleic acid chain, the third nucleic acid chain, etc. For example, when the nucleic acid agent of the present invention comprises two nucleic acid chains, both the first nucleic acid chain and the second nucleic acid chain contain a TDP-43 binding sequence. In addition, when the multivalent binding nucleic acid agent of the present invention comprises three nucleic acid chains, both the first nucleic acid chain, the second nucleic acid chain, and the third nucleic acid chain contain a TDP-43 binding sequence. The TDP-43 binding sequence contained in each chain may be the same or different.

[0115] In one embodiment, the multivalent binding nucleic acid agent of the present invention comprises a first nucleic acid strand and a second nucleic acid strand. In this embodiment, the first nucleic acid strand and the second nucleic acid strand are bound by a linker, or comprise an adapter sequence capable of forming a double strand of the first nucleic acid strand and the second nucleic acid strand.

[0116] In another embodiment, the multivalent binding nucleic acid agent of the present invention comprises a first nucleic acid strand, a second nucleic acid strand, and a third nucleic acid strand. In this embodiment, the first nucleic acid strand and the second nucleic acid strand, and the second nucleic acid strand and the third nucleic acid strand, are each bound by a linker. Alternatively, the first to third nucleic acid strands each comprise an adapter sequence capable of forming a double strand between the first nucleic acid strand and the second nucleic acid strand, and between the second nucleic acid strand and the third nucleic acid strand.

[0117] Furthermore, the multivalent binding nucleic acid agent of the present invention may contain, in addition to two or more nucleic acid chains containing a TDP-43 binding sequence, a nucleic acid chain not containing a TDP-43 binding sequence, or may contain no nucleic acid chain not containing a TDP-43 binding sequence.

[0118] In the nucleic acid agent of the present invention, each of the two or more nucleic acid chains may contain a nucleic acid sequence other than the TDP-43 binding sequence in addition to the TDP-43 binding sequence. However, in some embodiments, each of the two or more nucleic acid chains consists of a TDP-43 binding sequence.

[0119] Each of the two or more nucleic acid chains may include natural nucleosides and / or non-natural nucleosides, and may be composed of modified nucleosides such as bridged nucleosides and / or 2'-modified nucleosides connected by natural or modified internucleoside bonds.

[0120] The base length of each chain in the two or more nucleic acid chains is not particularly limited and can be independently selected. The base length of each chain can be the same or different, for example, can be at least 9 bases long, 10 bases long, 11 bases long, 12 bases long, 13 bases long, 14 bases long or 15 bases long, and / or, can be 500 bases long, 200 bases long, 100 bases long, 50 bases long, 40 bases long, 35 bases long, 30 bases long, 25 bases long, 24 bases long, 23 bases long, 22 bases long, 21 bases long, 20 bases long, 19 bases long, 18 bases long, 17 bases long or less than 16 bases long. Exemplary ranges include 10 to 100 bases in length, 12 to 60 bases in length, or 15 to 40 bases in length.

[0121] The nucleic acid agent of the present invention comprises a spacer that connects two or more nucleic acid chains together. In this specification, "spacer" refers to a portion of which is bound to at least one or at least two of the two or more nucleic acid chains contained in the nucleic acid agent of the present invention, and has sufficient rigidity, length, or a combination thereof to configure the TDP-43 binding sequences of each nucleic acid chain in positions separated from each other in space. Examples of spacers include linkers described later that directly connect two or more nucleic acid chains together, and nucleic acid complexes such as multiple chains formed by adapter sequences described later. The length of the spacer is not limited as long as it is a length that can inhibit the formation of aggregates of TDP-43 proteins, for example, it is 1 nm or more, preferably 2 nm or more, 3 nm or more, or 4 nm or more. The upper limit of the length of the spacer is not particularly limited, for example, it can be 100 nm or less or 50 nm or less, preferably 20 nm or less, more preferably 10 nm or less or 8 nm or less.

[0122] In some embodiments of the nucleic acid agent of the present invention, two or more nucleic acid chains are bound by a linker. In order to inhibit the formation of aggregates by two or more TDP-43 proteins (e.g., monomeric TDP-43 proteins) bound to the TDP-43 binding sequence, the linker preferably has a rigidity and / or length that can be configured to spatially separate positions, and preferably uses a rigid linker that can maintain a distance (e.g., limit or prevent contact) between two or more TDP-43 proteins bound to the TDP-43 binding sequence. Among them, the inhibition of the formation of aggregates by two or more TDP-43 proteins can be achieved based on the inhibition of binding between the C-terminal regions of the TDP-43 protein, or the promotion of phase separation of the TDP-43 protein.

[0123] The specific configuration of the linker is not particularly limited and can be any linker that does not bind to the TDP-43 protein. Examples include linkers comprising nucleic acids, peptides, polyether groups, and / or hydrocarbon groups; and linkers composed (or consisting) of nucleic acids, peptides, polyether groups, and / or hydrocarbon groups (i.e., nucleic acid chains, peptide chains, polyether chains, and / or hydrocarbon chains).

[0124] In one embodiment, the nucleic acid contained in or constituting the linker is composed of 1 or 2 to 200 (e.g., 2 to 100 or 2 to 50) nucleosides connected by internucleoside bonds. The number of nucleosides connected by internucleoside bonds is, for example, 3 to 40, 4 to 35, 5 to 30, 6 to 25, or 10 to 20, preferably 12 to 24 or more and less than 24, for example, 11, 12, 13, 14, or 15. In addition, the nucleosides may include natural nucleosides and / or non-natural nucleosides. The type of nucleic acid is not particularly limited, and for example, it may be a peptide nucleic acid.

[0125] In one embodiment, the length of the peptide contained in or constituting the linker is not limited, and examples thereof include 3 to 100 amino acids, 5 to 50 amino acids, and 10 to 40 amino acids, preferably 15 to 30 amino acids or 20 to 25 amino acids. The type of amino acid residues constituting the peptide can be appropriately selected based on the required rigidity and three-dimensional structure of the linker.

[0126] In one embodiment, the polyether group contained in or constituting the joint is not particularly limited as long as it is a straight or branched polymer with an ether bond on the main chain, and is preferably a straight or branched polymer comprising an alkylene glycol unit or a polyalkylene glycol unit. The number of molecules of the alkylene glycol unit or the polyalkylene glycol unit constituting the main chain of the joint is not limited, and for example, it can be 1 to 20, 2 to 16, or 3 to 12. The alkylene glycol unit or the polyalkylene glycol unit is preferably an ethylene glycol unit or a polyethylene glycol (PEG) unit. Ethylene glycol or polyethylene glycol, for example, can be ethylene glycol, diethylene glycol, triethylene glycol, tetraethylene glycol, pentaethylene glycol, hexaethylene glycol, heptaethylene glycol, octaethylene glycol, nineethylene glycol, decaethylene glycol, etc., preferably ethylene glycol, diethylene glycol, triethylene glycol or tetraethylene glycol.

[0127] In one embodiment, the hydrocarbon group contained in or constituting the above-mentioned linker is an optionally substituted hydrocarbon group having 2 to 30 carbon atoms. The number of carbon atoms constituting the hydrocarbon group may be 3 to 25, 4 to 20, 5 to 18, or 10 to 15, for example, 11 to 13 or 12, preferably 3 to 6. The hydrocarbon group may be a saturated alkylene group, or an unsaturated alkenylene group or alkynylene group. Alkenylene or alkynylene groups are preferred because they can increase the rigidity of the linker. The hydrocarbon group may be either linear or branched. The substituent may be a hydroxyl group, an amino group, an alkoxy group, a carboxyl group, a benzyl group, a phenyl group, a nitro group, a mercapto group, a thioalkoxy group, a halogen group, an alkyl group, an aryl group, an alkenyl group, and / or an alkynyl group.

[0128] In addition, the linker can be any of a cleavable linker or a non-cleavable linker. A "cleavable linker" refers to a linker that can be cleaved under physiological conditions, for example, in a cell or in an animal (e.g., in the human body). A cleavable linker is selectively cleaved by endogenous enzymes such as nucleases. There is no limitation on cleavable linkers, and examples include: amides, esters, monoesters or diesters in phosphodiesters, phosphates, carbamates, disulfide bonds, and natural DNA linkers. A "non-cleavable linker" refers to a linker that will not be cleaved under physiological conditions, for example, in a cell or in an animal (e.g., in the human body). There is no limitation on non-cleavable linkers, and examples include: thiophosphate bonds, and linkers composed of modified or non-modified deoxyribonucleosides or modified or non-modified ribonucleosides connected by thiophosphate bonds, etc. The linker is more preferably a non-cleavable linker.

[0129] Further specific examples of linkers can be appropriately selected from known linkers that can be used to connect nucleic acids in the technical field. In addition, methods for synthesizing linkers and methods for connecting nucleic acid chains via linkers are also known in the technical field.

[0130] In one embodiment, the joint comprises the region consisting of single-stranded nucleic acid.The region consisting of single-stranded nucleic acid can comprise any secondary structure, can comprise hairpin (loop) structure, stem (loop) structure, and / or pseudoknot structure.The hairpin structure can be, for example, guanine quadruplex (G-quadruplex, G4) structure or adenine quadruplex (A-quadruplex, A4) structure.These quadruplex structures can be any one in parallel type, antiparallel type or mixed type.In addition, the region consisting of single-stranded nucleic acid can comprise natural nucleosides and / or non-natural nucleosides, for example, the region consisting of single-stranded nucleic acid can be made up of modified nucleosides such as bridging nucleosides and / or 2' modified nucleosides connected by natural or modified internucleoside bonds.

[0131] In another embodiment, the multivalent binding nucleic acid agent of the present invention can also include complementary chain, and this complementary chain includes the base sequence complementary to at least a portion of the above-mentioned region consisting of single-stranded nucleic acid.This complementary chain forms a multiple chain structure (such as double-stranded structure, triple-stranded structure or structure of more than four chains) with the above-mentioned region consisting of single-stranded nucleic acid, and the rigidity of joint can be promoted.The region consisting of single-stranded nucleic acid and complementary chain can include any secondary structure, such as can include stem structure, convex ring (ring) structure, inner ring structure, branched ring structure etc. In addition, complementary chain can include natural nucleoside and / or non-natural nucleoside, such as can also be formed by the bridging nucleoside and / or 2 ' modified nucleoside of the internucleoside bond connected by natural or modified type.

