Application of CLU gene in preparation of product for treating keloid
By promoting the overexpression of CLU gene and using CLU gene recombinant vector or liposome complex to inhibit the activity of keloid cells, the problem of difficult treatment of keloids is solved and effective keloid prediction and treatment is achieved.
Patent Information
- Application Number
- CN202510867953.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-26
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2045-06-26
AI Technical Summary
Existing technologies are difficult to effectively treat keloids, and the complex causes of keloids make them difficult to eradicate, increasing the risk of infection and recurrence.
By promoting the overexpression of the CLU gene, using a recombinant vector that overexpresses the CLU gene or a liposome complex that overexpresses the CLU gene, the activity and apoptosis of primary fibroblasts in scar tissue are inhibited. Combined with reagents for detecting CLU gene expression, it is used to predict the risk of disease and evaluate the efficacy.
It significantly inhibits the activity of scar tissue cells and increases cell apoptosis, providing a new target for the treatment of keloids and improving the accuracy of treatment efficacy and prediction of disease risk.
Smart Images

Figure CN120695159A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to an application of a CLU gene in preparing a product for treating keloids. Background Art
[0002] Keloids are a common skin disorder characterized by the formation of pathological scars following healing of skin injuries. The etiology of keloids involves abnormal cell proliferation within the scar tissue, marked hyperplasia of connective tissue, and subsequent collagen degeneration. Keloids typically exhibit an expansive growth pattern, extending beyond the original wound site, and show resistance to natural involution. Clinically, keloids appear as raised, red or purple scars with a firm texture and irregular shape, often associated with itching or other discomfort. The clinical management of keloids typically involves a comprehensive strategy that combines various modalities such as local steroid injections, laser therapy for collagen degradation, and cryotherapy to induce necrosis of the keloid tissue. Despite the availability of various treatment options for keloids, the elusive etiology of keloids hinders complete eradication of the lesions, thereby increasing susceptibility to infection and recurrence.
[0003] A highly conserved glycoprotein called clusterin (CLU) has multiple isoform-specific functions and is present in many species. CLU participates in cancer progression by regulating key physiological processes, including apoptosis, metastasis, invasion, proliferation, and cell growth. However, whether CLU can serve as a target for the diagnosis or treatment of keloids has not been reported. Summary of the Invention
[0004] In view of this, the object of the present invention is to provide an application of the CLU gene in the preparation of a product for treating keloids.
[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0006] The present invention provides an application of a CLU gene in preparing a product for treating keloids.
[0007] The present invention provides an application of a reagent for promoting overexpression of CLU gene in the preparation of a product for treating keloids.
[0008] Preferably, the reagent promoting overexpression of the CLU gene includes a recombinant vector for overexpressing the CLU gene or a liposome complex for overexpressing the CLU gene.
[0009] Preferably, the CLU overexpression liposome complex is obtained by mixing a CLU overexpression gene recombinant vector with lipofectamine 3000 reagent.
[0010] The present invention provides an application of a reagent for detecting CLU gene expression in the preparation of a product for predicting the risk of keloid disease.
[0011] The present invention provides an application of a reagent for detecting CLU gene expression in screening drugs for treating keloids.
[0012] The present invention provides an application of a reagent for detecting CLU gene expression in the preparation of a product for evaluating the efficacy of a drug in treating keloids.
[0013] Preferably, the reagent for detecting CLU gene expression includes a CLU primer pair or a CLU antibody.
[0014] Preferably, the sequences of the primer pairs for detecting CLU are shown as SEQ ID NO.3 to SEQ ID NO.4.
[0015] The present invention provides a medicine for treating keloids, comprising the above-mentioned reagent for promoting overexpression of CLU gene and pharmaceutically acceptable excipients.
