Novel biosynthesis path for producing 3 '-phosphoadenosine-5'-phosphosulfuric acid and application of 3 '-phosphoadenosine-5'-phosphosulfuric acid

Abstract

The invention discloses a novel biosynthesis path for producing 3 '-phosphoadenosine-5'-phosphosulfuric acid and application, and belongs to the technical field of bioengineering. According to the invention, through recombinant expression and purification of ribose kinase, ribose phosphate pyrophosphate kinase, ribose phosphate transferase, adenine thiotransferase, adenosine phosphate sulfate kinase and polyphosphate kinase 2, a six-enzyme cascade reaction taking ribose and adenosine as substrates in vitro is constructed, the molar conversion rate reaches 22.85%, and the escherichia coli and bacillus subtilis PAPS cell factory can be used for preparing the recombinant ribose phosphate pyrophosphate kinase, the ribose phosphate transferase, the adenine thiotransferase, the adenosine phosphate sulfate kinase and the polyphosphate kinase 2. The yield of PAPS in a 5-L fermentation tank reaches 7.60 g / L and 5.03 g / L respectively. The PAPS synthesis route provided by the invention provides an extensible, economical and efficient solution for the production of sulfated compounds.

Description

Technical Field

[0001] The present invention relates to a novel biosynthetic pathway for producing 3'-adenosine phosphate-5'-phosphosulfate and its application, belonging to the technical field of bioengineering. Background Art

[0002] 3'-phosphoadenosine-5'-phosphosulfate (PAPS) is a high-energy compound with the molecular formula C 10 H 14 N5O 13 P2S, molecular weight 507.27 g·mol -1 , with two phosphate groups and one sulfate group, respectively attached to the 3' and 5' positions of adenosine. In the reaction catalyzed by reductase, the high-energy sulfate bond is easily broken to release the sulfate group, forming a sulfite compound or a sulfur-containing compound, completing the synthesis and sulfate modification of compounds such as amino acids, proteins, hormones and flavonoids in the body. PAPS has good solubility in water and is relatively stable under physiological conditions (37°C, pH 7.4). It has a half-life of about 24 hours and can be stored for a long time at low temperatures (below 0°C) without obvious degradation. When the temperature rises to 60°C, the half-life is only a few minutes, and it decomposes almost instantly at 80°C. It is easily hydrolyzed in acidic or alkaline environments to generate adenosine monophosphate and inorganic sulfate, resulting in the loss of its biological activity.

[0003] Currently, the dual-enzyme method for synthesizing PAPS using ATP as a substrate can achieve high conversion rates. However, ATP is expensive, easily decomposed, and the method is cumbersome to operate, making it unsuitable for large-scale production. Biosynthesis based on the natural PAPS synthesis pathway is limited by ATP supply and has low yields. There are no reports of PAPS cell factories either domestically or internationally. Both de novo synthesis cell factories and whole-cell catalytic systems for functional glycosaminoglycan derivatives such as heparan sulfate and chondroitin sulfate are limited by PAPS supply, resulting in insufficient production performance, low synthesis efficiency, and high production costs. Therefore, it is necessary to explore new, high-efficiency, and low-cost PAPS biosynthesis strategies to achieve efficient production and supply of PAPS. This would provide new ideas for constructing cell factories for sulfated compounds, expand the sulfotransferase resource library, and promote the development of enzyme engineering and metabolic engineering, which has important scientific significance and application value. Summary of the Invention

[0004] The present invention provides a novel PAPS biosynthetic pathway, which uses ribose and adenosine as substrates and synthesizes PAPS through a six-enzyme cascade reaction catalyzed by ribokinase (RBSK), phosphoribosyl pyrophosphokinase (PRS), phosphoribosyltransferase (APRT), adenine sulfur transferase (APSST), adenosine phosphosulfate kinase (APSK), and polyphosphate kinase 2 (PPK2).

[0005] The first object of the present invention is to provide a novel biosynthetic pathway for producing 3'-phosphoadenosine-5'-phosphosulfate, which consists of the following enzymes: ribokinase (RBSK), phosphoribosyl pyrophosphokinase (PRS), phosphoribosyltransferase (APRT), adenine sulfur transferase (APSST), adenosine phosphosulfate kinase (APSK) and polyphosphate kinase 2 (PPK2).

[0006] In one embodiment of the present invention, the ribokinase is derived from human; phosphoribosyl pyrophosphokinase is derived from Bacillus amyloliquefaciens; phosphoribosyltransferase is derived from Schizosaccharomyces pombe; adenine sulfotransferase is derived from bovine; adenosine phosphosulfate kinase is derived from Penicillium chrysogenum; and polyphosphate kinase 2 is derived from spherocytes.

[0007] In one embodiment of the present invention, the nucleotide sequence of the gene encoding ribokinase is shown as SEQ ID NO.1; the nucleotide sequence of the gene encoding phosphoribosylpyrophosphokinase is shown as SEQ ID NO.2; the nucleotide sequence of the gene encoding phosphoribosyltransferase is shown as SEQ ID NO.3; the nucleotide sequence of the gene encoding adenine sulfur transferase is shown as SEQ ID NO.4 or SEQ ID NO.7; the nucleotide sequence of the gene encoding adenosine phosphosulfate kinase is shown as SEQ ID NO.5; and the nucleotide sequence of the gene encoding polyphosphate kinase 2 is shown as SEQ ID NO.6.