[0132] In another embodiment, the region consisting of a single-stranded nucleic acid contains non-complementary bases (mismatched bases) relative to the complementary strand, and / or insertions and / or deletions of more than one base. For example, the number of non-complementary bases can be 1 to 3, the insertion sequence can be composed of 1 to 8 bases, and the deletion can be composed of 1 to 4 consecutive bases. The introduction of non-complementary bases, insertions and / or deletions can also form the above-mentioned secondary structure.

[0133] The base lengths of the region consisting of the single-stranded nucleic acid and the complementary chain are not particularly limited, and may be, for example, at least 6 bases long, 7 bases long, 8 bases long, 9 bases long, 10 bases long, 11 bases long, 12 bases long, 13 bases long, 14 bases long, or 15 bases long, and / or may be 50 bases long, 40 bases long, 35 bases long, 30 bases long, 25 bases long, 24 bases long, 23 bases long, 22 bases long, 21 bases long, 20 bases long, 19 bases long, 18 bases long, 17 bases long, or less than 16 bases long. Exemplary ranges include 8 to 50 bases, 12 to 40 bases, or 15 to 30 bases, preferably 12 to 24 bases or 12 bases or longer and less than 24 bases.

[0134] In some embodiments of the nucleic acid agent of the present invention, the two or more nucleic acid chains contain an adaptor sequence capable of forming a multiplex chain between the two or more nucleic acid chains.

[0135] As used herein, an "adapter sequence" refers to two or more base sequences that can hybridize to form a multiple strand, or a nucleic acid consisting of such sequences, and can be sequences that are at least partially complementary to each other. For example, when two nucleic acid chains form a double strand, the first nucleic acid chain includes, in addition to the TDP-43 binding sequence, a first adaptor sequence that does not bind to TDP-43, and the second nucleic acid chain includes, in addition to the TDP-43 binding sequence, a second adaptor sequence comprising a base sequence that is complementary to at least a portion of the first adaptor sequence. Thus, the two nucleic acid chains can form a double strand between the adaptor sequences. In the two or more nucleic acid chains, the adaptor sequences can be positioned on either the 5' side or the 3' side of the TDP-43 binding sequence. For example, the first and second adaptor sequences can be positioned on the 5' side of the TDP-43 binding sequence on the first and second nucleic acid chains, respectively, or the first and second adaptor sequences can be positioned on the 3' side of the TDP-43 binding sequence on the first and second nucleic acid chains, respectively. By arranging the first nucleic acid chain and the second nucleic acid chain in this manner, the TDP-43 binding sequences of the respective nucleic acid chains can be arranged at spatially separated positions, which is preferred.

[0136] The adapter sequence may include any secondary structure, for example, a stem structure, a convex loop (ring) structure, an internal loop structure, a branched loop structure, etc. In addition, the adapter sequence may include natural nucleosides and / or non-natural nucleosides, for example, may be composed of bridging nucleosides and / or 2' modified nucleosides connected by natural or modified internucleoside bonds.

[0137] In another embodiment, the adapter sequence comprises mutually non-complementary bases (mismatched bases), and / or insertions and / or deletions of one or more bases. For example, the number of non-complementary bases may be 1 to 3, the insertion may consist of 1 to 8 bases, and the deletion may consist of 1 to 4 consecutive bases. The introduction of non-complementary bases, insertions, and / or deletions may also form the aforementioned secondary structures.

[0138] The base length of the adapter sequence is not particularly limited, and may be, for example, at least 6 bases long, 7 bases long, 8 bases long, 9 bases long, 10 bases long, 11 bases long, 12 bases long, 13 bases long, 14 bases long, or 15 bases long, and / or may be 50 bases long, 40 bases long, 35 bases long, 30 bases long, 25 bases long, 24 bases long, 23 bases long, 22 bases long, 21 bases long, 20 bases long, 19 bases long, 18 bases long, 17 bases long, or less than 16 bases long. Exemplary ranges include 8 to 50 bases long, 12 to 40 bases long, or 15 to 30 bases long, preferably 8 to 30 bases long or 10 to 2 bases long.

[0139] In one embodiment of the multivalent binding nucleic acid agent of the present invention, at least one of the two or more nucleic acid chains may be bound to a functional moiety. The binding between the nucleic acid chain and the functional moiety may be direct or indirect via another substance. Preferably, the nucleic acid chain and the functional moiety are directly bound via a covalent bond, ionic bond, hydrogen bond, or the like. For more stable binding, a covalent bond is more preferred.

[0140] In one embodiment, the structure of the "functional part" is not particularly limited, and the desired function is imparted to the bivalent binding nucleic acid agent to which it is bound. The desired functions can include labeling function, purification function and delivery function to the target. Examples of parts that impart labeling function include compounds such as fluorescent proteins and luciferases. Examples of parts that impart purification function include compounds such as biotin, avidin, His tag peptides, GST tag peptides, and FLAG tag peptides. In addition, from the perspective of delivering the nucleic acid agent to the target site with high specificity and efficiency, and effectively controlling the TDP-43 protein through the nucleic acid agent, a molecule with delivery activity for the target site can be bound to at least one of the two or more nucleic acid chains as a functional part. Examples of parts that impart the function of delivery to the target include lipids, antibodies, aptamers, ligands for specific receptors, etc.

[0141] In one embodiment, at least one of the two or more nucleic acid chains (e.g., the first nucleic acid chain and / or the second nucleic acid chain) is bound to a lipid. Examples of lipids include, but are not limited to: tocopherol, cholesterol, fatty acids, phospholipids, and their analogs; folic acid, vitamin C, vitamin B1, vitamin B2; estradiol, androstane, and their analogs; steroids, and their analogs. The lipid may be tocopherol or its analogs, and / or cholesterol or its analogs, substituted or unsubstituted C 1~30 Alkyl, substituted or unsubstituted C 2~30 Alkenyl, or substituted or unsubstituted C 1~30 of alkoxy.

[0142] The functional portion may be linked to the 5' end, 3' end, or both ends of at least one of the two or more nucleic acid chains (e.g., the first nucleic acid chain and / or the second nucleic acid chain). Alternatively, the functional portion may be linked to an internal nucleotide of at least one of the two or more nucleic acid chains (e.g., the first nucleic acid chain and / or the second nucleic acid chain).

[0143] The functional portion can also be bound to at least one of the two or more nucleic acid chains (eg, the first nucleic acid chain and / or the second nucleic acid chain) via a cleavable or uncleavable linker.

[0144] In some embodiments, the TDP-43 binding sequences of two or more nucleic acid chains in the multivalent binding nucleic acid agents of the present invention bind to the RNA recognition motif (RRM) of the TDP-43 protein. The TDP-43 protein has two RRMs, RRM1 and RRM2, and the TDP-43 binding sequence can bind to either or both of them.

[0145] In one embodiment, the TDP-43 binding sequence that binds to the RNA recognition motif of the TDP-43 protein consists of or includes a repeating sequence represented by the following formula (I).

[0146] (X0GX1X2X3...X m ) n (I)

[0147] In formula (I), X0 is T or U; X1, X2, X3...X m It may exist or not. If it exists, X1, X2, X3...X m It is independently any one of A, C, G, T or U, which may be the same or different; m is 1 to 10; n represents the number of repetitions, which is 2 to 50, preferably 5 to 25 or 4 to 15.

[0148] Specific examples of the repeating sequence represented by the above formula (I) include a repeating sequence of the sequence UGGAA represented by the following formula (II).

[0149] (UGGAA) n (II)

[0150] In formula (II), n represents the number of repetitions, which is 2 to 50, preferably 15 to 25.

[0151] In another embodiment, the TDP-43 binding sequence that binds to the RNA recognition motif of the TDP-43 protein consists of or includes a repeating sequence represented by the following formula (III).

[0152] (U MeGX1X2X3...X m ) n (III)

[0153] In formula (III), U Me is a 2'-O-methyl modified nucleoside; G can be a natural ribonucleoside or a 2'-O-methyl modified nucleoside or other 2'-modified nucleoside; X1, X2, X3...X m It may exist or not. If it exists, X1, X2, X3...X m It is independently any one of A, C, G, T or U, which may be the same or different; it may also be a natural ribonucleoside or a 2'-modified nucleoside such as a 2'-O-methyl modified nucleoside; m is 1 to 10; n represents the number of repetitions, which is 2 to 30, preferably 5 to 25 or 4 to 15.

[0154] Examples of TDP-43 binding sequences comprising any one of the above formulas (I) to (III) include: AUG12 composed of the base sequence (GUGUGAAUGAAU) shown in SEQ ID NO: 6, and CLIP_34 composed of the base sequence (GAGAGAGCGCGUGCAGAGACUUGGUGGUGCAUAA) shown in SEQ ID NO: 7 (Lukavsky, PJ et al., Nat Struct Mol Biol, 2013, 20(12): 1443-9.; Grese Z R et al., EMBO Rep, 2021, 22(12): e53632.; Ayala Y M et al., EMBO J, 2011, 30(2): 277-88.; Mann, J R et al., Neuron, 2019, 102(2): 321-338.e8.).

