Escherichia coli Liu and application thereof

By providing Escherichia coli Liu, a strain capable of extracellularly secreting cellulase, hemicellulase, and lignin-degrading enzymes over a wide pH range, the high temperature and high pressure problem of lignocellulose degradation is solved, simplifying the protein extraction and purification process, improving production efficiency and succinic acid yield, and expanding the application prospects of biofuels and biomass resource utilization.

CN120699856BActive Publication Date: 2025-12-26INNER MONGOLIA UNIV OF TECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511224910.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-29
Publication Date
2025-12-26
Estimated Expiration
2045-08-29

AI Technical Summary

Technical Problem

In existing technologies, the degradation methods of lignocellulose require high temperature and high pressure, and have problems of high energy consumption and environmental pollution. The biodegradation research of fungi as the main model strains has problems of long pretreatment cycle and poor environmental adaptability. Traditional Escherichia coli expression systems have problems of complex protein extraction and purification.

Method used

A strain of Escherichia coli, Liu, was provided. This strain can secrete cellulase, hemicellulase, and lignin-degrading enzymes extracellularly over a wide pH range. It has a complete lignocellulose-degrading enzyme system and can efficiently degrade cellulose, hemicellulose, and lignin. It can also ferment to produce succinic acid.

Benefits of technology

It achieves efficient degradation of lignocellulose under mild conditions, simplifies protein extraction and purification processes, improves production efficiency, enhances environmental adaptability and the industrial application value of the strain, increases succinic acid production, and provides abundant options for biofuel and biomass resource utilization.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120699856B_ABST
    Figure CN120699856B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of bioengineering, and particularly relates to a strain of Escherichia coli Liu and application thereof. The Escherichia coli Liu provided by the present application is preserved in Guangdong Microbial Culture Collection Center on April 28, 2025, and the preservation number is GDMCC No:66233. The Escherichia coli provided by the present application can excrete cellulase and lignin-degrading enzyme extracellularly, the enzyme has a wide temperature and pH range, and can be used for degrading cellulose, hemicellulose and lignin; and can also be used for fermenting production of succinic acid, and has a wide application prospect in the fields of industry, agriculture, medicine and food.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of bioengineering technology, and particularly relates to a strain of Escherichia coli Liu and application thereof. BACKGROUND

[0002] Lignocellulose is mainly composed of cellulose, hemicellulose and lignin. Bioethanol produced by degradation of lignocellulosic material is a potential alternative to fossil fuels and is environmentally sustainable. However, lignin is very stable in combination with cellulose and hemicellulose and is not easy to degrade, which is one of the key bottlenecks for the utilization of biomass energy. Conventional physical, chemical and physical-chemical degradation methods for treating lignocellulose often require high temperature and high pressure conditions, and are prone to produce inhibitors, cause high energy consumption and environmental pollution, etc. Microbial mediated biocatalytic process is usually carried out under mild conditions, which can reduce energy input and provide more specific and effective options for the utilization of lignocellulose. Microorganisms can effectively degrade cellulose, hemicellulose and lignin by secreting lignin-degrading enzymes and cellulases.

[0003] The complete degradation of lignocellulose in nature is the result of the joint action of fungi, bacteria and corresponding microbial communities. The research on the degradation of lignin by fungi is the most extensive and in-depth, for example, the traditional biological degradation of lignin is represented by white rot fungi, but the biological degradation research carried out by fungi as the main model strain has problems such as long pretreatment cycle and poor environmental adaptability. Bacteria have good environmental adaptability and rapid reproduction, and become potential candidates for lignocellulose-degrading strains in the future. Escherichia coli is the most widely used protein expression strain, and has many advantages in the application of lignocellulose-degrading enzyme industry. Therefore, the isolation of Escherichia coli with high efficiency of degrading lignocellulose will have important market value and application prospect. SUMMARY

[0004] In order to solve the above technical problems, the present application provides a strain of Escherichia coli Liu and application thereof. The Escherichia coli provided by the present application has a wide temperature and pH range of enzyme action, can extracellularly secrete cellulase, hemicellulase and lignin-degrading enzyme, can be used for degrading complex lignocellulose, and can also be used for the fermentation production of succinic acid.