[0008] In the present invention, the APSST enzyme can preferably be a variant APSST in which histidine at position 8 is mutated to methionine and leucine at position 117 is mutated to aspartic acid. * The nucleotide sequence of its coding sequence is shown in SEQ ID NO.7.

[0009] The second object of the present invention is to provide the application of the synthetic route in the production of 3'-adenosine phosphate-5'-phosphosulfate, specifically using the enzyme in the synthetic route as a catalyst, with ribose and adenosine as substrates, to catalyze the reaction to obtain 3'-adenosine phosphate-5'-phosphosulfate.

[0010] In one embodiment of the present invention, the addition amounts of the enzymes in the synthetic pathway are 0.005-0.015 mM of ribokinase, 0.01-0.03 mM of phosphoribosyl pyrophosphokinase, 0.05-0.07 mM of phosphoribosyltransferase, 0.05-0.15 mM of adenine sulfotransferase, 0.05-0.15 mM of adenosine phosphosulfate kinase, and 0.05-0.15 mM of polyphosphate kinase 2.

[0011] In one embodiment of the present invention, the added amount of ribose is 1-10 mM, and the added amount of adenosine is 1-10 mM.

[0012] In one embodiment of the present invention, the reaction conditions of the catalytic reaction are 25-35° C., 200-300 rpm, and 10-60 min.

[0013] The third object of the present invention is to provide a nucleic acid vector comprising coding sequences encoding the following enzymes: ribokinase, phosphoribosyl pyrophosphate kinase, phosphoribosyltransferase, adenine sulfur transferase, adenosine phosphosulfate kinase and polyphosphate kinase 2, wherein the coding sequences of the enzymes are in one, two or more expression frames.

[0014] The fourth object of the present invention is to provide an engineered bacterium expressing the synthetic pathway, wherein the engineered bacterium expresses the following enzymes: ribokinase, phosphoribosyl pyrophosphate kinase, phosphoribosyltransferase, adenine sulfur transferase, adenosine phosphosulfate kinase and polyphosphate kinase 2.

[0015] In one embodiment of the present invention, the engineered bacteria has the cysH gene knocked out.

[0016] In one embodiment of the present invention, the host cell of the engineered bacteria is Escherichia coli or Bacillus subtilis.

[0017] In one embodiment of the present invention, the Escherichia coli is Escherichia coli BL21 (DE3), and the Bacillus subtilis is Bacillus subtilis 168.

[0018] In one embodiment of the present invention, when the host of the engineered bacteria is Escherichia coli, it also includes inserting three copies of the gene encoding adenine sulfotransferase as shown in SEQ ID NO.7 into the cysH gene site in the genome, and inserting three copies of the gene encoding adenine sulfotransferase as shown in SEQ ID NO.7 into the rph pseudogene site.

[0019] In one embodiment of the present invention, when the host of the engineered bacteria is Bacillus subtilis, six copies of a gene encoding adenine sulfotransferase as shown in SEQ ID NO. 7 are inserted into the cysH gene site in the genome.

[0020] The fifth object of the present invention is to provide the use of the engineered bacteria in the fermentation production of 3'-adenosine phosphate-5'-phosphosulfate, wherein the use is to synthesize 3'-adenosine phosphate-5'-phosphosulfate from scratch using ribose and adenosine as substrates.

[0021] In one embodiment of the present invention, the application is specifically to ferment and culture the engineered bacteria using a culture medium supplemented with ribose and adenosine.

[0022] In one embodiment of the present invention, the culture medium is LB medium or TB medium.

[0023] In one embodiment of the present invention, ribose and adenosine are further added during the fermentation process.

[0024] In one embodiment of the present invention, the fermentation is performed as a shake flask fermentation, and the fermentation conditions are as follows: the inoculation amount is 2-5%, the initial OD 600 The fermentation temperature is 30-38℃, the rotation speed is 220rpm, and the fermentation period is 30-36h.

[0025] In one embodiment of the present invention, the fermentation is carried out in a fermenter, and the fermentation conditions are as follows: the inoculation volume is 5-15%, the liquid volume is 20-60%, and the initial OD of the fermentation is 0. 600 The fermentation temperature is 30-38℃, the rotation speed is 300-700rpm, the pH is controlled at 6.5-7.5, the ventilation volume is 1-2vvm, and the fermentation period is 30-36h.

[0026] Beneficial effects

[0027] The present invention constructs a novel PAPS biosynthetic pathway, with an in vitro multi-enzyme cascade catalytic molar conversion rate of 22.85%. The PAPS synthesis pathway is applied to the industrial chassis strains Escherichia coli and Bacillus subtilis to construct PAPS cell factories, achieving efficient biosynthesis of PAPS in 5-L fermenters, with PAPS yields reaching 7.60 g / L and 5.03 g / L, respectively. This provides a scalable and cost-effective solution for the production of sulfated compounds. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 :Schematic diagram of the synthesis route of the new PAPS.

[0029] Figure 2 : HPLC-MS detection spectrum of PAPS.