[0155] Non-limiting examples of TDP-43 binding sequences that bind to the RNA recognition motif of the TDP-43 protein are as follows: Me G) 5~15 、(U Me G) 12 、(U Me G Me ) 5~15 、(U Me G Me ) 12 、(U Me GGAA) 5~10 、(U Me GGAA)8, (U Me G Me GAA 5~10 、(U MeG Me GAA)8、(U Me G Me G Me AA) 5~10 、(U Me G Me G Me AA)8、(U Me G Me G Me A Me A) 5~10 、(U Me G Me G Me A Me A)8、(U Me G Me G Me A Me A Me ) 5~10 、(U Me G Me G Me A Me A Me )8、(U Me GG Me AA) 5~10 、(U Me GG Me AA)8、(U Me GGA Me A) 5~10 、(U Me GGA Me A)8、(U Me GGAA Me ) 5~10 、(U Me GGAAA Me )8、(U Me G Me GA Me A) 5~10 、(U Me G Me GA Me A)8、(U Me G Me GAA Me ) 5~10 、(U Me G Me GAA Me )8、(U Me GG Me A Me A) 5~10 、(U Me GG Me A Me A)8、(UMe GG Me AA Me ) 5~10 、(U Me GG Me AA Me )8、(U Me GGA Me A Me ) 5~10 、(U Me GGA Me A Me )8、(U Me GG Me A Me A Me ) 5~10 、(U Me GG Me A Me A Me )8、(U Me G Me GA Me A Me ) 5~10 、(U Me G Me GA Me A Me )8、(U Me G Me G Me AA Me ) 5~10 、(U Me G Me G Me AA Me )8. In the above specific example, U Me 、A Me and G Me represents a 2'-O-methyl modified nucleoside, and A and G represent unmodified ribonucleosides. Furthermore, in the above specific examples, the 2'-O-methyl modified nucleoside can be independently substituted with a 2'-O-methoxyethyl modified nucleoside or a 2'-O-[2-(N-methylcarbamoyl)ethyl] modified nucleoside, and U can also be independently substituted with T.

[0156] In another embodiment, the TDP-43 binding sequence that binds to the RNA recognition motif of the TDP-43 protein consists of or includes a repeating sequence represented by the following formula (IV).

[0157] (XG) n (IV)

[0158] In formula (IV), X represents T or U.

[0159] In formula (IV), n, which represents the number of repeats, is greater than or equal to 3. In this case, the repeating sequence of formula (IV) is at least 6mer, which is long enough to bind to the fragmented TDP-43 protein. There is no upper limit for n, and the repeating sequence of formula (IV) can be of a length sufficient to bind to one (one molecule) or two (two molecules) or more TDP-43 proteins or fragments thereof. For example, n can be 3-30, 3-20, or 3-10.

[0160] In a preferred embodiment, the length of the TDP-43 binding sequence is sufficient to bind to one TDP-43 protein or fragment thereof. In this case, n in formula (IV) can be, for example, 6 or less or 5 or less, and the range of n is 3 to 6 or 3 to 5. In this case, the repeating sequence in formula (IV) is a 6mer to 12mer or a 6mer to 10mer. It should be noted that the n Xs contained in formula (IV) can independently be T or U, or all can be T or all can be U. Therefore, in another embodiment, the TDP-43 binding sequence consists of or contains the repeating sequence represented by the following formula (V).

[0161] (TG) n (V)

[0162] In another embodiment, the TDP-43 binding sequence consists of or comprises a repeating sequence represented by the following formula (VI).

[0163] (UG) n (VI)

[0164] The TDP-43 binding sequence or the repetitive sequence represented by formulas (I) to (VI) above may include natural nucleosides and / or non-natural nucleosides. Furthermore, the internucleoside linkages in the TDP-43 binding sequence or the repetitive sequence represented by formulas (I) to (VI) above may be natural or modified internucleoside linkages, or a combination thereof.

[0165] In one embodiment, the repetitive sequence represented by the above formula (I), (II), (IV), (V) or (VI) is composed of RNA nucleosides. In this case, the repetitive sequence is a repetitive RNA sequence.

[0166] For example, the TDP-43 binding sequence can also be composed of bridging nucleosides and / or 2'-modified nucleosides connected by natural or modified internucleoside bonds. In one embodiment, the non-natural ribonucleoside is a 2'-O-methyl modified nucleoside, a 2'-O-methoxyethyl modified nucleoside, or a 2'-O-[2-(N-methylcarbamoyl)ethyl] modified nucleoside.

[0167] In one embodiment, at least the first U or T in the repetitive sequence represented by the above formula (I), (II), (IV), (V) or (VI) is a 2'-modified nucleoside or a 2'-modified ribonucleoside. In this embodiment, the other bases in the repetitive sequence may or may not be 2'-modified nucleosides or 2'-modified ribonucleosides, and the second G is preferably a 2'-modified ribonucleoside. The above 2'-modified ribonucleoside is not limited and may be a 2'-O-methyl modified nucleoside, a 2'-O-methoxyethyl modified nucleoside, a 2'-O-[2-(N-methylcarbamoyl)ethyl] modified nucleoside, or a combination thereof.

[0168] In another embodiment, all bases in the repeating sequences represented by formulas (I) to (VI) above may be 2'-modified ribonucleosides. The 2'-modified ribonucleosides are not limited and may be 2'-O-methyl modified nucleosides, 2'-O-methoxyethyl modified nucleosides, 2'-O-[2-(N-methylcarbamoyl)ethyl] modified nucleosides, or combinations thereof.

[0169] 1-4. Method for producing a multivalent binding nucleic acid agent

[0170] The multivalent binding nucleic acid agent of the present invention can be manufactured by those skilled in the art by appropriately selecting a known method. The method is not limited, and is usually to start with designing and manufacturing each nucleic acid chain in two or more nucleic acid chains constituting the multivalent binding nucleic acid agent. Then, according to the designed base sequence information, for example, commercially available automatic nucleic acid synthesizers such as GE Healthcare, Thermo Fisher Scientific, Beckman Coulter, etc. can be used to synthesize each nucleic acid chain. Then, a reverse phase chromatography column or the like can be used to purify the oligonucleotide obtained. The method of connecting a spacer such as a joint to a nucleic acid chain is well known in the art. In addition, the nucleic acid chain can also specify a base sequence and a modification site and a type, and can be ordered and obtained from major manufacturers (such as GeneDesign Co., Ltd.).

[0171] 1-5. Effect

[0172] Through the nucleic acid agent of the present invention, according to the spacer such as the linker disposed between two or more TDP-43 binding sequences, multiple TDP-43 proteins or fragments thereof bound to the TDP-43 binding sequence are arranged in spatially separated positions, or the approach, contact or binding between the C-terminal regions of multiple TDP-43 proteins or fragments thereof bound to the TDP-43 binding sequence is inhibited, or their phase separation is promoted, thereby effectively inhibiting the formation of aggregates. In addition, according to the nucleic acid agent of the present invention, the TDP-43 protein dimer is stabilized, thereby reducing the proportion of monomers, thereby also inhibiting the formation of monomer aggregates. Unexpectedly, the nucleic acid agent of the present invention also exhibits an aggregation inhibitory effect on mutant TDP-43 proteins that cannot form dimers.

[0173] The mechanism of action of the nucleic acid agent of the present invention is not limited and can be described, for example, as follows. Each of the two or more TDP-43 binding sequences comprising the nucleic acid agent of the present invention binds to a monomeric TDP-43 protein or a fragment thereof. The monomers bound to the TDP-43 binding sequences then form multimers such as dimers via bonds between their N-terminal domains.

[0174] According to the present invention, methods for treating and / or preventing diseases such as neurodegenerative diseases, comprising administering any of the multivalent binding nucleic acid agents described above to a human or other subject, as well as methods (in vitro or in vivo) for inhibiting the toxicity, accumulation, and / or aggregation of a TDP-43 protein or a fragment thereof (e.g., a C-terminal fragment) are also provided.

[0175] Furthermore, the present invention also provides use of any of the above-mentioned multivalent binding nucleic acid agents for treating and / or preventing diseases such as neurodegenerative diseases in human subjects.

[0176] The present invention also provides use of any of the above-mentioned multivalent binding nucleic acid agents in the manufacture of a medicament for treating and / or preventing diseases such as neurodegenerative diseases.

[0177] In addition, the present invention also provides use of any of the above-mentioned multivalent binding nucleic acid agents for inhibiting the toxicity, accumulation and / or aggregation of a TDP-43 protein or a fragment thereof (e.g., a C-terminal fragment), or for stabilizing TDP-43 protein dimers.

[0178] 2. Pharmaceutical Composition

[0179] 2-1. Overview

[0180] A second aspect of the present invention is a pharmaceutical composition. The pharmaceutical composition of the present invention comprises any of the multivalent binding nucleic acid agents described in the first aspect as an active ingredient. The pharmaceutical composition of the present invention can exhibit preventive or therapeutic effects on neurodegenerative diseases such as TDP-43 proteinopathy.

[0181] The following is a detailed description of the various components that may be contained in the pharmaceutical composition of the present invention.

[0182] 2-2. Composition

[0183] 2-2-1. Active ingredients

[0184] The pharmaceutical composition of the present invention comprises at least the multivalent binding nucleic acid agent described in the first aspect as an active ingredient. The pharmaceutical composition of the present invention may contain one or more multivalent binding nucleic acid agents.

[0185] The amount (content) of the multivalent binding nucleic acid agent contained in the pharmaceutical composition of the present invention varies depending on the type of multivalent binding nucleic acid agent, the delivery site, the dosage form of the pharmaceutical composition, the dosage of the pharmaceutical composition, and the type of carrier described later. Therefore, various conditions can be considered and appropriately determined. Usually, an effective amount of multivalent binding nucleic acid agent is contained in the composition prepared into a single administration amount. "Effective amount" refers to the amount necessary for the multivalent binding nucleic acid agent to function as an active ingredient, and the amount that almost or completely does not impart harmful side effects to the organism to which it is applied. The effective amount can vary according to various conditions such as the information of the subject, the route of administration, and the number of administrations. It is ultimately determined based on the judgment of a doctor, veterinarian, pharmacist, etc. "Subject information" refers to various individual information of the organism to which the pharmaceutical composition is applied. For example, if the subject is a human, it includes age, weight, sex, diet, health status, degree and severity of disease progression, drug sensitivity, whether there are combined drugs, etc.

[0186] 2-2-2. Carrier

[0187] The pharmaceutical composition of the present invention may contain a pharmaceutically acceptable carrier. "Pharmaceutically acceptable carrier" refers to additives commonly used in the field of pharmaceutical preparation technology. Examples include: solvents, vegetable oils, bases, emulsifiers, suspending agents, surfactants, pH adjusters, stabilizers, excipients, vehicles, preservatives, binders, diluents, isotonic agents, sedatives, fillers, disintegrants, buffers, coating agents, lubricants, thickeners, solubilizers, and other additives.