[0005] In a first aspect, the present application provides a strain of Escherichia coli Liu, which was preserved in Guangdong Microbial Culture Collection Center (address: 5th Floor, Building 59, Guangzhou Xianlie Middle Road 100 Courtyard) on April 28, 2025, and the preservation number is GDMCC No: 66233.

[0006] In a second aspect, the present application provides a bacterial agent containing the Escherichia coli Liu of the first aspect.

[0007] As a non-limiting example, the bacterial agent provided by the present application refers to a fermentation broth obtained by culturing the strain of the Escherichia coli Liu in LB medium at 37℃ with shaking at 180-220 rpm for 12-16 h.

[0008] In the culture of the Escherichia coli or the bacterial agent, the carbon source is preferably glucose, and the nitrogen source is preferably yeast powder.

[0009] In a third aspect, the present application provides use of the Escherichia coli Liu of the first aspect or the bacterial agent of the second aspect in degrading cellulose, hemicellulose and / or lignin.

[0010] In a fourth aspect, the present application provides use of the Escherichia coli Liu of the first aspect or the bacterial agent of the second aspect in preparing cellulase, hemicellulase and / or lignin-degrading enzyme.

[0011] In some embodiments of the present application, the cellulase includes exoglucosidase, endoglucosidase and beta-glucosidase.

[0012] In some embodiments of the present application, the hemicellulase includes xylanase.

[0013] Compared with the traditional Escherichia coli expression system, the Escherichia coli strain provided by the present application can directly secrete cellulase or hemicellulase to the extracellular, solving the problems such as inclusion body formation, protein refolding complexity and secretion barrier, simplifying the extraction and purification process of the protein and improving the production efficiency. The extracellular protein expression system of the present application has various advantages over the intracellular expression: avoiding the degradation of intracellular protease; being beneficial to downstream purification and improving the purity of the product; avoiding protein folding error; the extracellular expression of heterologous protein has the function of rapid and direct screening of target protein.

[0014] In some embodiments of the present application, the lignin-degrading enzyme includes laccase, lignin peroxidase and manganese peroxidase.

[0015] The Escherichia coli provided by the present application has relatively high biological activity in the pH range of 5.0-9.0, and can extracellularly secrete exoglucosidase, endoglucosidase, beta-glucosidase and xylanase, laccase, lignin peroxidase and manganese peroxidase.

[0016] In a fifth aspect, the present application provides use of the Escherichia coli Liu of the first aspect or the microbial agent of the second aspect in the preparation of biofuel.

[0017] In some embodiments of the present application, the biofuel comprises cellulose, hemicellulose and / or lignin obtained by degrading lignocellulosic substrates using cellulase, hemicellulase and / or lignin-degrading enzyme secreted by the Escherichia coli Liu of the first aspect or the microbial agent of the second aspect. The lignocellulosic substrates of the present application include, but are not limited to, plant straw, nuclear shell, wood and other biomass or waste.

[0018] The Escherichia coli provided by the present application can improve the overall conversion efficiency of substrate raw materials.

[0019] In a sixth aspect, the present application provides use of the Escherichia coli Liu of the first aspect or the microbial agent of the second aspect in the fermentation production of organic acid.

[0020] In some embodiments of the present application, the organic acid is succinic acid.

[0021] The technical solutions provided by the embodiments of the present application have the following advantages compared with the prior art:

[0022] 1. Compared with the prior art, the Escherichia coli strain (Escherichia coli) Liu provided by the present application has a complete lignocellulose-degrading enzyme system, can secrete cellulase, hemicellulase and lignin-degrading enzyme extracellularly, meets the needs of efficient degradation of cellulose, hemicellulose and lignin, provides rich choices for catalyzing various types of reactions, and provides strong support for biofuel and biomass resource utilization.

[0023] 2. Strong pH tolerance, active in the pH range of 5.0-9.0, good growth performance and environmental adaptability.

[0024] 3. The yield of succinic acid is significantly improved, which is suitable for industrial fermentation production of organic acid and has potential biological manufacturing application value.