[0030] Figure 3 : Schematic diagram of pET-Duet-RBSK-PRS-APRT plasmid.

[0031] Figure 4 :pRSF-Duet-APSK * -Schematic diagram of the APSST-PPK2 plasmid.

[0032] Figure 5 : Shake flask fermentation results of recombinant Escherichia coli.

[0033] Figure 6 : Fermentation results of recombinant Escherichia coli in 5-L fermenter.

[0034] Figure 7 : Schematic diagram of pTA-RBSK-PRS-APRT plasmid.

[0035] Figure 8 :pHT-APSK * -Schematic diagram of the APSST-PPK2 plasmid.

[0036] Figure 9 : Fermentation of recombinant Bacillus subtilis in 5-L fermenter and analysis of results. DETAILED DESCRIPTION

[0037] Plasmid construction was performed using classical molecular biological methods.

[0038] Table 1 Carrier-related characteristics

[0039]

[0040] The culture medium involved in the following examples is as follows:

[0041] LB liquid medium: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, sterilized at 121°C for 20 min.

[0042] LB solid medium: Add 2% agar to LB liquid medium.

[0043] TB liquid medium: KH2PO4 2.31 g / L, K2HPO4·3H2O 16.42 g / L, yeast powder 24 g / L, peptone 12 g / L, glycerol 4 g / L.

[0044] The detection method adopted in the following examples is as follows:

[0045] HPLC-MS determination of PAPS: Analyses were performed using an HPLC system equipped with a polyamine column (YMC Pack polyamine II, 250 mm × 4.6 mm). Filtered, ultrasonically degassed 0.7 mM KH2PO4 was used as the mobile phase at a flow rate of 0.6 mL / min. The column temperature was maintained at 30°C throughout the analysis, and the detection wavelength was 254 nm.

[0046] The sequences involved in the following examples are:

[0047] SEQ ID NO.1:

[0048] ATGGCAGCTTCAGGAGAACCCCAGAGGCAATGGCAAGAGGAAGTTGCTGCTGTGGTGGTCGTCGGCTCCTGCATGACTGATCTCGTGAGCTTGACCTCTCGCCTGCCAAAGACGGGTGAGACAATTCACGGCCATAAATTCTTCATTGGTTTTGGAGGTAAGGGTGCCAACCAGTGTGTTCAAGCGGCGCGTCTGGGTGCTATGACCAGCATGGTATGCAAAGTGGGCAAGGACAGCTTCGGCAATGACTACATTGAAAACTTGAAGCAAAACGATATTTCCACCGAGTTCACCTATCAGACCAAAGACGCCGCTACTGGCACCGCAAGCATTATTGTGAACAACGAAGGTCAGAACATTATCGTGATCGTGGCGGGTGCGAATCTGCTGCTCAACACCGAGGACCTGCGCGCAGCGGCGAACGTGATCTCTCGTGCAAAAGTCATGGTGTGCCAACTGGAAATCACCCCAGCGACCAGCCTGGAAGCTCTCACGATGGCACGCCGTTCAGGTGTTAAGACCTTGTTTAACCCGGCTCCGGCCATTGCGGACCTGGACCCGCAGTTTTACACCCTGTCCGATGTTTTTTGTTGTAATGAGAGCGAAGCCGAGATCCTGACCGGCCTGACGGTTGGCAGTGCAGCGGACGCGGGCGAAGCAGCCCTGGTTCTGCTGAAACGTGGTTGCCAGGTTGTTATCATCACCCTTGGCGCGGAGGGCTGCGTGGTCCTGAGCCAGACTGAGCCGGAACCGAAGCACATCCCGACCGAGAAAGTGAAGGCGGTTGATACCACCGGTGCGGGTGATTCGTTCGTGGGTGCGCTGGCGTTTTACCTGGCGTATTACCCGAATTTGTCTTTGGAGGACATGCTGAATCGTTCCAACTTCATCGCCGCGGTTAGCGTTCAAGCGGCGGGTACGCAGAGCAGCTATCCGTATAAAAAAGACTTACCGCTGACGCTGTTC

[0049] SEQ ID NO.2:

[0050] ATGAGTAACGAATATGGCGATAAAAATTTGAAGATTTTCTCTTTGAACAGTAACCCCGAACTGGCAAAGGAGATTGCCGACAACGTTGGCGTACAGCTTGGTAAATGTTCCGTGACGCGCTTCAGTGATGGTGAGGTACAAATCAACATCGAAGAATCAATCCGTGGATGCGACTGTTACATTATTCAATCAACTTCAGCACCTGTCAATGAACACATCATGGAGTTGTTAATTATGGTTGATGCGTTGAAGCGTGCATCTGCTAAGACTATCAACATTGTTATTCCATACTACGGATATGCCCGTCAGGATCGCAAGGCACGCAGCCGCGAACCCATTACTGCCAAGTTATTTGCAAACTTGTTGGAAACCGCCGGTGCCACGCGTGTGATCGCTTTGGATATTCACGCTCCGCAGATTCAGGGGTTCTTCGATATCCCGATCGACCATCTGATGGGCGTCCCAATCCTGGGTCATTATTTTGAAGGCAAGGATTTAAAAGACATCGTCATTGTGTCTCCTGATCACGGGGGAGTCACGCGCGCTCGTAAACTTGCAGACCGCTTGAAAGCACCAATTGCCATCATTGACAAGCGTCGTCCCCGCCCCAACGAAGTGGAGGTCATGAATATCGTCGGAAATGTAGAGGGAAAGACCGCCATCCTTATTGATGACATCATTGATACAGCGGGCACAATCACATTGGCTGCTAACGCGCTTGTGGAGAATGGAGCAGCGGAGGTTTACGCGTGCTGCACTCATCCGGTACTGTCCGGTCCAGCGGTGGAGCGCATCAATAATTCTAAGATCAAGGAATTAGTTGTTACAAACTCAATCAAGTTGCCAGAGGAGAAGAAAATTGAACGTTTCAAGCAATTGAGTGTAGGGCCCTTACTGGCAGAAGCCATCATCCGCGTGCACGAAAAGCAGAGTGTCTCGTACCTGTTTTCG