[0188] The solvent may be, for example, water or a pharmaceutically acceptable aqueous solution other than water, or any pharmaceutically acceptable organic solvent. Examples of aqueous solutions include isotonic solutions containing physiological saline, glucose or other adjuvants, phosphate buffer, and sodium acetate buffer. Examples of adjuvants include D-sorbitol, D-mannose, D-mannitol, and sodium chloride. Other examples include low-concentration nonionic surfactants and polyoxyethylene sorbitan fatty acid esters.

[0189] These carriers are used not only to prevent or suppress the degradation of the multivalent binding nucleic acid agent as an active ingredient by enzymes in the body but also to facilitate formulation and administration, maintain the dosage form and efficacy, and can be used appropriately as needed.

[0190] 2-2-3. Dosage form

[0191] The dosage form of the pharmaceutical composition of the present invention is not particularly limited as long as it does not inactivate the multivalent binding nucleic acid agent described in the first aspect as the active ingredient due to degradation, can be delivered to the target site, and can exert the pharmacological effect of the active ingredient in vivo.

[0192] The specific dosage form varies depending on the administration method and / or prescription conditions. Administration methods can be roughly divided into parenteral administration and oral administration, so it is sufficient to prepare a dosage form suitable for each administration method.

[0193] If the method of administration is non-oral administration, the preferred dosage form is a liquid that can be directly administered to the target site or administered systemically through the circulatory system. Examples of liquids include injections. Injections can be appropriately combined with the above-mentioned excipients, elixirs, emulsifiers, suspending agents, surfactants, stabilizers, pH regulators, etc., and mixed in accordance with the unit dosage form generally considered required for pharmaceutical implementation to prepare the formulation. In addition, it can also be an ointment, plaster, paste (cataplasm), transdermal agent, lotion, inhalant, aerosol, eye drops and suppository.

[0194] If the administration method is oral administration, preferred dosage forms include solids (including tablets, capsules, drops, and lozenges), granules, powders, dispersants, and liquids (including internal aqueous solutions, emulsions, and syrups). Solids can be coated as needed using methods known in the art, such as sugar-coated tablets, gelatin-coated tablets, enteric-coated tablets, film-coated tablets, double-layer tablets, and multi-layer tablets.

[0195] It should be noted that the specific shape and size of each of the above dosage forms are not particularly limited as long as they are within the dosage form range known in the art. The pharmaceutical composition of the present invention can be prepared by conventional methods in the art.

[0196] 2-3. Application method and application amount

[0197] In this specification, the preferred mode of administration of the pharmaceutical composition is not particularly limited. Administration can be systemic administration or local administration. The route of administration can be oral administration or parenteral administration. Specific examples of parenteral administration include intravenous administration, intraarterial administration, blood transfusion administration, intraperitoneal administration, intraventricular administration, intramedullary administration, intraocular administration, intramuscular administration, subcutaneous administration (including implantable continuous subcutaneous administration), intradermal administration, intravesical administration, vaginal administration, rectal administration, inhalation or nasal administration, and tracheal / bronchial administration. When the object of application of the present invention is the brain, intraventricular administration or intramedullary administration as the object site is more appropriate. For example, administration can be intravenous administration, intratumoral administration, hepatic artery injection, splenic subcapsular injection, subcutaneous administration, intraventricular administration or intramedullary administration. Intramedullary administration is, for example, intraventricular administration, posterior cranial fossa puncture or lumbar puncture. In addition, intramedullary administration can use a shunt, an indwelling catheter or a subcutaneous infusion port to administer the pharmaceutical composition of the present invention.

[0198] When the pharmaceutical composition is used by administration or ingestion, the dosage or ingestion amount can be set to, for example, 0.00001 mg / kg / day to 10000 mg / kg / day or 0.001 mg / kg / day to 100 mg / kg / day of the multivalent binding nucleic acid agent contained. Administration of the pharmaceutical composition can be a single administration or multiple administrations. In the case of multiple administrations, it can also be administered daily or at appropriate time intervals (e.g., 1 day, 2 days, 3 days, 1 week, 2 weeks, 1 month intervals), for example, 2 to 20 times. The single dose of the multivalent binding nucleic acid agent can be, for example, 0.001 mg / kg or more, 0.005 mg / kg or more, 0.01 mg / kg or more, 0.25 mg / kg or more, 0.5 mg / kg or more, 1.0 mg / kg or more, 2.0 mg / kg or more, 3.0 mg / kg or more, 4.0 mg / kg or more, 5 mg / kg or more, 10 mg / kg or more, 20 mg / kg or more, 30 mg / kg or more, 40 mg / kg or more, 50 mg / kg or more, 75 mg / kg or more, / kg or more, 100 mg / kg or more, 150 mg / kg or more, 200 mg / kg or more, 300 mg / kg or more, 400 mg / kg or more or 500 mg / kg or more, for example, any amount within the range of 0.001 mg / kg to 500 mg / kg (for example, 0.001 mg / kg, 0.01 mg / kg, 0.1 mg / kg, 1 mg / kg, 5 mg / kg, 10 mg / kg, 50 mg / kg, 100 mg / kg or 200 mg / kg) can be appropriately selected.

[0199] For example, when the pharmaceutical composition of the present invention is administered intramedullary, if the subject is a monkey or a human, the multivalent binding nucleic acid agent can be administered in an amount of 0.01 mg or more, 0.1 mg or more, or 1 mg or more, for example, 2 mg or more, 3 mg or more, 4 mg or more, 5 mg or more, 10 mg or more, 20 mg or more, 30 mg or more, 40 mg or more, 50 mg or more, 75 mg or more, 100 mg or more, 200 mg or more, 300 mg or more, 400 mg or more, or 500 mg or more. 0.01 mg to 1000 mg, 0.1 mg to 200 mg, or 1 mg to 20 mg can also be administered. If the subject is a mouse, 1 μg or more can be administered.

[0200] The multivalent binding nucleic acid agent of the present invention can be administered 4 times at a dose of 0.01 to 10 mg / kg (e.g., approximately 6.25 mg / kg) at a frequency of 2 times per week. Alternatively, the multivalent binding nucleic acid agent can be administered 2 to 4 times at a dose of 0.05 to 30 mg / kg (e.g., approximately 25 mg / kg) at a frequency of 1 to 2 times per week, for example, twice at a frequency of 2 times per week. This administration regimen (split administration) can reduce toxicity (e.g., avoid thrombocytopenia) compared to a single high-dose administration, thereby reducing the burden on the subject.

[0201] Even if the pharmaceutical composition is repeatedly administered, it can also play a cumulative inhibitory effect in cells. In addition, in the case of repeated administration, setting a certain degree of administration interval (for example, half a day or more) can improve the effectiveness.

[0202] 2-4. Target diseases

[0203] The diseases that are the target of application of the pharmaceutical composition of the present invention are mainly neurodegenerative diseases. Neurodegenerative diseases refer to progressive diseases in which the nerve cells of the central nervous system gradually degenerate due to the aggregation of abnormal protein aggregates, leading to functional defects and cell apoptosis. Specific examples of neurodegenerative diseases related to the TDP-43 protein include: amyotrophic lateral sclerosis (ALS), i.e., sporadic amyotrophic lateral sclerosis or familial amyotrophic lateral sclerosis; frontotemporal lobar degeneration (FTLD); Alzheimer's disease; Lewy body dementia; Huntington's disease; Parkinson's disease; argyrophilic grain dementia (Grain disease); Perry syndrome; progressive supranuclear palsy; corticobasal degeneration; multiple system atrophy, etc. Frontotemporal lobar degeneration can be, for example, Pick's disease. The pharmaceutical composition of the present invention can be used in particular for the prevention or treatment of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. In addition, the pharmaceutical composition of the present invention can also be used for the prevention or treatment of neurodegenerative diseases associated with dementia. A particularly preferred neurodegenerative disease is TDP-43 proteinopathy caused by abnormal aggregation of TDP-43 protein or its fragments in the cytoplasm and the formation of intracellular inclusion bodies.

[0204] The pharmaceutical composition can be used in animals including humans as test subjects. However, there are no specific limitations on animals other than humans, and various livestock, poultry, pets, experimental animals, etc. can be used as test subjects in some embodiments. The test subject can be a subject in need of preventing or treating a neurodegenerative disease in the central nervous system and / or peripheral nervous system.

[0205] 2-5. Effect

[0206] The pharmaceutical compositions of the present invention can be used to prevent or treat neurodegenerative diseases. Furthermore, the pharmaceutical compositions of the present invention can inhibit the progression of neurodegenerative diseases and prevent recurrence. The pharmaceutical compositions of the present invention can also be used to inhibit or block abnormal intracellular aggregation and cytoplasmic accumulation of TDP-43 protein or its fragments.

[0207] According to the present invention, there is also provided a method for treating and / or preventing neurodegenerative diseases, etc., comprising administering the above-mentioned pharmaceutical composition to a subject such as a human.

[0208] [Example]

[0209] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to these examples.

[0210] <Example 1: Preparation of Bivalent Decoy Nucleic Acid>

[0211] (Purpose)

[0212] A novel bait nucleic acid has been developed that contains two TDP-43 binding sequences at either end of a spacer. The presence of these spacers inhibits aggregate formation between TDP-43 proteins bound to each TDP-43 binding sequence. In the following examples, bait nucleic acids capable of binding to at least two TDP-43 molecules are referred to as "divalent bait nucleic acids."

[0213] (Methods and Results)

[0214] By binding a TDP-43 binding sequence capable of binding to one molecule of TDP-43 protein to both ends of a spacer, a bivalent decoy nucleic acid capable of binding TDP-43 protein at separate positions is prepared using a spacer composed of a nucleic acid.

[0215] The structures of the monovalent decoy nucleic acid used as a control, the bivalent decoy nucleic acid without a spacer, and the bivalent decoy nucleic acid containing a nucleic acid as a spacer for binding the TDP-43 binding sequence to both ends are shown in the following Tables 1 and Figure 1 .