[0025] 4. Excellent carbon and nitrogen source utilization ability, under the condition that the carbon source is glucose and the nitrogen source is yeast powder, the dry weight of the bacterial cell reaches 1.25 g / L, which provides optimization parameters for industrial cultivation.

[0026] 5. Novel source, high resource value, the strain is isolated from rumen microbial resources, multiple cellulase encoding genes are found in the genome, which provides new industrial strain resources and enriches the application basis of Escherichia coli expression system.

[0027] The above characteristics jointly determine that the Escherichia coli Liu has a broad application prospect in the fields of industry, agriculture, medicine and food. BRIEF DESCRIPTION OF DRAWINGS

[0028] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present application and serve to explain the principles of the present application together with the specification.

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings needed to be used in the embodiments or prior art description will be briefly introduced as follows. Obviously, for those of ordinary skill in the art, other drawings can also be obtained based on these drawings without any creative effort.

[0030] Figure 1 The figure is a colony growth chart of the strain described in Example 1 of the present application on a MAC plate.

[0031] Figure 2 The figure is a PCR electrophoresis chart of the strain described in Example 2 of the present application.

[0032] Figure 3 The figure is a genomic sequencing NR annotation result chart of the strain described in Example 2 of the present application.

[0033] Figure 4 The figure is an extracellular exoglucosidase activity determination result chart of the Escherichia coli Liu described in Example 3 of the present application.

[0034] Figure 5 The figure is an extracellular endoglucosidase activity determination result chart of the Escherichia coli Liu described in Example 3 of the present application.

[0035] Figure 6 The figure is an extracellular β-glucosidase activity determination result chart of the Escherichia coli Liu described in Example 3 of the present application.

[0036] Figure 7 The figure is an extracellular xylanase activity determination result chart of the Escherichia coli Liu described in Example 3 of the present application.

[0037] Figure 8 The figure is an extracellular laccase activity determination result chart of the Escherichia coli Liu described in Example 4 of the present application.

[0038] Figure 9Figure of determination result of extracellular lignin peroxidase activity of Escherichia coli Liu according to embodiment 4 of the present application;

[0039] Figure 10 Figure of determination result of extracellular manganese peroxidase activity of Escherichia coli Liu according to embodiment 4 of the present application;

[0040] Figure 11 Congo red plate figure of Escherichia coli Liu and MG1655 according to embodiment 5 of the present application;

[0041] Figure 12 Figure of optimal carbon source optimization result of Escherichia coli Liu according to embodiment 6 of the present application;

[0042] Figure 13 Figure of optimal nitrogen source optimization result of Escherichia coli Liu according to embodiment 6 of the present application;

[0043] Figure 14 Figure of optimal culture pH result of Escherichia coli Liu according to embodiment 7 of the present application;

[0044] Figure 15 Figure of succinic acid production content determination result of Escherichia coli Liu according to embodiment 8 of the present application. DETAILED DESCRIPTION

[0045] In order to enable the above-mentioned purposes, features and advantages of the present application to be more clearly understood, the schemes of the present application will be further described below. It should be noted that the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

[0046] In the following description, many specific details are set forth in order to provide a thorough understanding of the present application, but the present application can also be practiced without the specific details; obviously, the embodiments in the description are only some of the embodiments of the present application, not all the embodiments.

[0047] LB medium: 10 g / L Tryptone, 5 g / L Yeast extract, 10 g / L NaCl.

[0048] MAC medium: 17 g / L Tryptone, 10 g / L lactose, 1.5 g / L bile salts, 5 g / L NaCl, 0.03 g / L neutral red, 0.001 g / L crystal violet, 20 g / L agar.

[0049] Congo red plate medium: CMC-Na 10.0 g, NaCl 5.0 g, KH2PO4 1.0 g, MgSO4 0.2 g, Yeast extract 10.0 g, Agar 18.0 g, pH 7.0.

[0050] Carbon-free M9 medium: 3 g / L potassium dihydrogen phosphate, 6 g / L sodium hydrogen phosphate, 0.5 g / L sodium chloride, 1 g / L ammonium chloride, 0.24 g / L magnesium sulfate, 0.011 g / L calcium chloride.