[0016] Compared with the prior art, the present invention has the following beneficial effects:
[0017] This invention provides a method for using the CLU gene in the preparation of a product for treating keloids. By studying the relationship between keloids and the apoptosis-related gene ARG, and by overexpressing CLU or knocking down CLU cell activity and apoptosis, the authors found that the CLU gene can be used to treat keloids and plays a crucial role in the pathogenesis of keloids. This invention demonstrates for the first time that the CLU gene serves as a target for predicting keloid risk and treating it, providing a new option for clinically selecting products for treating and / or diagnosing keloids. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 Comparison of the expression of CLU, pro-apoptotic gene BAX, and anti-apoptotic gene BCL2 in keloid tissue and healthy skin tissue;
[0019] Figure 2 The results are the comparison of the expression of CLU, pro-apoptotic gene BAX and anti-apoptotic gene BCL2 in primary fibroblasts between keloid group and normal group;
[0020] Figure 3 Immunohistochemistry was used to detect the expression of CLU in keloid tissue and healthy skin tissue;
[0021] Figure 4 The results of MTT assay for cell viability of keloid-derived primary fibroblasts overexpressing CLU;
[0022] Figure 5 The results of TUNEL assay for apoptosis in keloid-derived primary fibroblasts after overexpression of CLU were shown;
[0023] Figure 6 The results of the MTT assay for cell viability after knockdown of CLU in primary fibroblasts derived from keloids;
[0024] Figure 7 The results of cell apoptosis detection using TUNEL technology after knocking down CLU in primary fibroblasts derived from keloids. DETAILED DESCRIPTION
[0025] The present invention provides an application of a CLU gene in preparing a product for treating keloids.
[0026] The present invention provides an application of a reagent for promoting overexpression of CLU gene in the preparation of a product for treating keloids.
[0027] In the present invention, the sequence of the CLU gene is registered in the NCBI database with accession number NM_001831.4. The product includes a reagent or a drug. The reagent for promoting CLU gene overexpression includes a CLU gene overexpression recombinant vector or a CLU overexpression liposome complex. The backbone vector of the CLU gene overexpression recombinant vector is preferably pcDNA3.1+; the preparation method of the CLU gene overexpression recombinant vector includes ligating the CLU gene with the nucleotide sequence shown in SEQ ID NO. 9 to pcDNA3.1+. The overexpression CLU liposome complex is obtained by mixing an overexpression CLU gene recombinant vector with a lipofectamine 3000 reagent, wherein the overexpression CLU gene recombinant vector is a recombinant vector diluted with Opti-MEM culture medium, and the mass volume ratio of the overexpression CLU gene recombinant vector to the Opti-MEM culture medium is 1 μg:500 μL; the lipofectamine 3000 reagent is a lipofectamine 3000 solution diluted with Opti-MEM culture medium, and the volume ratio of the lipofectamine 3000 reagent to the Opti-MEM culture medium is 1 μL:500 μL; the mass volume ratio of the diluted recombinant vector to the diluted lipofectamine 3000 solution is 1 μg:(0.5-2) μL, more preferably 1 μg:1 μL.
[0028] In the present invention, by promoting the overexpression of the CLU gene, the activity and apoptosis of primary fibroblasts in scar tissue can be significantly inhibited, thereby effectively treating scar tissue.
[0029] The present invention provides an application of a reagent for detecting CLU gene expression in the preparation of a product for predicting the risk of keloid disease.
[0030] The present invention provides an application of a reagent for detecting CLU gene expression in screening drugs for treating keloids.
[0031] The present invention provides an application of a reagent for detecting CLU gene expression in the preparation of a product for evaluating the efficacy of a drug in treating keloids.
[0032] In the present invention, the reagent for detecting CLU gene expression includes a CLU detection primer pair or a CLU antibody. The sequences of the CLU detection primer pair are shown in SEQ ID NO. 3 to SEQ ID NO. 4. The CLU antibody can be 12289-1-AP from Proteintech or an enzyme-linked immunosorbent assay (ELISA) kit purchased from Jingmei Biotechnology Co., Ltd., Jiangsu, China.
[0033] The present invention provides a medicine for treating keloids, comprising the above-mentioned reagent for promoting overexpression of CLU gene and pharmaceutically acceptable excipients.
[0034] In the present invention, the drug can include an agent that promotes CLU gene overexpression as its sole active ingredient, or it can be used in combination with other active agents for preventing and / or treating keloids. The excipients include lentivirus, adenovirus, adeno-associated virus, or lipofectamine 3000. The drug is administered orally or by injection; the injection method is preferably selected from intravenous, intramuscular, intracoronary, and cardiac injection to achieve the purpose of preventing and / or treating keloids. The agent that promotes CLU gene overexpression includes the aforementioned recombinant vector for overexpressing the CLU gene or the CLU overexpressing liposome complex.