[0051] SEQ ID NO.3:

[0052] ATGTCAGATGACAGGATAAATTATCTAAAAAACAAGCTGGTGCAGTACCCGGATTTTCCGAAAAAAGGTATCCTGTTCGAAGACATCATGCCGATTTTTCAGGACCCGAGAGCATTCGGCATTCTGATCGACCTGCTGCTTGAGGCCGTTGAAACCGAGTTCAACAACATCGATGTTATTGTGGGTCTGGAGGCGCGTGGTTTTCTGTTCGGCCCTACGTTGGCGCTGCGCGCGAACTGCGCGTTTGTTCCGGTTCGTAAGCCGAATAAGCTGCCGGGTGATCTGGTGGTGGTTTCCTACAATAAAGAGTATAGCACCGACAGCTTCGCGATTCAAAAAGGTACGATCAAACCAGGCCAGCGTGTTCTGATTGTCGATGACATCCTTGCCACCGGCGGTACGGCTCTGGCGGCAGATGAGCTGGTCACCCGTCTGGGTGGTGAATTAGTGGGCCACTTGTTCTTGTTGGAGTTAACCTTTCTGCAAGGTCGTAAGCGCTTGATGGCACCGACCTATACCTTGCTGACTGGCCAAGACGAGGCTCCGGATGGCTCTGAGTTCGCG

[0053] SEQ ID NO.4:

[0054] ATGTCATTTAGGTTCGGACAACACCTAATAAAGCCGAGCGTTGTCTTTCTGAAAACCGAACTGAGCTTCGCCTTGGTTAACCGCAAGCCGGTTGTTCCGGGTCATGTGCTGGTGTGCCCGCTGAGACCTGTTGAACGTTTTCGCGACATGAGCCCGGAGGAGGTTGCAGACTTGTTTCAAGCGGCGCAGCGCGTGGGCACGGTGGTCGAGAAGCACTTCCAAGGTACTTCGCTGACCTTTTCCATGCAGGATGGTCCAGAGGCCGGCCAGACCGTAAAACACGTGCACGTTCATATTCTGCCGCGTAAAGCGGGCGACTTCCATCGTAATGATTCTATCTATGATGCATTGGAAAAGCACGATCGTGAAGACAAAGACTCCCCGGCACTGTGGCGTAGCGAAGAGGAGATGGCTGCTGAAGCGGCGGCGTTACGTGTGTACTTCCAA

[0055] SEQ ID NO.5:

[0056] ATGTCCACTAATATCACCTTCCATGCCTCTGCACTGACTCGTTCGGAACGTACAGAATTACGCAATCAGCGCGGCCTTACAATCTGGCTGACTGGGCTGTCGGCATCGGGTAAGTCAACTTTGGCCGTAGAATTAGAGCACCAACTTGTTCGTGACCGCGGCGTACACGCCTATCGTCTTGATGGAGATAACATTCGTTTCGGACTTAACAAGGACTTAGGTTTCAGCGAGGCGGACCGCAATGAAAACATTCGCCGTATCGCGGAAGTGGCAAAACTTTTCGCCGACTCCAATAGCATCGCAATTACTTCTTTTATTAGTCCATATCGTAAGGATCGCGATACAGCGCGTCAGCTTCACGAGGTAGCGACACCTGGGGAGGAGACCGGGCTGCCGTTTGTTGAGGTTTACGTTGACGTGCCCGTGGAGGTAGCAGAACAACGTGACCCGAAAGGACTTTATAAGAAGGCCCGTGAAGGAGTGATCAAGGAATTTACGGGCATTTCCGCACCTTATGAAGCTCCAGCTAACCCTGAAGTACACGTTAAAAATTACGAATTACCCGTCCAAGATGCTGTGAAACAAATTATTGACTATCTGGATTCTAAGGGCTACCTGCCTGCGAAGAAGGAGCTCGAG

[0057] SEQ ID NO.6:

[0058]

[0059] SEQ ID NO.7:

[0060] ATGTCATTTAGGTTCGGACAAATGCTAATAAAGCCGAGCGTTGTCTTTCTGAAAACCGAACTGAGCTTCGCCTTGGTTAACCGCAAGCCGGTTGTTCCGGGTCATGTGCTGGTGTGCCCGCTGAGACCTGTTGAACGTTTTCGCGACATGAGCCCGGAGGAGGTTGCAGACTTGTTTCAAGCGGCGCAGCGCGTGGGCACGGTGGTCGAGAAGCACTTCCAAGGTACTTCGCTGACCTTTTCCATGCAGGATGGTCCAGAGGCCGGCCAGACCGTAAAACACGTGCACGTTCATATTCTGCCGCGTAAAGCGGGCGACTTCCATCGTAATGATTCTATCTATGATGCAGATGAAAAGCACGATCGTGAAGACAAAGACTCCCCGGCACTGTGGCGTAGCGAAGAGGAGATGGCTGCTGAAGCGGCGGCGTTACGTGTGTACTTCCAA

[0061] SEQ ID NO.8:

[0062] ATGTCCAAACTCGATCTAAACGCCCTGAACGAACTGCCGAAGGTAGATCGCATTCTGGCGCTGCGGGAAACTAACGCCCAACTGGAAAAACTGGACGCTGAAGGCCGCGTAGCCTGGGCGCTGGATAATCTGCCCGGTGAATATGTGCTTTCTTCCAGCTTCGGCATTCAGGCGGCGGTGAGC CTGCATCTGGTGAATCAGATTCGGCCGGATATTCCAGTGATCCTCACCGATACCGGTTATCTGTTTCCGGAAACCTACCGCTTTATTGACGAGTTAACGGACAAACTCAAGCTCAACCTGAAAGTGTACCGTGCTACCGAAAGCGCCGCCTGGCAGGAAGCACGCTACGGCAAACTGTGGGAAC AGGGCGTTGAAGGCATTGAAAAGTACAATGACATCAACAAAGTCGAACCGATGAACCGGGCGCTGAAAGAACTTAACGCGCAAACCTGGTTTGCTGGCCTGCGCCGAACAATCCGGCAGCCGCGCCAATTTACCGGTGCTGGCAATTCAGCGTGGCGTATTTAAAGTGCTGCCGATTATCGA CTGGGATAACCGAACTATTTATCAGTACCTGCAAAAACATGGCCTGAAATATCACCCATTATGGGATGAAGGATATTTATCGGTCGGTGATACCCATACAACCCGTAAATGGGAACCTGGCATGTCGGAAGAAGAAACACGTTTCTTTGGCTTAAAAAGGGAATGTGGATTGCACGAAGGGTAA

[0063] Example 1: Screening of enzymes in the synthetic pathway

[0064] 1. Screening of ribokinase (RBSK):

[0065] (1) Chemically synthesized ribokinase from Escherichia coli (NCBI No. 948260), ribokinase from Saccharomyces cerevisiae (NCBI No. 850402), and ribokinase from human as shown in SEQ ID NO. 1;

[0066] (2) connecting the ribokinase obtained in step (1) to the pET-28a vector to prepare a recombinant vector;

[0067] (3) introducing the prepared recombinant vectors into E. coli BL21 (DE3) strains to prepare recombinant strains;

[0068] The prepared recombinant strains were inoculated into LB liquid culture medium, and cultured at 220 rpm and 37°C for 8-12 h to prepare seed solution;

[0069] The obtained seed solution was inoculated into TB liquid culture medium at an inoculum volume of 2% (v / v) and cultured at 220 rpm and 37°C until the OD 600 = 0.6-0.8, add IPTG to a final concentration of 0.2 mM for induction at 220 rpm and 25°C for 16 h. After centrifugation, collect the cells separately;

[0070] (4) The R5P production was determined by whole-cell reaction of the induced expression bacteria obtained in step (3).

[0071] The reaction conditions are as follows: 10 g / L of the prepared wet bacteria is added to a reaction system of 10 mL of Tris-HCl buffer (50 mM, pH 7.0), wherein the reaction system also contains 1 mM DTT, 1 mM EDTA, 5 mM ATP, 5 mM ribose, and 5 mM MgCl2, and incubated at 37°C for 10 hours. After the reaction is completed, a portion of the conversion liquid is centrifuged at 10,000 rpm for 30 minutes, and the supernatant is filtered through a 0.22 μm microfiltration membrane and then measured by HPLC to detect the R5P content in the reaction liquid after the reaction is completed.

[0072] The results showed that the R5P yield of the recombinant strain expressing ribokinase from Escherichia coli was 3.05 mM;

[0073] The R5P yield of the recombinant strain expressing ribokinase from Saccharomyces cerevisiae was 1.85 mM;

[0074] The R5P yield of the recombinant strain expressing human ribokinase was 3.97 mM.