[0051] Rumen natural medium: 10 g / L Tryptone, 5 g / L Yeast extract, 10 g / L NaCl, 170 mL / L bovine rumen fluid, 2.0 g / L carboxymethylcellulose sodium.

[0052] Example 1 Isolation and screening of strains

[0053] 1.1 Sample collection

[0054] Rumen content collection: Rumen fluid was derived from the cattle and sheep of farmers scattered in Xikouzuo slaughterhouse in Hohhot, Inner Mongolia Autonomous Region. Different individuals of sheep (20) and cattle (20) were collected, and 2 samples were collected from each individual. The specific sampling process was as follows: first, the rumen was cut open and part of the sample was taken with a go-to mineral water bottle, and the bottle was shaken constantly to mix the bacteria attached to the chyme into the rumen fluid. Then, fresh rumen chyme was filtered with four layers of gauze, and the filtrate was injected into a sterile vial with a syringe, sealed and stored in an ice box for standby.

[0055] 1.2 Preparation of cell-free rumen fluid

[0056] First, the rumen content filtrate obtained in step 1 was filtered with 4 layers of medical gauze, and centrifuged at 4 °C, 12000 rpm for 2 times, 10 min each time. The rumen supernatant was stored at -20 °C for standby.

[0057] 1.3 Enrichment of E. coli

[0058] The rumen fluid obtained from step 1 was inoculated into a flask containing fresh LB medium (10 g / L Tryptone, 5 g / L Yeast extract, 10 g / L NaCl) at an inoculation amount of 1%, and was enriched at 37°C, 220 rpm for 12 h, and was used as seed liquid, and the strain and rumen fluid samples were stored.

[0059] 1.4 Screening

[0060] The screening method used MacConkey agar medium (MAC). The MAC medium screening principle: this medium is mainly used to isolate Gram-negative enteric bacilli that ferment lactose; peptone mainly provides carbon and nitrogen sources, vitamins and influencing factors, bile salts and crystal violet can inhibit the growth of Gram-positive bacteria, sodium chloride maintains balanced osmotic pressure, agar is the coagulant of the medium, lactose is a fermentable sugar, neutral red is a pH indicator. This medium uses bile salts and crystal violet to inhibit the growth of Gram-positive bacteria, while promoting the growth of Salmonella typhi, using lactose fermentation, the color of neutral red can distinguish bacteria that decompose lactose and those that do not. E. coli colonies are pink or red, Salmonella and Shigella colonies are colorless.

[0061] First, a pre-experiment was conducted, and the seed liquid was diluted at a concentration gradient, respectively: 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 and 10 -8 , and was coated on MAC medium, and was cultured at 37°C for 24 h. After concentration dilution, it was determined that the number of colonies grown on the plate was most suitable when the seed liquid was diluted by 10 -5 and 10 -6 times. After all samples were diluted to the optimal concentration of 10 -5 , they were plated and cultured at 37°C, and the growth of colonies was observed. Single colonies appeared after 12 h, and the results are shown in Figure 1 . Four single colonies were picked and inoculated into 96-well plates with LB medium, and were cultured at 37°C, 220 rpm, and the overnight shaking bacteria were used as seed.

[0062] Figure 1 Growth of colonies of strains on MAC plates (A is the control strain E. coli-MG1655, B is the experimental strain derived from rumen fluid). From Figure 1It can be seen that the color of the experimental strain is basically the same as that of the control strain. It is found that the single colony selected from the rumen liquid grows faster than E. coli-MG1655 during the culture process. It can also be seen from the plate that the single colony of the experimental strain is relatively large. Figure 1 The results show that the experimental strain from the rumen liquid has better growth ability than the control strain, which is also the result of adaptive evolution.

[0063] Example 2 Identification and preservation of the strain

[0064] 2.1 Physiological and biochemical characteristics

[0065] The reference source is the 9th edition of Bergey's Manual of Determinative Bacteriology.