[0035] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.
[0036] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0037] Example 1
[0038] 1.1 CLU in keloid tissue has a significant effect on the proliferation and apoptosis of primary fibroblasts
[0039] 1.1.1 The experiment was divided into a keloid group (Keloid) and a normal control group (Control). The keloid group consisted of scar tissue from patients diagnosed with keloid, while the normal control group consisted of skin tissue from healthy individuals. qRT-PCR was used to detect the expression of CLU, the pro-apoptotic gene BAX, and the anti-apoptotic gene BCL2 in the keloid group and the normal control group, respectively.
[0040] 1.1.2 The experiment was divided into a keloid group (Keloid) and a normal group (Control). The keloid group consisted of primary fibroblasts extracted from scar tissue of patients diagnosed with keloid, while the normal group consisted of primary fibroblasts extracted from skin tissue of healthy individuals. qRT-PCR was used to detect the expression of CLU, the pro-apoptotic gene BAX, and the anti-apoptotic gene BCL2 in each primary fibroblast of the keloid group and the normal group, respectively.
[0041] Among them, the primary fibroblast preparation method is as follows: after obtaining keloid tissue or normal skin tissue, the epidermis and subcutaneous fat are removed, and the tissue is cut into 10 mm × 10 mm squares, 1 μL of type I collagenase (purchased from Shanghai Yuanye Biotechnology Co., Ltd., product number S10053) is added, and the tissue is placed in a 37°C shaker for digestion for 3 hours. The supernatant is removed by centrifugation, and DMEM high-glucose medium (purchased from Gibco Thermo Fisher Scientific) containing 10% fetal bovine serum (Every Green, purchased from Zhejiang Tianhang Biotechnology Co., Ltd.) is added. The tissue is cultured in an incubator at 37°C and 5% CO2. The culture medium is replaced every 2 days. When the cell confluence reaches more than 80%, primary fibroblasts derived from the skin of scar patients or primary fibroblasts derived from the skin of normal people are obtained, respectively.
[0042] Primary fibroblasts derived from the skin of patients with the scar or normal human skin were passaged using trypsin (purchased from Gibco Thermo Fisher Scientific), generally not exceeding 7 generations.
[0043] Total RNA extraction from tissues or cells and qRT-PCR gene detection:
[0044] Total RNA was extracted from primary fibroblasts or tissues using Invitrogen's Trizol reagent, and the first-strand cDNA was synthesized using a Roche reverse transcription kit. Gene expression analysis was performed using Roche's SYBR Green Supermix and the instrument was Bio-Rad's iQ5 Multicolor Real-Time PCR Detection System. -△△CtmRNA levels were calculated using the GAPDH housekeeping gene as a calibration tool. The primer sequences used are as follows: (all primers are oriented 5'-3')
[0045] GAPDH forward primer: GTCTCCTCTGACTTCAACA (SEQ ID NO. 1);
[0046] GAPDH negative primer: CTCTTCCTCTTGTGCTCTT (SEQ ID NO. 2);
[0047] CLU forward primer: TTCGTTCATTAACATTCTCTGAT (SEQ ID NO. 3);
[0048] CLU negative primer: CTGACTTTACTCTGAATTTCCTT (SEQ ID NO. 4);
[0049] BAX forward primer: CTCACCATCTGGAAGAAGA (SEQ ID NO. 5);
[0050] BAX negative primer: TCCCGAAGGAGGTTTATTAC (SEQ ID NO. 6);
[0051] BCL2a forward primer: TTAAGAGGTGGCTGATATTCT (SEQ ID NO. 7);
[0052] BCL2a negative primer: GGAAAGTTTAATGGCAATGTG (SEQ ID NO. 8).
[0053] Figure 1 The results showed that compared with the normal group, the expression of CLU and apoptosis marker gene BAX in the keloid tissue of the keloid group decreased, while the expression of BCL2 increased, indicating that the proliferation of keloid tissue may be negatively correlated with CLU expression.
[0054] Figure 2 The results showed that compared with the normal group, the expression of CLU and apoptosis marker gene BAX in primary fibroblasts of the keloid group decreased, while the expression of BCL2 increased, indicating that the proliferation of primary fibroblasts may be negatively correlated with CLU expression.