[0216] [Table 1]

[0217] Table 1: Structure of bait nucleic acids

[0218]

[0219] Uppercase letters: 2'-O-methyl-RNA; Underlined uppercase letters: LNA; Lowercase letters: DNA;

[0220] The internucleoside bonds are all phosphodiester bonds.

[0221] Bait nucleic acid (UG) 6 is a monovalent bait nucleic acid composed of 2'-O-methyl-RNA nucleosides and capable of binding to one TDP-43 protein.

[0222] Bait nucleic acid (UG) 12 It is a bivalent decoy nucleic acid composed of 2'-O-methyl-RNA nucleosides and capable of binding to two TDP-43 proteins. It has a structure in which two (UG)6 sequences are connected by an internucleoside bond and does not contain a spacer.

[0223] Bait nucleic acid A 12 It is composed of 2'-O-methyl-RNA nucleosides, and contains a (UG)6 sequence capable of binding to one TDP-43 protein on each side of the 5' end and the 3' end of the nucleic acid chain, and contains A 12 The sequence serves as a bivalent decoy nucleic acid spacer that is unable to bind to TDP-43.

[0224] Bait nucleic acid A(L) 12 The 5' and 3' ends of the nucleic acid chain each contain a (UG)6 sequence composed of 2'-O-methyl-RNA nucleosides capable of binding to one TDP-43 protein, and the central region therebetween contains an A(L) composed of locked nucleic acid (LNA). 12 The sequence serves as a bivalent decoy nucleic acid spacer that is unable to bind to TDP-43.

[0225] Bait nucleic acid A 12 / t 12 It is a bivalent decoy nucleic acid composed of a double-stranded complex, one of which has the same 12 The same configuration, the other nucleic acid chain contains t 12 sequence.

[0226] The above nucleic acid agents were synthesized by contract from GeneDesign Co., Ltd. and Hokkaido System Science Co., Ltd.

[0227] <Example 2: In vitro aggregation experiment>

[0228] (Purpose)

[0229] The inhibitory effect of the decoy nucleic acid prepared in Example 1 on TDP-43 protein aggregation was verified in vitro.

[0230] (Methods and Results)

[0231] (1) Preparation of brain extract containing TDP-43 protein

[0232] A brain extract containing endogenous TDP-43 protein was prepared using the following method. Striatum was removed from wild-type mice (C57BL / 6J, 5-8 weeks old, male) without fixative perfusion and pulverized in 10 times the brain mass of H buffer (50 mM HEPES pH 7.4, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 5 mM MgCl2, 1 mM EGTA, protease inhibitors, phosphatase inhibitors). Pulverization was repeated 10 times on ice at 900 rpm using a Potter-type homogenizer. The pulverized solution was centrifuged at 20,000 × g at 4°C for 30 minutes, and the supernatant was recovered. This supernatant was adjusted to 3 mg / mL and used as the brain extract for the following in vitro aggregation experiments.

[0233] (2) In vitro aggregation assay

[0234] An outline of the in vitro aggregation assay is shown in Figure 2 . The bait nucleic acid prepared in Example 1 was added to the brain extract prepared in (1) above, so that the final concentration of the monovalent bait nucleic acid (UG) 6 reached 0.2 μM and the final concentration of the other divalent bait nucleic acids reached 0.1 μM, and the mixture was shaken at 37°C and 1,800 rpm for 3 hours. It should be noted that as a negative control, the sample without the addition of bait nucleic acid was also shaken. Then, the mixture was centrifuged at 4°C and 16,000×g for 30 minutes to separate the supernatant and precipitate components. For these two components, protein blotting was performed using a polyclonal TDP-43 antibody (12892-1-AP) from Proteintech (Rosemont, IL) to detect TDP-43 protein, and the band intensity was quantified by a densitometer to determine the amount of TDP-43 protein contained in each component. The ratio of TDP-43 protein in the precipitate component to the sum of the supernatant component and the precipitate component was calculated as the aggregation rate.

[0235] (result)

[0236] The results of the TDP-43 aggregation inhibitory effects of each decoy nucleic acid in the in vitro aggregation assay are shown in FIG. Figure 3 Bivalent decoy nucleic acid A containing a spacer 12 、A(L) 12 and A 12 / t 12 It showed a stronger aggregation inhibition effect than the monovalent decoy nucleic acid (UG)6 and a stronger effect than the bivalent decoy nucleic acid (UG) without a spacer. 12 Compared with the above, it showed the same or better aggregation inhibition effect.

[0237] <Example 3: Verification of the Aggregation Inhibitory Effect on 6M Mutant TDP-43 Protein>

[0238] (Purpose)

[0239] Verify the aggregation inhibitory effect on mutant TDP-43 proteins that do not form dimers.

[0240] (Methods and Results)

[0241] In this example, a mutant TDP-43 protein with six mutations (E14A / E17A / E21A / Q34A / R52A / R55A) that lacks the ability to form dimers (hereinafter referred to as the "6M mutant TDP-43 protein") was used for in vitro aggregation experiments. It is known that this six mutation (E14A / E17A / E21A / Q34A / R52A / R55A) does not affect the folding structure of the N-terminal domain of the TDP-43 protein, but blocks multimerization (Afroz, T, et al., Nat Commun, 2017, 8, 45). It is also believed that the multimerization ability of 25kDa or 35kDa fragments lacking the N-terminal domain and S48 phosphorylated TDP-48 proteins is inhibited or impaired in the same manner as the six-mutant.

[0242] The 6M mutant TDP-43 protein was prepared by in vitro translation. DNA encoding the human TDP-43 protein was introduced into the pcDNA3.1(+) vector, and site-specific mutagenesis was performed using PCR to introduce six mutations (E14A / E17A / E21A / Q34A / R52A / R55A). This expression vector for the 6M mutant TDP-43 protein was constructed. This expression vector was used with an in vitro translation kit (TNT T7 Rapid Coupled Transcription / Translation System, Promega) using rabbit erythrocyte extract to produce the 6M mutant TDP-43 protein.

[0243] The bivalent decoy nucleic acid was mixed with 6M mutant TDP-43 protein to a final concentration of 0.1 μM. Similarly, the monovalent decoy nucleic acid (UG)6 was mixed to a final concentration of 0.2 μM. A sample without decoy nucleic acid was used as a negative control. Shaking and centrifugation were performed using the same method as in Example 2, and the amount of TDP-43 protein in the supernatant and precipitate fractions was quantified to assess the aggregation rate.

[0244] The results are shown in Figure 4 Bivalent decoy nucleic acid without spacer (UG) 12 Compared with the negative control without bait nucleic acid, no significant aggregation inhibition effect was observed. 12 and A 12 / t 12showed an aggregation inhibition effect, especially A 12 / t 12 The strongest effect was demonstrated. This result indicates that, by placing a spacer between two TDP-43 binding sequences in a bivalent decoy nucleic acid, an aggregation-inhibiting effect can be achieved against mutant TDP-43 proteins that do not form dimers. Similar to the six-fold mutant, the multimer-forming ability of 25kDa or 35kDa fragments lacking the N-terminal domain and S48-phosphorylated TDP-48 proteins is inhibited or impaired. Therefore, it is believed that the nucleic acid agent of the present invention has a significant aggregation-inhibiting effect in both familial and sporadic ALS.

[0245] <Example 4: Evaluation of the Existence Ratio of Monomers and Dimers of TDP-43 Protein>

[0246] (Purpose)

[0247] In the presence of various decoy nucleic acids prepared in Example 1, the ratio of TDP-43 protein dimers to monomers was evaluated.

[0248] (Methods and Results)

[0249] A solution containing wild-type (WT) and 6M mutant TDP-43 proteins expressed by in vitro translation was diluted 2-fold with the aforementioned H buffer. Various decoy nucleic acids were then added to a final concentration of 0.1 μM for the monovalent decoy nucleic acid (UG)6 and 0.05 μM for the divalent decoy nucleic acid. The mixture was shaken steadily at 37°C for 30 minutes. N,N'-disuccinimidyl glutarate (DSG, Wako) was then added to a final concentration of 1 mM, and the mixture was shaken at room temperature for 30 minutes to initiate a cross-linking reaction. The cross-linking reaction was then terminated by adding 20 mM Tris-HCl, pH 8.0, and shaking at room temperature for 15 minutes. The bridged nucleic acid-TDP-43 protein complex was detected by Western blotting, and the intensities of the bands corresponding to monomers and dimers were quantified to assess the ratio of dimers to monomers.

[0250] The results are shown in Figure 5 and Figure 6 In the absence of bait nucleic acid and the addition of monovalent bait nucleic acid (UG) 6, both wild-type (WT) and 6M mutant TDP-43 proteins mainly detected bands corresponding to TDP-43 monomers, and the proportion of dimers was extremely low. On the other hand, when divalent bait nucleic acid (UG) was added, the TDP-43 monomers were mainly detected. 12 、A 12 、A(L) 12 and A 12 / t 12In this case, both the wild-type (WT) and 6M mutant TDP-43 proteins showed a high ratio of the band corresponding to the TDP-43 dimer.

[0251] Furthermore, the comparison with the results showing almost no dimer formation with the monovalent decoy nucleic acid (UG)6 suggests that the two (UG)6 sequences in the bivalent decoy nucleic acid do not independently induce dimer formation, but rather coordinately promote dimer formation. Therefore, it is believed that when using bivalent decoy nucleic acids, the decoy nucleic acid and TDP-43 protein bind at a 1:2 ratio to form a complex.

[0252] In addition, especially the addition of A 12 、A(L) 12 and A 12 / t 12 The dimer ratio in the case of adding (UG) 12 This indicates that the configuration of a spacer between the two TDP-43 binding sequences in the bivalent decoy nucleic acid will increase the proportion of TDP-43 dimers, indicating that the introduction of the spacer will enhance the above-mentioned coordination effect between the two (UG)6 sequences ( Figure 6 ).

[0253] <Example 5: Effects of Spacers Other Than Nucleic Acids>

[0254] (Purpose)

[0255] A bivalent decoy nucleic acid containing two TDP-43 binding sequences and a spacer other than a nucleic acid disposed therebetween was prepared, and its effect on inhibiting TDP-43 protein aggregation was verified.