[0066] The strain grows well at 37-39℃ and pH 7.0, can ferment glycerol, galactose, nitrate, mannitol, dulcitol, proteose peptone, ornithine decarboxylase, lysine decarboxylase, glucose, aesculin, arabinose, fructose, lactose, melibiose, rhamnose, xylose, maltose, sorbitol and salicylic acid, and cannot ferment cellobiose, raffinose, sucrose, hydrogen sulfide, gelatin, starch, urea, simon's citrate, phenylalanine, has motility, and is facultative anaerobic.

[0067] 2.2 16S rDNA sequencing

[0068] 16S rDNA sequencing is used and the sequence of the strain is compared. The amplification uses 16S universal primers as follows:

[0069] SEQ ID NO. 1: 27F: AGAGTTTGATCCTGGCTCAG;

[0070] SEQ ID NO. 2: 1492R: GGTTACCTTGTTACGACTT.

[0071] The PCR reaction system and reaction conditions are shown in Table 1 and Table 2, respectively.

[0072] Table 1 PCR reaction system

[0073]

[0074] Table 2 PCR reaction conditions

[0075]

[0076] The preserved strain is streaked, cultured at 37℃ for 12 h, then colony PCR is performed, and the product is electrophoresed. The PCR identification result is shown in Table 3. Figure 2 Table 3 PCR identification result Figure 2It was found that all 16S rDNA sequences could be amplified, and the fragment sizes were consistent with the expected results, indicating that the strain was a pure bacterium. Sequencing analysis was performed on the PCR products that were verified to be correct. The 16S rDNA sequences were assembled and compared using Nucleotide Blast to determine the species. Blast alignment analysis confirmed the strain to be *Escherichia coli*.

[0077] 2.3 Whole genome sequencing

[0078] Remove the bacterial strain from the -80°C freezer and streak it onto an LB agar plate. After clear single colonies have grown, pick a single colony and inoculate it into LB medium for overnight incubation at 37°C and 220 rpm. Inoculate 1% of the bacterial culture into LB medium and incubate until the logarithmic growth phase. Collect the bacterial cells and extract genomic DNA, following the instructions for the Tiangen Genomic DNA Extraction Kit. Send the extracted, high-quality genomic DNA to Novogene Biotechnology Co., Ltd. for sequencing.

[0079] The results are as follows Figure 3 As shown, Figure 3 This is a graph showing the NR annotation results for genome sequencing. The Non-Redundant Protein Database (NR) is a non-redundant protein database; the genome annotation results include species information and can be used for species classification. Based on the species annotated, the statistical results of the annotated species and gene counts further confirmed that the above strain is *E. coli*, with a genome size of 5.22 Mb and a GC content of 50.78%, which is larger and has a higher GC content than the standard *E. coli* strain. Furthermore, by analyzing the genome sequencing data, genes encoding cellulase-related enzymes were retrieved.

[0080] 2.4 Preservation of bacterial strains

[0081] The *Escherichia coli* Liu, classified and named as *Escherichia coli*, is deposited at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, on April 28, 2025, with accession number GDMCC No. 66233.

[0082] Example 3. Detection of cellulase and hemicellulase activities

[0083] After culturing Escherichia coli Liu in LB medium, the fermentation broth was centrifuged, and the supernatant was used as the fermentation supernatant. The supernatant was centrifuged at 4°C and 6000 rpm for 10 minutes.

[0084] 3.1 Assay of exoglucanase activity

[0085] Take 500 μL of fermentation supernatant as crude enzyme solution, add 50 μL of substrate p-nitrophenyl cellulose biglycoside (pNPC, 1 mg / mL), mix well, react at 50 °C for 30 min, and terminate the reaction by adding 150 μL of 10% Na₂CO₃. Calculate enzyme activity by measuring the amount of p-nitrophenol produced at a wavelength of 405 nm.