[0055] 1.1.3 Immunohistochemical analysis of tissue sections
[0056] For immunohistochemistry (IHC) analysis, keloid tissue (keloid group, denoted as Keloid) and normal skin tissue (normal group, denoted as Control) were obtained from Suqian People's Hospital from January 10 to 20, 2025. The samples were fixed in 4% paraformaldehyde and then embedded in paraffin. 4 μm thick sections were prepared from formalin-fixed, paraffin-embedded tissues. The sections were dewaxed and rehydrated according to standard protocols. Antigen retrieval was performed by heating the slides in citrate buffer (pH 6.0) at 95°C for 20 minutes. The primary antibody for CLU (1:1200 dilution, 12289-1-AP from Proteintech) was applied and incubated at room temperature for 15 minutes. After washing with phosphate-buffered saline (PBS), the slides were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies at room temperature for 1 hour. Immunoreactivity was visualized using 3,3'-diaminobenzidine (DAB) as a chromogen, followed by counterstaining with hematoxylin. Slides were then counterstained with hematoxylin, dehydrated, and coverslipped for further analysis. Imaging was performed using a Nikon A1RHD25 confocal microscope.
[0057] Figure 3 The results showed that the expression level of CLU in keloid tissue was downregulated compared with the normal group.
[0058] In conclusion, changes in CLU expression can be used to diagnose and / or treat keloids.
[0059] Example 2
[0060] Application of CLU in the preparation of drugs for treating keloids
[0061] This example uses primary fibroblasts derived from the skin of scar patients prepared in Section 1.1.2 of Example 1 or primary fibroblasts extracted from the skin tissue of healthy people.
[0062] 2.1 Effect of CLU overexpression on keloids
[0063] The experiment was divided into a control group and a treatment group, in which cells containing pcDNA3.1 + empty plasmid served as the control group (denoted as Keloid), and cells containing pcDNA3.1 + -CLU overexpression plasmid served as the treatment group (denoted as Ke-CLU);
[0064] The pcDNA3.1+-CLU overexpression plasmid was prepared by ligating the CLU gene (nucleotide sequence shown in SEQ ID NO. 9) into the Nhel and Xhol restriction sites of pcDNA3.1+ to generate the pcDNA3.1+-CLU overexpression plasmid. Testing confirmed that the pcDNA3.1+-CLU overexpression plasmid successfully overexpressed CLU. The pcDNA3.1+-CLU overexpression plasmid was synthesized by Shanghai Qilong Biotechnology Co., Ltd.
[0065] The nucleotide sequence of the CLU gene is as follows:
[0066] atgatgaagactctgctgctgtttgtggggctgctgctgacctggggagagtgggcaggtcctgggggaccagacg
[0067] gtctcagacaatgagctccaggaaatgtccaatcagggaagtaagtacgtcaataaggaaattcaaaatgctgtcaacgg
[0068] ggtgaaacagataaagactctcatagaaaaaacaaacgaagagcgcaagacactgctcagcaacctagaagaagccaa
[0069] gaagaagaaagaggatgccctaaatgagacccagggaatcagagacaaagctgaaggagctcccaggagtgtgcaatg
[0070] agaccatgatggccctctgggaagagtgtaagccctgcctgaaacagacctgcatgaagttctacgcacgcgtctgcaga
[0071] agtggctcaggcctggttggccgccagcttgaggagttcctgaaccagagctcgcccttctacttctggatgaatggtgac
[0072] cgcatcgactccctgctggagaacgaccggcagcagacgcacatgctggatgtcatgcaggacccacttcagccgcgcgt
[0073] ccagcatcatagacgagctcttccaggacaggttcttcacccgggagccccaggatacctaccactacctgcccttcagcc
[0074] tgccccaccggaggcctcacttcttctttcccaagtcccgcatcgtccgcagcttgatgcccttctctccgtacgagcccctg
[0075] aacttccacgccatgttccagcccttccttgagatgatacacgaggctcagcaggccatggacatccacttccatagcccg
[0076] gccttccagcacccgccaacagaattcatacgagaaggcgacgatgaccggactgtgtgccgggagatccgccacaact
[0077] ccacgggctgcctgcggatgaaggaccagtgtgacaagtgccgggagatcttgtctgtggactgttccaccaacaacccc
[0078] tcccaggctaagctgcggcgggagctcgacgaatccctccaggtcgctgagaggttgaccaggaaatacaacgagctg
[0079] ctaaagtcctaccagtggaagatgctcaacacctcctccttgctggagcagctgaacgagcagtttaactgggtgtcccgg
[0080] ctggcaaacctcacgcaaggcgaagaccagtactatctgcgggtcaccacggtggcttcccacacttctgactcggacgt
[0081] tccttccggtgtcactgaggtggtcgtgaagctctttgactctgatcccatcactgtgacggtccctgtagaagtctccagga
[0082] agaaccctaaatttatggagaccgtggcggagaaagcgctgcaggaataccgcaaaaagcaccgggaggagtga(S
[0083] EQ ID NO.9).