[0256] (Methods and Results)

[0257] (1) Preparation of nucleic acid agents

[0258] By attaching a TDP-43 binding sequence capable of binding to a single molecule of TDP-43 protein to both ends of a spacer, a bivalent nucleic acid agent capable of binding TDP-43 protein at distant locations was prepared using a spacer other than a nucleic acid. The bivalent decoy nucleic acid prepared in this example is as follows.

[0259] The structure of a bivalent decoy nucleic acid (hereinafter referred to as "Spacer-9") containing a (UG)6 sequence composed of 2'-O-methyl-RNA nucleosides at both ends of triethylene glycol (TEG) and capable of binding to one TDP-43 protein is shown in the following formula (VII) and Figure 7 .

[0260] [Chemistry 1]

[0261]

[0262] (Wherein, U and G represent 2'-O-methyl-RNA)

[0263] The structure of a bivalent decoy nucleic acid (hereinafter referred to as "Spacer-18") containing a (UG)6 sequence composed of 2'-O-methyl-RNA nucleosides at both ends of hexaethylene glycol (HEG) and capable of binding to one TDP-43 protein is shown in the following formula (VIII) and Figure 7 .

[0264] [Chemistry 2]

[0265]

[0266] (Wherein, U and G represent 2'-O-methyl-RNA)

[0267] The structure of a bivalent decoy nucleic acid (hereinafter referred to as "Spacer-C12") containing a (UG)6 sequence consisting of 2'-O-methyl-RNA nucleoside at both ends of an alkylene chain having 12 carbon atoms (C12 alkylene chain) and capable of binding to one TDP-43 protein is shown in the following formula (IX) and Figure 7 .

[0268] [Chemistry 3]

[0269]

[0270] (Wherein, U and G represent 2'-O-methyl-RNA)

[0271] The above nucleic acid agents were synthesized by contract from GeneDesign Co., Ltd. and Hokkaido System Science Co., Ltd.

[0272] (2) In vitro aggregation assay

[0273] In vitro aggregation experiments were conducted using the same method as in Example 2. Specifically, bait nucleic acid was added to brain extract to a final concentration of 0.1 μM. The extract was then shaken and centrifuged using the same method as in Example 2. The amount of TDP-43 protein in the supernatant and precipitate fractions was quantified, and the aggregation rate was assessed. A sample without bait nucleic acid was also used as a negative control.

[0274] The results are shown in Figure 8 The bivalent decoy nucleic acids Spacer-9 and Spacer-18 containing TEG or HEG as spacers exhibited an aggregation-inhibiting effect on TDP-43 protein, with Spacer-9 showing the strongest effect.

[0275] The results of this example demonstrate that a strong aggregation-inhibiting effect can also be achieved using spacers other than nucleic acids. This result suggests that placing two TDP-43 binding sequences at distances from each other via a rigid spacer can effectively inhibit aggregate formation between TDP-43 proteins bound to each TDP-43 binding sequence.

[0276] <Example 6: Preparation of Further Bivalent and Trivalent Decoy Nucleic Acids>

[0277] (Purpose)

[0278] Bivalent bait nucleic acids with spacers of various lengths were prepared. Furthermore, bait nucleic acids containing three TDP-43 binding sequences (hereinafter referred to as "trivalent bait nucleic acids") were prepared. Furthermore, as complex-type bait nucleic acids, nucleic acid complexes consisting of two nucleic acid strands, each containing a TDP-43 binding sequence and an adapter sequence capable of forming a double strand between the nucleic acid strands (hereinafter referred to as "bivalent bait nucleic acid complexes") were prepared.

[0279] (Methods and Results)

[0280] The structures of the bait nucleic acids prepared in this example are shown in Tables 2 and Figure 9 .

[0281] [Table 2]

[0282] Table 2: Structure of bait nucleic acids

[0283]

[0284] Uppercase letters: 2′-O-methyl-RNA;

[0285] The internucleoside bonds are all phosphodiester bonds.

[0286] Bait nucleic acid (UG) 12 and A 12 The bait nucleic acid (UG) prepared in Example 1 was 12 and A 12 same.

[0287] Bait nucleic acid A 24 It is composed of two (UG)6 sequences consisting of 2'-O-methyl-RNA nucleosides, and contains A 24 A bivalent decoy nucleic acid containing a spacer sequence.

[0288] Bait nucleic acid A 48 It is composed of two (UG)6 sequences consisting of 2'-O-methyl-RNA nucleosides, and contains A 48A bivalent decoy nucleic acid containing a spacer sequence.

[0289] Bait nucleic acid A 12 The trivalent body contains three (UG)6 sequences composed of 2'-O-methyl-RNA nucleosides, and contains A between the (UG)6 sequences. 12 A trivalent bait nucleic acid containing two spacer sequences.

[0290] In addition to the above bait nucleic acids, the following bait nucleic acids A3, A6, and A9 were prepared.

[0291] Bait nucleic acid A3: contains two (UG)6 sequences composed of 2'-O-methyl-RNA nucleosides, and contains a spacer consisting of the A3 sequence therebetween.

[0292] Bait nucleic acid A6: contains two (UG)6 sequences composed of 2'-O-methyl-RNA nucleosides, and contains a spacer consisting of the A6 sequence between them.

[0293] Bait nucleic acid A9: contains two (UG)6 sequences composed of 2'-O-methyl-RNA nucleosides, and contains a spacer consisting of the A9 sequence between them.

[0294] In addition, in order to allow the spacer portion of the decoy nucleic acid described in Table 2 to form a double-stranded structure, a t 12 Sequence, t 24 Sequence or t 48 The bait nucleic acid ( Figure 10 ).

[0295] Bait nucleic acid A 12 / t 12 The bait nucleic acid A prepared in Example 1 12 / t 12 same.

[0296] Bait nucleic acid A 24 / t 24 It is a bivalent decoy nucleic acid composed of a double-stranded complex, one of which has the same 24 The same configuration, the other nucleic acid chain is composed of deoxyribonucleosides 24 sequence.

[0297] Bait nucleic acid A 48 / t 48 It is a bivalent decoy nucleic acid composed of a double-stranded complex, one of which has the same 48 The same configuration, the other nucleic acid chain is composed of deoxyribonucleosides 48 sequence.

[0298] Bait nucleic acid A 12 / t 12 A trivalent is a complex trivalent decoy nucleic acid composed of three nucleic acid chains. 12 In addition to the trivalent form, it also contains t 12 Two complementary chains composed of sequences.

[0299] The structures of the divalent decoy nucleic acid complexes prepared in this example are shown in Tables 3 and Figure 11 .

[0300] [Table 3]

[0301] Table 3: Structure of the bait nucleic acid complex

[0302]

[0303] Uppercase letters: 2'-O-methyl-RNA; lowercase letters: DNA;

[0304] The internucleoside bonds are all phosphodiester bonds.

[0305] The bivalent decoy nucleic acid complex Adapter1 / C1 consists of the Adapter1 strand and the C1 strand. Each strand, starting from the 5' end, contains a (UG)6 sequence composed of 2'-O-methyl-RNA nucleosides and a 10-base-long adapter sequence composed of deoxyribonucleosides. The adapter sequences in the Adapter1 and C1 strands consist of complementary base sequences.

[0306] The bivalent decoy nucleic acid complex Adapter2 / C2 consists of an Adapter2 strand and a C2 strand. Each strand, starting from the 5' end, contains a 10-base adapter sequence composed of deoxyribonucleosides and a (UG)6 sequence composed of 2'-O-methyl-RNA nucleosides. The adapter sequences in the Adapter2 and C2 strands consist of complementary base sequences.

[0307] The above nucleic acid agents were synthesized by contract from GeneDesign Co., Ltd. and Hokkaido System Science Co., Ltd.

[0308] <Example 7: In vitro aggregation assay and dimer quantification>

[0309] (Purpose)

[0310] The inhibitory effect of the decoy nucleic acids prepared in Example 6 on TDP-43 protein aggregation was verified in vitro. In addition, TDP-43 protein dimers were quantified in the presence of each decoy nucleic acid.

[0311] (Methods and Results)

[0312] (1) In vitro aggregation assay

[0313] In vitro aggregation experiments were conducted using the same method as in Example 2. Specifically, each bait nucleic acid prepared in Example 6 was added to a brain extract to a final concentration of 0.05 μM. The extract was then shaken and centrifuged using the same method as in Example 2. The amount of TDP-43 protein in the supernatant and precipitate fractions was quantified, and the aggregation rate was assessed. A sample without bait nucleic acid was also used as a negative control.

[0314] The results are shown in Figure 12 A and Figure 13 A. The results showed that A 12 and A 24 and (UG) 12 and A 48 Compared with the Figure 12 A); In addition, A 12 Compared with A3, A6 and A9, the aggregation inhibition effect tends to be higher ( Figure 13 A). It also shows that A 12 Trivalent and A 12 and A 24 Same as A 48 Compared with the aggregation inhibition effect ( Figure 12 A).

[0315] (2) Quantification of TDP-43 protein dimers

[0316] A brain extract of wild-type mice was prepared by the same method as in "(1) Preparation of a brain extract containing TDP-43 protein" in Example 2. Various bait nucleic acids were added to the brain extract to a final concentration of 0.05 μM, and the mixture was shaken steadily at 37°C for 30 minutes. N,N'-disuccinimidyl glutarate (DSG, Wako) was then added to a final concentration of 1 mM, and the mixture was shaken at room temperature for 30 minutes to perform a cross-linking reaction. Tris-HCl pH 8.0 was then added to a final concentration of 20 mM, and the mixture was shaken at room temperature for 15 minutes to stop the cross-linking reaction. The bridged nucleic acid-TDP-43 protein complex was detected by protein blotting, and the intensity of the band equivalent to the dimer was quantified to determine the amount of dimer present.

[0317] The results are shown in Figure 12 B and Figure 13 B. The results show that A 12 and A 24 In the presence of (UG) 12 and A 48 Compared with the presence of Figure 12 B); In addition, A 12 Compared with the presence of A3 and A6, the amount of TDP-43 dimers tends to be more ( Figure 13 B). It also shows that A 12 The presence of trivalents and A 12 and A 24 Compared with the presence of Figure 12 B).