[0086] 3.2 Assay of Endoglucanase Activity

[0087] Add 50 μL of fermentation supernatant to a centrifuge tube containing 150 μL of 0.5% sodium carboxymethyl cellulose (CMCNa) and react at 50 °C for 30 min. Terminate the reaction by adding 50 μL of 1M NaOH solution and 150 μL of 3,5-dinitrosalicylic acid (DNS) solution to the centrifuge tube. Vortex to thoroughly mix the reaction solution, then heat in a boiling water bath for 5 min. Terminate the reaction with an ice-water mixture. Adjust the volume of the reaction solution to 1250 μL and measure the absorbance at 540 nm. Calculate the enzyme activity based on the standard curve of endoglycanase activity.

[0088] 3.3 β-glucosidase activity assay

[0089] Take 200 uL of fermentation supernatant as crude enzyme solution, add 100 uL of pNPG (1 mg / mL), react at 50℃ for 30 min, add 300 uL of 10% Na2CO3 to terminate the reaction, and measure the OD value at a wavelength of 405 nm.

[0090] 3.4 Xylanase Activity Assay

[0091] The reaction system consisted of 50 μL of fermentation supernatant as crude enzyme solution, 100 μL of 1% xylan (beech or birch) solution, mixed well, reacted at 50 °C for 30 min, 200 μL of DNS solution was added to terminate the reaction, boiled for 10 min, allowed to stand and cool, and then distilled water was added to make up to 1.25 mL. The mixture was shaken well and the OD value was measured at a wavelength of 540 nm.

[0092] The results are as follows Figures 4-7 As shown, by Figures 4-7It can be seen that the exoglucosidase activity of Escherichia coli Liu can reach 13.1 IU, the endoglucosidase activity is 10.8 IU, the β-glucosidase activity is 14.35 IU, and the xylanase activity is 18.90 IU, indicating that Escherichia coli Liu has good ability to secrete exoglucosidase, endoglucosidase, β-glucosidase and xylanase.

[0093] Example 4 Lignin-degrading enzyme activity detection

[0094] Escherichia coli Liu was cultured in LB medium, and then the fermentation broth was centrifuged, and the supernatant was taken as the fermentation supernatant. Escherichia coli ZH-4 was used as a control group.

[0095] 4.1 Laccase activity determination

[0096] It is determined by monitoring the oxidation of ABTS at 420 nm. 3 mL of reaction system at 37℃, the reaction mixture contains 2 mL of 0.5 mmol / L ABTS (dissolved in 0.1 mmol / L, pH 5.0 acetic acid-sodium acetate buffer solution), 1 mL of fermentation supernatant is added to start the reaction, and the change value of absorbance at 420 nm is determined after 3 min. One enzyme activity unit (U) is defined as the amount of enzyme required to oxidize 1 μmol of ABTS per minute. (Distilled water instead of enzyme solution as control)

[0097] Enzyme activity (U / mL) =

[0098] ΔA is the change value of absorbance; V1 is the total volume of the reaction liquid (mL); V2 is the volume of the crude enzyme liquid (mL); Δt is the reaction time.

[0099] 4.2 Lignin peroxidase activity determination

[0100] It is determined by monitoring the oxidation of veratryl alcohol to veratraldehyde at 310 nm. 3 mL of reaction system at 37℃, the reaction mixture contains 1.80 mL of 0.24 mmol / L veratryl alcohol and 1.1 mL of fermentation supernatant, preheated to 37℃, then add 0.1 mL of 6 mmol / L H2O2 to start the reaction, and the increase of absorbance at 310 nm is determined after 3 min. One activity unit (U) is defined as the amount of enzyme required to oxidize 1 μmol of veratryl alcohol per minute. (Distilled water instead of H2O2 as control)

[0101] Enzyme activity (U / mL) =

[0102] ΔA represents the change in absorbance at 310 nm for each well; Vt represents the total volume of the reaction system (mL); and t represents the reaction time (min).

[0103] 4.3 Manganese peroxidase activity assay

[0104] The reaction system was set at 37℃, with a 3 mL reaction mixture containing 2.4 mL of 50 mM pH 4.5 acetate buffer, 0.1 mL of 1.6 mM MnSO4 solution, and 0.4 mL of fermentation supernatant. 0.1 mL of 1.6 mM H2O2 solution was added at 37℃ to initiate the reaction. The absorbance at 240 nm was measured within the first 3 minutes. One unit of enzyme activity (U) is defined as the rate at which 1 μmol of MnSO4 is activated per minute. 2+ Transform into Mn 3+ Required amount of enzyme. (Use distilled water as a control instead of enzyme solution.)