[0084] The preparation method of cells containing pcDNA3.1+empty plasmid or cells containing pcDNA3.1+-CLU overexpression plasmid is as follows:
[0085] Primary fibroblasts derived from scar patient skin, prepared in Section 1.1.2 of Example 1, were seeded onto a 96-well plate at a density of 8,000 cells per well. Transfection was initiated after reaching 70% confluency. 3 mL of Opti-MEM medium was mixed with 6 μL of lipofectamine 3000 solution and stirred evenly to obtain diluted lipofectamine 3000 solution. 3 mL of Opti-MEM medium was mixed with 6 μg of pcDNA3.1+ plasmid or pcDNA3.1+-CLU overexpression plasmid to prepare pcDNA3.1+ premix or pcDNA3.1+-CLU premix, respectively. 1 μg of pcDNA3.1+ premix or 1 μg of pcDNA3.1+-CLU premix was added to 1 μL of the diluted lipofectamine 3000 solution, respectively, and the mixture was incubated at room temperature for 20 minutes to obtain pcDNA3.1+-liposome complexes or pcDNA3.1+-CLU-liposome complexes. The pcDNA3.1+-liposome complex or the pcDNA3.1+-CLU-liposome complex were then added to primary fibroblasts derived from the skin of scar patients. Finally, the cells were incubated at 37°C in a cell culture incubator to obtain cells containing either pcDNA3.1+empty plasmid or pcDNA3.1+-CLU overexpression plasmid. Cell viability and apoptosis were then assayed. For apoptosis assays, a blank control group without any plasmid was used. Three biological replicates were performed for each group.
[0086] Cell viability assay: After incubating the cells in the aforementioned 37°C cell culture incubator for 24 or 48 hours, the culture medium was removed from the cells containing pcDNA3.1 + empty plasmid or the cells containing pcDNA3.1 + -CLU overexpression plasmid at each time point, and 100 μL of MTT solution (the volume ratio of MTT to culture medium in the MTT solution was 1:9) was added to each well. Each cell was then incubated in a 37°C incubator for an additional 4 hours, and then 100 μL of 20% SDS solution was added to each well. After the subsequent 20-hour incubation, the absorbance at 570 nm was measured using a microplate reader.
[0087] Cell apoptosis assay:
[0088] In this example, a Tunel apoptosis kit was used to perform apoptosis detection on a flow cytometer. TUNEL Bright Red apoptosis detection kit-A113 was purchased from Vazyme Biotechnology Co., Ltd. in Nanjing, China. After incubating the cells in the above-mentioned 37°C cell culture incubator for 24 hours, primary fibroblasts derived from normal human skin (Control), cells containing pcDNA3.1+ empty plasmid (Keloid), or cells containing pcDNA3.1+-CLU overexpression plasmid (Ke-CLU) were evenly seeded onto 24-well slides coated with PLL, fixed with 4% paraformaldehyde, rinsed twice with PBS, treated with 20μg / mL proteinase K solution, and incubated at room temperature for 5 minutes. The cells were then washed three times with PBS and then balanced with TdT buffer. Subsequently, the cells were washed twice with PBS and incubated with 1μg / mL PI solution for 5 minutes at room temperature. After washing three times with PBS, 100μL of glycerol was added to the cell area to maintain moisture, and the changes in fluorescence intensity of the samples were immediately analyzed under a fluorescence microscope.
[0089] Figure 4 The results showed that after incubation in a 37°C cell culture incubator for 24h or 48h, the viability of cells overexpressing CLU (Ke-CLU) was significantly decreased compared with the control group (Keloid).