[0075] 2. Screening of phosphoribosylpyrophosphokinase (PRS):

[0076] (1) Chemically synthesized from: ribose phosphoryl pyrophosphokinase from Escherichia coli (NCBI No.: 945772), ribose phosphoryl pyrophosphokinase from Mycobacterium tuberculosis (NCBI No.: BAH25337), and ribose phosphoryl pyrophosphokinase from Bacillus amyloliquefaciens as shown in SEQ ID NO. 2;

[0077] (2) respectively connecting the phosphoribosyl pyrophosphokinase from different sources obtained in step (1) and the human ribokinase shown in SEQ ID NO.1 to the pET-28a vector to prepare a recombinant vector;

[0078] (3) introducing the prepared recombinant vectors into E. coli BL21 (DE3) strains to prepare recombinant strains;

[0079] The prepared recombinant strains were inoculated into LB liquid culture medium, and cultured at 220 rpm and 37°C for 8-12 h to prepare seed solution;

[0080] The obtained seed solution was inoculated into TB liquid culture medium at an inoculum volume of 2% (v / v) and cultured at 220 rpm and 37°C until the OD 600 = 0.6-0.8, add IPTG to a final concentration of 0.2 mM for induction at 220 rpm and 25°C for 16 h. After centrifugation, collect the cells separately;

[0081] (4) measuring the PRPP production by whole-cell reaction of the induced expression bacteria obtained in step (3);

[0082] The reaction conditions are as follows: 10 g / L of the prepared wet cells are added to a reaction system of 10 mL of Tris-HCl buffer (50 mM, pH 7.0), wherein the reaction system also contains 1 mM DTT, 1 mM EDTA, 5 mM ATP, 5 mM ribose, and 5 mM MgCl2, and the mixture is incubated at 37°C for 10 h. After the reaction is completed, a portion of the conversion solution is centrifuged at 10,000 rpm for 30 min, and the supernatant is filtered through a 0.22 μm microfiltration membrane and then determined by HPLC to determine the PRPP content in the reaction solution after the reaction is completed.

[0083] The results showed that the PRPP yield of the recombinant strain expressing phosphoribosylpyrophosphokinase from Escherichia coli was 2.80 mM;

[0084] The PRPP production of the recombinant strain expressing phosphoribosylpyrophosphokinase from Mycobacterium tuberculosis was 2.92 mM;

[0085] The PRPP production of the recombinant strain expressing phosphoribosylpyrophosphokinase from Bacillus amyloliquefaciens was 3.35 mM;

[0086] 3. Screening of phosphoribosyltransferase (APRT)

[0087] (1) Chemically synthesized from: phosphoribosyltransferase from Arabidopsis thaliana (NCBI No.: 839636), phosphoribosyltransferase from Escherichia coli (NCBI No.: 945113), and phosphoribosyltransferase from Schizosaccharomyces pombe shown in SEQ ID NO. 3;

[0088] (2) respectively connecting the human ribokinase shown in SEQ ID NO.1, the phosphoribosylpyrophosphokinase from Bacillus amyloliquefaciens shown in SEQ ID NO.2, and the phosphoribosyltransferases from different sources obtained in step (1) to the pET-28a vector to prepare a recombinant vector;

[0089] (3) introducing the prepared recombinant vectors into E. coli BL21 (DE3) strains to prepare recombinant strains;

[0090] The prepared recombinant strains were inoculated into LB liquid culture medium, and cultured at 220 rpm and 37°C for 8-12 h to prepare seed solution;

[0091] The obtained seed solution was inoculated into TB liquid culture medium at an inoculum volume of 2% (v / v) and cultured at 220 rpm and 37°C until the OD 600 = 0.6-0.8, add IPTG to a final concentration of 0.2 mM for induction at 220 rpm and 25°C for 16 h. After centrifugation, collect the cells separately;

[0092] (4) measuring AMP production by whole-cell reaction of the induced expression bacteria obtained in step (3);

[0093] The reaction conditions are as follows: 10 g / L of the prepared wet bacteria is added to a reaction system of 10 mL of Tris-HCl buffer (50 mM, pH 7.0), wherein the reaction system also contains 1 mM DTT, 1 mM EDTA, 5 mM ATP, 5 mM ribose, 5 mM MgCl2, and 5 mM adenosine, and incubated at 37°C for 10 h. After the reaction is completed, a portion of the conversion liquid is centrifuged at 10,000 rpm for 30 min, and the supernatant is filtered through a 0.22 μm microfiltration membrane and then measured by HPLC to detect the AMP content in the reaction liquid after the reaction is completed.

[0094] The results showed that the AMP production of the recombinant strain expressing the phosphoribosyltransferase from Arabidopsis thaliana was 0.33 mM;

[0095] The AMP production of the recombinant strain expressing the phosphoribosyltransferase from Escherichia coli was 1.11 mM.

[0096] The AMP production of the recombinant strain expressing phosphoribosyltransferase from Schizosaccharomyces pombe was 1.76 mM;

[0097] 4. Screening of adenosine phosphate kinase (APSK)

[0098] (1) Chemically synthesized adenosine phosphosulfate kinase from Escherichia coli (NCBI No. 947221), adenosine phosphosulfate kinase from Saccharomyces cerevisiae (NCBI No. 853869), and adenosine phosphosulfate kinase from Penicillium chrysogenum as shown in SEQ ID NO. 5;

[0099] (2) respectively connecting the bovine adenine sulfotransferase (APSST*) shown in SEQ ID NO. 7 and the adenosine phosphosulfate kinase from different sources obtained in step (1) to the pET-28a vector to prepare a recombinant vector;

[0100] (3) introducing the prepared recombinant vectors into E. coli BL21 (DE3) strains to prepare recombinant strains;