[0105] Enzyme activity (U / L) =

[0106] ΔA represents the change in absorbance at 240 nm for each well; Vt represents the total volume of the reaction system (mL); and t represents the reaction time (min).

[0107] The results are as follows Figures 8-10 As shown. By Figure 8 It can be seen that the enzyme activity of laccase gradually increases from 4 h to 12 h, reaching a maximum of 8.18 U / mL at 12 h. From Figure 9 It can be seen that the activity of lignin peroxidase gradually increases from 4 h to 12 h, reaching a maximum of 1.80 U / mL at 12 h. Figure 10 The activity of manganese peroxidase gradually increased from 4 h to 12 h, reaching a maximum of 0.39 U / mL at 12 h. This indicates that *Escherichia coli* Liu has a good ability to secrete laccase, lignin peroxidase, and manganese peroxidase extracellularly, further suggesting that *Escherichia coli* Liu has lignin degradation capabilities. However, the above-mentioned ligninase activities were not detected in *Escherichia coli* ZH-4.

[0108] Example 5: Identification of Cellulose Degradability

[0109] The cellulose degradation ability of the strain was qualitatively determined by using a carboxymethyl cellulose Congo red plate. Whether a transparent circle was formed on the plate after inoculation was used as the basis for cellulose degradation. First, 2 μL of seed liquid was inoculated on the plate and incubated at 37°C for 24 h. Then, the plate was dyed with 1% Congo red staining solution for 1 h, and then decolorized with 0.9% NaCl until a clear transparent circle could be observed. The laboratory standard strain MG1655 was used as a control group. The results are shown in Figure 11 As can be seen from the figure, Escherichia coli Liu has stronger cellulose degradation ability than the laboratory standard strain MG1655.

[0110] According to the results of Examples 3, 4 and 5, compared with the laboratory standard strain MG1655 and Escherichia coli ZH-4, the Escherichia coli Liu provided by the application has a complete lignocellulose degradation enzyme system, can produce various cellulases, hemicellulases and lignin degradation enzymes including exoglucosidase, endoglucosidase, β-glucosidase and xylanase, laccase, lignin peroxidase and manganese peroxidase, and the synergistic effect of the two can efficiently degrade complex lignocellulose, and the application of the two in biofuels provides strong support for the utilization of biofuels and biomass resources.

[0111] Example 6 Optimization of optimal carbon source and nitrogen source

[0112] Pre-experiment: M9 medium without carbon source was used as a control group, and M9 + single carbon source (glucose, cellobiose, sucrose) was used as an experimental group. Escherichia coli Liu strain was cultured at 37°C and 200 rpm overnight, and then inoculated into the corresponding medium (80 mL) at a 5% inoculation amount, and cultured at 37°C and 200 rpm, and the OD600 was monitored to the stable phase, and the growth curve was recorded.

[0113] M9 medium without nitrogen source was used as a control group, and M9 (fixed optimal carbon source) + single nitrogen source (peptone, yeast extract, ammonium sulfate, ammonium chloride, etc.) was used as an experimental group, and the detection method was the same as that of the carbon source experiment.

[0114] The results are shown in Figure 12 and 13 As can be seen from Figure 12 , the optimal carbon source is glucose, followed by cellobiose. As can be seen from Figure 13 , the optimal nitrogen source is peptone and yeast powder.

[0115] The two best-performing carbon sources (glucose and cellobiose) and two nitrogen sources (peptone and yeast powder) in the pre-experiment were selected for a full combination (4 groups) of orthogonal experiments: inoculate 80 mL of the combined medium at a 5% inoculation rate, 37°C, 200 rpm shaking culture for 26 h, and measure the dry weight of the bacterial cells. Analyze the interaction to determine the optimal carbon-nitrogen combination. The results are shown in Table 3:

[0116] Table 3 Dry weight of bacterial cells

[0117]

[0118] As shown in Table 3, glucose and yeast powder are the optimal carbon-nitrogen source combination. Under the condition of glucose as the carbon source and yeast powder as the nitrogen source, the dry weight of the bacterial cells reaches 1.25 g / L, providing optimized parameters for industrial cultivation.