[0090] Figure 5 The results showed that the apoptosis of cells overexpressing CLU (Ke-CLU) was increased compared with the control group (Keloid).
[0091] 2.2 Effects of knocking down CLU expression on keloids
[0092] Primary fibroblasts derived from normal human skin were used as the blank control group (Control), CLU-scramble cells were designated as Keloid, and CLU knockdown cells were designated as the experimental group (Nor-siCLU).
[0093] Among them, siRNA was used to knock down CLU in primary fibroblasts derived from the skin of scar patients. The nucleic acid sequence of the siRNA for knocking down CLU is as follows:
[0094] ACAAUUAUGAUCACUUAAGCA (SEQ ID NO. 10).
[0095] Preparation method of knockdown CLU cells: The primary fibroblasts derived from the skin of scar patients prepared in Section 1.1.2 of Example 1 were seeded into a 96-well plate at a density of 8,000 cells per well. Transfection was started after reaching 70% fusion. 3 mL of Opti-MEM medium was mixed with 6 μL of lipofectamine RNAiMAX liquid and stirred evenly to obtain a diluted lipofectamine RNAiMAX solution. 3 mL of Opti-MEM medium was mixed with 6 μg of siRNA for knockdown CLU to obtain a diluted siRNA solution. 1 μg of the diluted siRNA solution was added to 2 μL of the diluted lipofectamine RNAiMAX solution, incubated at room temperature for 20 minutes, and the resulting siRNA-liposome complex was added to the above-mentioned primary fibroblasts. Finally, the cells were incubated in a 37°C cell culture incubator.
[0096] Among them, after the siRNA for knocking down CLU is scrambled, a sequence without knocking down CLU cells is prepared as a negative siRNA, and the siRNA for knocking down CLU in the preparation method of knocking down CLU cells is replaced with the negative siRNA to obtain CLU-scramble cells.
[0097] After incubating the cells in the above-mentioned 37°C cell culture incubator for 24 h or 48 h, the cell viability of the cells in different groups was determined according to the method of cell viability detection in Section 2.1.
[0098] After incubating the cells in the above-mentioned 37°C cell culture incubator for 24 h, cell apoptosis detection was performed on cells in different groups according to the method of cell apoptosis detection in Section 2.1.
[0099] Figures 6 and 7 The results showed that compared with the Control group, knockdown of CLU significantly enhanced cell viability and inhibited cell apoptosis.
[0100] Figures 4 to 7 The results showed that overexpression of CLU can effectively treat keloids.
[0101] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. Application of CLU gene in the preparation of products for the treatment of keloids.
2. Application of reagents that promote overexpression of the CLU gene in the preparation of products for the treatment of keloids.
3. The use according to claim 1, characterized in that The reagent for promoting overexpression of the CLU gene includes a recombinant vector for overexpressing the CLU gene or a liposome complex for overexpressing the CLU gene.
4. The use according to claim 3, characterized in that The overexpressed CLU liposome complex is obtained by mixing an overexpressed CLU gene recombinant vector with a lipofectamine 3000 reagent.
5. Application of reagents for detecting CLU gene expression in the preparation of products for predicting the risk of keloid disease.
6. Application of reagents for detecting CLU gene expression in screening drugs for treating keloids.
7. Application of reagents for detecting CLU gene expression in the preparation of products for evaluating the efficacy of drugs in treating keloids.
8. The use according to any one of claims 5 to 7, characterized in that: The reagent for detecting CLU gene expression includes a CLU primer pair or a CLU antibody.
9. The use according to claim 8, characterized in that The sequences of the primer pairs for detecting CLU are shown in SEQ ID NO.3 to SEQ ID NO.
4.
10. A drug for treating keloids, characterized in that: The invention comprises the reagent for promoting overexpression of CLU gene as claimed in claim 3 or 4 and pharmaceutically acceptable excipients.
Citation Information
Patent Citations
Human nuclear clusterin, vector and application thereof
CN101816779A
Application of reagent for inhibiting expression of transcription factor MEF2C in preparation of medicine for treating keloid
CN113209312A
Application of reagent for detecting CLU gene and / or CLU protein in preparation of meningioma related products
CN118186076A
Method of Treating Corneal Opacities and Scarring
US20240100124A1