[0318] The results of (1) and (2) above indicate that the decoy nucleic acid having a spacer consisting of a nucleic acid chain of 12 to 24 bases in length is particularly effective.

[0319] (3) Correlation analysis

[0320] Based on the results of (1) and (2) above, we verified whether there is a correlation between the quantitative value of dimer and the aggregation rate in in vitro aggregation experiment. 12 、A 12 、A 24 、A 48 and A 12 The quantitative results of trivalents and dimers are plotted on the horizontal axis and the aggregation rate is plotted on the vertical axis. Figure 14 The coefficient of determination (R 2 The value) was 0.9327, indicating an extremely high correlation. From this result, it can be seen that the more the amount of dimer is increased, the higher the aggregation inhibition effect is.

[0321] <Example 8: Preparation of a Further Decoy Nucleic Acid Containing a Spacer Other than Nucleic Acid>

[0322] (Purpose)

[0323] A further bivalent decoy nucleic acid is prepared comprising two TDP-43 binding sequences and a spacer other than a nucleic acid disposed therebetween.

[0324] (Methods and Results)

[0325] The structure of the bait nucleic acid prepared in this example is shown in Figure 15 and Figure 16 The structure of the bivalent decoy nucleic acid prepared in this example is as follows.

[0326] The decoy nucleic acid Spacer-3 is a bivalent decoy nucleic acid comprising two (UG)6 sequences consisting of 2'-O-methyl-RNA nucleosides and a spacer consisting of an ethylene glycol group disposed therebetween. The structure of the decoy nucleic acid Spacer-3 is shown in the following formula (X).

[0327] [Chemistry 4]

[0328]

[0329] Wherein, U and G represent 2'-O-methyl-RNA.

[0330] The decoy nucleic acid Spacer-9 is a bivalent decoy nucleic acid comprising two (UG)6 sequences consisting of 2'-O-methyl-RNA nucleosides and a spacer consisting of a triethylene glycol group disposed therebetween. The structure of the decoy nucleic acid Spacer-9 is shown in Formula (VII).

[0331] Bait nucleic acid Spacer-12 is a bivalent bait nucleic acid comprising two (UG)6 sequences consisting of 2'-O-methyl-RNA nucleosides and a spacer consisting of a tetraethylene glycol group disposed therebetween. The structure of Bait nucleic acid Spacer-12 is shown in the following formula (XI).

[0332] [Chemistry 5]

[0333]

[0334] Wherein, U and G represent 2'-O-methyl-RNA.

[0335] Bait nucleic acid Spacer-18 is a bivalent decoy nucleic acid comprising two (UG)6 sequences consisting of 2'-O-methyl-RNA nucleosides and a spacer consisting of a hexaethylene glycol group disposed therebetween. The structure of Bait nucleic acid Spacer-18 is shown in Formula (VIII) above.

[0336] The decoy nucleic acid Spacer-C3 is a bivalent decoy nucleic acid consisting of two (UG)6 sequences composed of 2'-O-methyl-RNA nucleosides and a spacer consisting of an alkylene chain with 3 carbon atoms (C3 alkylene chain) disposed therebetween. The structure of the decoy nucleic acid Spacer-C3 is shown in the following formula (XII).

[0337] [Chemistry 6]

[0338]

[0339] Wherein, U and G represent 2'-O-methyl-RNA.

[0340] The decoy nucleic acid Spacer-C6 is a bivalent decoy nucleic acid consisting of two (UG)6 sequences composed of 2'-O-methyl-RNA nucleosides and a spacer consisting of an alkylene chain with 6 carbon atoms (C6 alkylene chain) disposed therebetween. The structure of the decoy nucleic acid Spacer-C6 is shown in the following formula (XIII).

[0341] [Chemistry 7]

[0342]

[0343] Wherein, U and G represent 2'-O-methyl-RNA.

[0344] The decoy nucleic acid Spacer-C12 is a bivalent decoy nucleic acid consisting of two (UG)6 sequences composed of 2'-O-methyl-RNA nucleosides and a spacer consisting of an alkylene chain with 12 carbon atoms (C12 alkylene chain) disposed therebetween. The structure of the decoy nucleic acid Spacer-C12 is shown in Formula (IX) above.

[0345] The above nucleic acid agents were synthesized by contract from GeneDesign Co., Ltd. and Hokkaido System Science Co., Ltd.

[0346] <Example 9: In vitro aggregation assay and dimer quantification>

[0347] (Purpose)

[0348] The inhibitory effect of the decoy nucleic acids prepared in Example 8 on TDP-43 protein aggregation was verified in vitro. In addition, TDP-43 protein dimers were quantified in the presence of each decoy nucleic acid.

[0349] (Methods and Results)

[0350] For each bait nucleic acid prepared in Example 8, an in vitro aggregation experiment and dimer quantification were performed by the same method as in Example 7.

[0351] Bait nucleic acid (UG) 12 The results of Spacer-3, Spacer-9, Spacer-12 and Spacer-18 are shown in Figure 17 The results show that Spacer-3, Spacer-9 and Spacer-12 are similar to (UG) 12 Compared with Spacer-18, it has excellent aggregation inhibition effect ( Figure 17 A); In addition, the presence of Spacer-3, Spacer-9 and Spacer-12 is associated with (UG) 12 Compared with the presence of Spacer-18, the amount of TDP-43 dimer is higher ( Figure 17 B) The above results indicate that decoy nucleic acids having a spacer consisting of 1 to 4 ethylene glycol groups are particularly effective.

[0352] Bait nucleic acid (UG) 12 The results of Spacer-C3, Spacer-C6 and Spacer-C12 are shown in Figure 18 The results show that Spacer-C3 and Spacer-C6 are similar to (UG)12 Compared with Spacer-C12, it has excellent aggregation inhibition effect ( Figure 18 A); In addition, the presence of Spacer-C3 and Spacer-C6 and (UG) 12 Compared with the presence of Spacer-C12, the amount of TDP-43 dimer is higher ( Figure 18 B) The above results indicate that the decoy nucleic acid having a spacer consisting of an alkylene group having 3 to 6 carbon atoms is particularly effective.

[0353] <Example 10: Aggregation Inhibitory Effect on 6M Mutant TDP-43 Protein>

[0354] (Purpose)

[0355] The aggregation inhibition effect of the bait nucleic acid and the bait nucleic acid complex prepared in Example 6 and Example 8 on the 6M mutant TDP-43 protein was verified.

[0356] (Methods and Results)

[0357] In this example, a 6M mutant TDP-43 protein with six mutations (E14A / E17A / E21A / Q34A / R52A / R55A) and lacking the ability to form dimers was used for in vitro aggregation experiments using the same method as in Example 3. Specifically, the monovalent decoy nucleic acid (UG)6 from the decoy nucleic acids prepared in Examples 6 and 8 was mixed with the 6M mutant TDP-43 protein to a final concentration of 0.2 μM. Other decoy nucleic acids were mixed with the 6M mutant TDP-43 protein to a final concentration of 0.1 μM. The mixture was shaken and centrifuged, and the amount of TDP-43 protein in the supernatant and precipitate fractions was quantified to assess the aggregation rate.

[0358] The results are shown in Figure 19 The results showed that the bait nucleic acid A 12 、A 24 、A 48 and A 12 Trivalent and bait nucleic acid (UG) 12 Compared with the Figure 19 A); Bait nucleic acid A 12 / t 12 、A 24 / t 24 、A 48 / t 48 and A 12 / t 12 Trivalent and bait nucleic acid (UG) 12 Compared with the Figure 19B); Bait nucleic acid complex Adapter1 / C1 and bait nucleic acid (UG) 12 Compared with the Figure 19 C).

[0359] <Example 11: Toxicity Evaluation>

[0360] (Purpose)

[0361] A single intracerebroventricular administration of bait nucleic acid A 12 The acute and chronic toxicity of the bait nucleic acid Spacer-9 were evaluated.

[0362] (Methods and Results)

[0363] (1) Acute toxicity assessment

[0364] Acute toxicity assessment was performed according to the method described in the literature (Jia C. et al., Mol Ther Nucleic Acids, 2022, 31: 182-196.). Specifically, 5-week-old male C57BL / 6J mice were fixed on a brain positioning fixture under isoflurane anesthesia, the skin was incised, and a hole was drilled in the skull with a 1 mm diameter drill bit. PBS (control), bait nucleic acid A 12 The bait nucleic acid Spacer-9 or a toxic oligonucleotide (a positive control) exhibiting acute toxicity was injected into a Hamilton syringe and administered into the brain ventricle approximately 3 mm from the burr hole. The skin was then sutured with nylon suture. The dosage of the nucleic acid agent was 100 μg.

[0365] The central nervous system toxicity of the mice after administration was evaluated. Specifically, from the start of administration to 1 hour and 3 hours later, behavioral evaluation was performed using a scoring system that uses the 5 categories of behavior and death described in the above literature as evaluation objects. If each behavioral evaluation item is normal, it is scored as 0 points, and the higher the toxicity, the higher the score. The total value of the scores of the 5 categories and death is used as the toxicity score (0 to 22 points).

[0366] The results are shown in Figure 20 A. The toxicity score of the positive control toxic oligonucleotide was about 3 points after 1 hour from the start of administration and about 8 points after 3 hours. 12 and Spacer-9 showed no acute toxicity at 1 hour and 3 hours after administration.

[0367] (2) Chronic toxicity assessment

[0368] The motor cortex was removed from mice one week after the intracerebroventricular administration of (1) above. RNA was extracted from the removed motor cortex using the FastGene RNA Basic Kit (Genetics Co., Ltd., Japan). cDNA was synthesized using PrimeScript RT Master Mix (Takara Bio Co., Ltd., Japan) according to the operating manual. Then, the obtained cDNA was used as a template for quantitative RT-PCR to measure the expression levels of TNF-α mRNA, IL-1β mRNA, GFAP mRNA and GAPDH mRNA (internal standard gene). Quantitative RT-PCR was performed using TaqMan [Roche Applied Science]. The primers used in quantitative RT-PCR were products designed and manufactured by Thermo Fisher Scientific [formerly Life Technologies Corp]. Amplification conditions (temperature and time) were as follows: 95°C for 10 seconds, 60°C for 30 seconds and 72°C for 1 second as one cycle, and 45 cycles were repeated. The ratios of TNF-α mRNA, IL-1β mRNA, and GFAP mRNA expression levels relative to GAPDH mRNA (internal standard gene) expression levels were calculated, and the values ​​normalized to those of the PBS-administered group were used as relative expression levels.