[0119] Example 7 pH tolerance experiment

[0120] In the optimal carbon-nitrogen combination (carbon source: glucose, nitrogen source: yeast powder) medium, adjust the initial pH, pH gradient: 5.0, 6.0, 7.0, 8.0, 9.0 (adjusted with buffer or HC1 / NaOH), inoculate at 37°C, 220 rpm for 34 h and monitor OD600 to the stable phase. The results are shown in Figure 14 Table 4. The optimal culture pH of Escherichia coli Liu is 7.0, and in addition, the strain has good pH broadness and can grow at pH 5.0 and 9.0, indicating that it has good pH tolerance.

[0121] Example 8 Succinic acid content determination

[0122] The laboratory standard strain MG1655 was used as the control group, and Escherichia coli Liu was used as the experimental group. After overnight culture at 37°C, 220 rpm in LB medium, the seed liquid was inoculated in an anaerobic fermentation bottle at a 2% inoculation rate. The fermentation medium was rumen natural medium, and the culture was carried out at 37°C, 220 rpm for 24 h. The fermentation broth was centrifuged at 12000 rpm for 2 min, and the supernatant was filtered with a 0.22 μm water filter membrane. The filtered supernatant was measured by Shimadzu high performance liquid chromatography with a differential detector, equipped with Aminex HPX-87H column (BioRad, Inc., Hercules, CA), 5 mM sulfuric acid as the mobile phase, flow rate 0.6 mL / min, column temperature 65°C, to determine the succinic acid content.

[0123] The results are shown in Figure 15 Table 5. As shown in Figure 15It is known that the succinic acid content of Escherichia coli Liu strain is 0.66 g / L, which is increased by 65% compared with Escherichia coli MG1655 strain, and is suitable for industrial fermentation production of organic acid and has potential biological manufacturing application value.

[0124] It should be noted that, in this document, relational terms such as“first” and“second”, and the like, are used solely to distinguish one entity or action from another entity or action, without necessarily requiring or implying any actual such relationship or order between such entities or actions. Moreover, the terms“comprises”,“comprising”, or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but can include other elements not expressly listed or inherent to such process, method, article, or apparatus. An element proceeded by“comprises a...” does not, without more constraints, exclude the existence of additional identical elements in the process, method, article, or apparatus that comprises the element.

[0125] The above description is merely that of the specific embodiments of the present application, making it possible for those skilled in the art to understand or implement the present application. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein can be applied to other embodiments without departing from the spirit or scope of the present application. Therefore, the present application is not intended to be limited to the embodiments described herein but is to accord with the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A strain of Escherichia coli Liu, which was deposited with the Guangdong Microbial Culture Collection Center on April 28, 2025, and has the accession number GDMCC No: 66233.

2. An inoculant characterized in that, A strain of Escherichia coli Liu as claimed in claim 1.

3. Use of the strain of Escherichia coli Liu as claimed in claim 1 or the microbial agent as claimed in claim 2 in degrading cellulose, hemicellulose and / or lignin.

4. Use of the strain of Escherichia coli Liu as claimed in claim 1 or the microbial agent as claimed in claim 2 in preparing cellulase, hemicellulase and / or lignin-degrading enzyme. The cellulase includes exoglucosidase, endoglucosidase and β-glucosidase, and the hemicellulase includes xylanase. The lignin-degrading enzyme includes laccase, lignin peroxidase and manganese peroxidase.

5. Use of the strain of Escherichia coli Liu as claimed in claim 1 or the microbial agent as claimed in claim 2 in fermentative production of succinic acid.

Citation Information

Patent Citations

  • Novel xylanase V-XYL as well as gene, high-efficiency expression method and application thereof

    CN102002471A

  • Escherichia coli capable of secreting cellulase and application of escherichia coli in degrading cellulose

    CN111733103A

  • Escherichia coli for producing succinic acid and application of escherichia coli

    CN112239738A