[0101] The prepared recombinant strains were inoculated into LB liquid culture medium, and cultured at 220 rpm and 37°C for 8-12 h to prepare seed solution;

[0102] The obtained seed solution was inoculated into TB liquid culture medium at an inoculum volume of 2% (v / v) and cultured at 220 rpm and 37°C until the OD 600 = 0.6-0.8, add IPTG to a final concentration of 0.2 mM for induction at 220 rpm and 25°C for 16 h. After centrifugation, collect the cells separately;

[0103] (4) measuring the PAPS production by whole-cell reaction of the induced expression bacteria obtained in step (3);

[0104] The reaction conditions are as follows: 10 g / L of the prepared wet bacteria is added to a reaction system of 10 mL of Tris-HCl buffer (50 mM, pH 7.0), wherein the reaction system also contains 20 mM AMP, 200 mM Na2SO4, 4 mM ATP and 20 mM MgCl2, and incubated at 37°C for 10 hours. After the reaction is completed, a portion of the conversion liquid is centrifuged at 10,000 rpm for 30 minutes, and the supernatant is filtered through a 0.22 μm microfiltration membrane and then determined by HPLC to detect the PAPS content in the reaction liquid after the reaction is completed.

[0105] The results showed that the PAPS yield of the recombinant strain expressing adenosine phosphate sulfate kinase from Escherichia coli was 10.28 mM;

[0106] The PAPS yield of the recombinant strain expressing adenosine phosphosulfate kinase from Saccharomyces cerevisiae was 9.11 mM;

[0107] The PAPS yield of the recombinant strain expressing adenosine phosphosulfate kinase derived from Penicillium chrysogenum was 14.12 mM;

[0108] 5. Screening of polyphosphate kinase 2 (PPK2)

[0109] (1) Chemically synthesized from: polyphosphate kinase 2 from Escherichia coli (NCBI No. 946971) and polyphosphate kinase 2 from spherocytes shown in SEQ ID NO. 6;

[0110] (2) respectively connecting the polyphosphate kinase 2 from different sources obtained in step (1) to a vector to prepare a recombinant vector;

[0111] (3) introducing the prepared recombinant vectors into E. coli BL21 (DE3) strains to prepare recombinant strains;

[0112] The prepared recombinant strains were inoculated into LB liquid culture medium, and cultured at 220 rpm and 37°C for 8-12 h to prepare seed solution;

[0113] The obtained seed solution was inoculated into TB liquid culture medium at an inoculum volume of 2% (v / v) and cultured at 220 rpm and 37°C until the OD 600 = 0.6-0.8, add IPTG to a final concentration of 0.2 mM for induction at 220 rpm and 25°C for 16 h. After centrifugation, collect the cells separately;

[0114] (4) measuring ATP production by whole-cell reaction of the induced expression bacteria obtained in step (3);

[0115] The reaction conditions are as follows: 10 g / L of the prepared wet cells are added to a reaction system of 10 mL of Tris-HCl buffer (50 mM, pH 7.0), wherein the reaction system also contains 20 mM ADP, 20 mM sodium hexapolyphosphate, and 20 mM MgCl2, and incubated at 37°C for 10 h. After the reaction is completed, a portion of the conversion solution is centrifuged at 10,000 rpm for 30 min, and the supernatant is filtered through a 0.22 μm microfiltration membrane and then measured by HPLC to detect the ATP content in the reaction solution after the reaction is completed.

[0116] The results showed that the ATP production of the recombinant strain expressing polyphosphate kinase 2 from Escherichia coli was 12.38 mM;

[0117] The ATP production of the recombinant strain expressing polyphosphokinase 2 from spherical erythrocytes was 18.21 mM;

[0118] Example 2: Construction of a novel biosynthetic pathway for PAPS in vitro

[0119] (1) Vectors expressing pathway enzymes

[0120] Chemically synthesize the sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.7, SEQ ID NO.5, and SEQ ID NO.6 to synthesize RBSK, PRS, APRT, and APSST. * , APSK, PPK2 enzyme encoding genes, and connected to the pET28a vector to prepare recombinant vectors: pET28a-RBSK, pET28a-PRS, pET28a-APRT, pET28a-APSST * , pET28a-APSK, pET28a-PPK2.

[0121] (2) The prepared recombinant vectors were transformed into Escherichia coli BL21 cells, and six pure enzymes were obtained after induced expression and Ni column affinity purification.

[0122] These six pure enzymes (RBSK, PRS, APRT, APSST * , APSK, PPK2 enzyme addition amounts were: 0.01mM, 0.02mM, 0.06mM, 0.1mM, 0.1mM, 0.1mM), ribose (added amount was 5mM), adenosine (added amount was 5mM) were mixed, and 10mL Tris-HCl buffer (50mM, pH 7.5) was added to construct a multi-enzyme cascade system, namely the in vitro PAPS biosynthesis pathway ( Figure 1 ), react at 30°C and 220 rpm for 20 min, and immediately place at 4°C to stop the reaction to obtain a reaction solution;

[0123] (3) The reaction solution was centrifuged at 12,000 rpm for 15 min, the supernatant was frozen and thawed twice at -80°C, 50 μL of the sample was diluted 5-fold and immediately centrifuged at 12,000 rpm for 15 min at 4°C, and the supernatant was detected by ultra-performance liquid chromatography-mass spectrometry (UPLC-MS). PAPS ( Figure 2 ), the molar conversion rate of adenine to PAPS reached 22.85%, confirming the feasibility of this pathway.