[0369] The results are shown in Figure 20 B~ Figure 20 D. Bait nucleic acid A was administered 12 Compared with mice administered PBS, mice administered with bait nucleic acid Spacer-9 showed no significant changes in the expression levels of inflammatory markers TNF-α mRNA and IL-1β mRNA, and glial proliferation marker GFAP mRNA. 12 and Spacer-9 have low toxicity.

[0370] <Example 12: Analysis of Survival Period>

[0371] (Purpose)

[0372] Validation of the single intracerebroventricular administration of bait nucleic acid A in mice 12 and the decoy nucleic acid Spacer-9, which can increase the survival of amyotrophic lateral sclerosis (ALS) model mice.

[0373] This example uses rNLS mice described in the literature (Waker AK, et al., Acta Neuropathol., 2015, 130(5):643-660.) as an ALS model mouse. In rNLS mice, in the absence of doxycycline (Dox), expression of the nuclear localization signal-deficient (ΔNLS) human TDP-43 protein (hTDP-43ΔNLS) is induced, leading to the accumulation of insoluble TDP-43 in the brain and spinal cord, ultimately leading to death.

[0374] (Methods and Results)

[0375] The vehicle (PBS), bait nucleic acid A, and 5-week-old rNLS mice were intracerebroventricularly administered with the same method as in Example 11. 12 Or the bait nucleic acid Spacer-9. The dosage of the nucleic acid agent was 100 μg, and each administration group consisted of three mice (one male, two females). Dox administration continued until the day of intraventricular administration. After this day, Dox was no longer administered, inducing hTDP-43ΔNLS expression. This day was designated as the baseline day (Day 0 after Dox withdrawal), and the survival rate of mice after the baseline day was analyzed.

[0376] The results are shown in Figure 21 The average survival time of the vehicle-administered group was 24.0 days. In contrast, the average survival time of the Spacer-9-administered group was 26.33 days. 12 The average survival time of the administration group was about 33.67. 12 The survival period of the administration group was significantly prolonged.

[0377] <Example 13: Rotarod experiment>

[0378] (Purpose)

[0379] A single intracerebroventricular administration of bait nucleic acid A into ALS model mice (rNLS mice) 12 The therapeutic effect of the decoy nucleic acid Spacer-9 on motor function decline in ALS model mice was verified by rotarod testing.

[0380] (Methods and Results)

[0381] The vehicle (PBS), bait nucleic acid A and PBS were intracerebroventricularly administered to 5-week-old rNLS mice (1 male and 2 females) housed under Dox administration conditions using the same method and dosage as in Example 12. 12Or the decoy nucleic acid Spacer-9. Dox administration continued until the day of intraventricular administration. Using the day of intraventricular administration as the reference time point, rotarod tests were performed before administration (week 0 after Dox withdrawal), one week after administration (week 1 after Dox withdrawal), and two weeks after administration (week 2 after Dox withdrawal) to assess motor function.

[0382] The rotarod test was implemented by the following method. The mice were placed on a rotarod apparatus (Ugo Basile 7650) and the rotation speed of the rotor was accelerated for 300 seconds, increasing from an initial speed of 4 rpm to a final speed of 40 rpm. Taking this as one stage, 1 training phase and 2 experimental phases were carried out. A 30-minute rest period was set between stages. During the experimental phase, the time from the time the mice were placed on the apparatus to the time they fell was recorded. The situation of not falling at the end of the phase was recorded as 300 seconds. The average time of the 2 experimental phases was calculated, and the score of the standardized score at each time point was calculated by taking the score before application as 100.

[0383] The results are shown in Figure 22 The PBS administration group showed a significant decrease in scores after 1 week and 2 weeks of administration compared to before administration, indicating a significant decline in motor function. 12 The decline in motor function in the treated groups was significantly alleviated, with the Spacer-9 group showing a particularly significant reduction in motor function. These results demonstrate that decoy nucleic acids can effectively maintain motor function in ALS model mice.

[0384] All publications, patents, and patent applications cited in this specification are hereby incorporated by reference into this specification.

Claims

1. A multivalent binding nucleic acid agent that binds to a TDP-43 protein or a fragment thereof, wherein: The nucleic acid agent comprises two or more nucleic acid chains, each of the two or more nucleic acid chains comprises a TDP-43 binding sequence capable of binding to a TDP-43 protein or a fragment thereof, The two or more nucleic acid chains: (1) are connected by a linker; or (2) contain an adapter sequence capable of forming a multiplex chain between the two or more nucleic acid chains.

2. The nucleic acid agent according to claim 1, wherein The linker has a rigidity and / or length capable of inhibiting the two or more monomeric TDP-43 proteins bound to the TDP-43 binding sequences of the two or more nucleic acid chains from forming aggregates.

3. The nucleic acid agent according to claim 2, wherein The inhibition of the formation of the aggregates is achieved based on the inhibition of the binding between the C-terminal regions of the TDP-43 protein and / or the promotion of the phase separation thereof.

4. The nucleic acid agent according to any one of claims 1 to 3, wherein The linker includes a nucleic acid, a peptide, a polyether group and / or a hydrocarbon group.

5. The nucleic acid agent according to claim 4, wherein The nucleic acid consists of one nucleoside or 2 to 50 nucleosides connected by internucleoside bonds. The nucleic acid agent according to claim 5, wherein The nucleosides include natural nucleosides and / or non-natural nucleosides.

7. The nucleic acid agent according to claim 4, wherein The nucleic acid is a peptide nucleic acid.

8. The nucleic acid agent according to claim 4, wherein The polyether group is a polyethylene glycol group.

9. The nucleic acid agent according to claim 4, wherein The hydrocarbon group is an optionally substituted hydrocarbon group having 2 to 30 carbon atoms.

10. The nucleic acid agent according to claim 1, wherein The linker comprises a region consisting of single-stranded nucleic acid. The nucleic acid agent according to claim 10 , wherein The region consisting of single-stranded nucleic acid comprises a hairpin structure.

12. The nucleic acid agent according to claim 10 or 11, wherein The nucleic acid agent further includes a complementary strand including a base sequence complementary to at least a portion of the region consisting of the single-stranded nucleic acid, and the region consisting of the single-stranded nucleic acid and the complementary strand form a multi-stranded structure.

13. The nucleic acid agent according to claim 12, wherein The region consisting of the single-stranded nucleic acid contains non-complementary bases and / or insertions and / or deletions of one or more bases relative to the complementary chain. The nucleic acid agent according to claim 13 , wherein The region consisting of single-stranded nucleic acid contains 1 to 3 non-complementary bases.

15. The nucleic acid agent according to claim 13, wherein The insertion sequence consists of 1 to 8 bases. The nucleic acid agent according to claim 13 , wherein The deletion consists of 1 to 4 consecutive bases.

17. The nucleic acid agent according to claim 12, wherein The complementary strand comprises natural nucleosides and / or non-natural nucleosides.

18. The nucleic acid agent according to claim 1, wherein The adapter sequence is 8 to 50 bases long.

19. The nucleic acid agent according to claim 1, wherein The TDP-43 binding sequence binds to the RNA recognition motif RRM of the TDP-43 protein.

20. The nucleic acid agent according to claim 1, wherein The TDP-43 binding sequence consists of a repeating sequence represented by the following formula (I): (X0GX1X2X3...X m ) n (I) In formula (I), X0 is T or U; X1, X2, X3...X m It may exist or not. If it exists, X1, X2, X3...X m It is independently any one of A, C, G, T or U, which may be the same or different; m is 1 to 10; n represents the number of repetitions, which is 2 to 50.

21. The nucleic acid agent according to claim 1, wherein The TDP-43 binding sequence consists of a repeating sequence represented by the following formula (IV): (XG) n (IV) In formula (IV), X represents T or U; and n is 3 or greater.

22. The nucleic acid agent according to claim 21, wherein Each sequence of the TDP-43 binding sequence is capable of binding to one TDP-43 protein or a fragment thereof.

23. The nucleic acid agent according to claim 22, wherein The n is less than or equal to 6.

24. The nucleic acid agent according to any one of claims 21 to 23, wherein The repeat sequence comprises natural ribonucleosides and / or non-natural ribonucleosides.

25. The nucleic acid agent according to claim 24, wherein The non-natural ribonucleoside is a 2'-O-methyl modified nucleoside, a 2'-O-methoxyethyl modified nucleoside or a 2'-O-[2-(N-methylcarbamoyl)ethyl] modified nucleoside. The nucleic acid agent according to claim 1 , which is used for inhibiting the aggregation of TDP-43 protein and / or fragments thereof. A pharmaceutical composition comprising the nucleic acid agent according to claim 1 as an active ingredient. The pharmaceutical composition according to claim 27 , which is used for preventing or treating neurodegenerative diseases.

29. The pharmaceutical composition according to claim 28, wherein The neurodegenerative disease is TDP-43 proteinopathy.

30. The pharmaceutical composition according to claim 28 or 29, wherein The neurodegenerative disease is selected from the group consisting of: amyotrophic lateral sclerosis (ALS), i.e., sporadic amyotrophic lateral sclerosis or familial amyotrophic lateral sclerosis; frontotemporal lobar degeneration (FTLD); Alzheimer's disease; dementia with Lewy bodies; Huntington's disease; Parkinson's disease; argyrophilic grain dementia (Grain disease); Perry syndrome; progressive supranuclear palsy; corticobasal degeneration; and multiple system atrophy.

Citation Information

Patent Citations

  • Sound insulation plate and soundproof wall using the same

    JP2023022549A

  • Nucleic acid reducing als-causing protein toxicity

    WO2016088797A1

  • TDP-43 aggregation inhibitor

    WO2020027311A1