[0124] Example 3: Construction of PAPS-producing Escherichia coli engineered bacteria

[0125] The specific steps are as follows:

[0126] (1) The Crispr-Cas9 system was used to perform gene editing on Escherichia coli BL21 (DE3).

[0127] Building APSST * Integration cassette: Primers cysH-F1, cysH-R1, cysH-F2, and cysH-R2 (Table 2) were designed based on the gene cysH (SEQ ID NO. 8) encoding the PAPS degrading enzyme (NP_417242.1). Using the E. coli BL21(DE3) genome as a template, the upstream and downstream homology arms of the cysH gene were amplified using primers cysH-F1 / cysH-R1 and cysH-F2 / cysH-R2, respectively. The PCR system consisted of 1 μL of 50 ng / μL genomic DNA, 1 μL each of 10 μM primers cysH-F1 and cysH-R1, 25 μL of 2× PrimeSTAR MAX Premix, and 2 μL of ddH2O2. PCR conditions included pre-denaturation at 98°C for 5 min, followed by 30 cycles of 98°C for 10 s, 57°C for 15 s, and 72°C for 1 min, and termination at 4°C. The PCR products were verified by 1% agarose gel electrophoresis and purified using a PCR Purification Kit.

[0128] Three copies of APSST were synthesized based on the sequence shown in SEQ ID NO.8 (cysH gene) * Gene fragment.

[0129] Using cysH-F1 / cysH-R2 as primers, the cysH upstream fragment, three copies of the APSST* gene, and the cysH downstream fragment were assembled by fusion PCR to obtain the APSST* gene inserted into the cysH gene locus. * Integration box.

[0130] Construction of pTargetF plasmid: Based on the CRISPR / Cas 9 gene editing principle, Suzhou Jinweizhi Biotechnology Co., Ltd. synthesized a specific guide sgRNA sequence with the target recognition gene cysH and ligated it to the pTargetF plasmid to construct pTargetF-cysH.

[0131] Transformation of pCas9 plasmid: The pCas9 plasmid was electroporated into E. coli BL21 (DE3) cells, spread on LB plates containing 50 mg / L kanamycin, and cultured at 30°C for 24 h. Positive transformants were screened and sequenced to obtain E. coli BL21 (DE3)-pCas9 strains. The cells were cultured in LB medium containing 50 μg / mL kanamycin and 0.01 M arabinose to induce expression of the homologous recombinase, and the cells were collected to prepare electroporation competent cells.

[0132] Gene editing: APSST * The integration cassette and pTargetF-cysH plasmid were co-electroporated into E. coli BL21(DE3)-pCas9 competent cells. After 1 h of recovery, the cells were spread on LB double-resistance plates containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin hydrochloride, cultured at 30°C for 24 h, and positive transformants were selected for colony PCR verification.

[0133] Elimination of the pTargetF plasmid: The positive transformants were transferred to LB medium, and 0.43 mM IPTG was added to induce the expression of the endonuclease on the pCas9 plasmid, which cut pTargetF-cysH. After culturing for 12 h, the transformants were streaked onto LB single-antibody plates containing 50 μg / mL kanamycin and LB double-antibody plates containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin hydrochloride, respectively. The plates were cultured at 30°C for 12 h. The strains with the pTargetF-cysH plasmid eliminated could only grow on the single-antibody plates but not on the double-antibody plates.

[0134] Follow steps (1) to (5) to integrate three copies of APSST into the rph pseudogene locus. * The genes and related primers are shown in Table 2.

[0135] After gene editing, the strain was cultured at 42°C to eliminate the pCas9 plasmid, resulting in knockout of cysH and insertion of six copies of APSST. * The recombinant strain E. coli BL21 (DE3) (ΔcysH, 3APPST * ;Δrph,3APPST * ).

[0136] Table 2 Primers and sequences

[0137]

[0138]

[0139] (2) Construction of pathway enzyme expression vector

[0140] Construction of pET-Duet-RBSK-PRS-APRT vector: The coding genes of RBSK, PRS and APRT enzymes were synthesized according to the sequences shown in SEQ ID NO.1 to 3, and ligated into the pET-Duet vector so that RBSK, PRS and APRT were driven by T7 promoter ( Figure 3 ).

[0141] Construction of pRSF-Duet-APSK-APSST * -PPK2 vector: APSK and APSST were synthesized according to the sequences shown in SEQ ID NO. 5, 7, and 6, respectively. * and PPK2 enzyme encoding genes were connected to the pRSF-Duet vector, so that APSK, APSST * and PPK2 are driven by T7 promoter ( Figure 4 ).

[0142] (3) Construction of recombinant Escherichia coli

[0143] The vectors pET-Duet-RBSK-PRS-APRT and pRSF-Duet-APSK-APSS*-PPK2 were co-transformed into the recombinant strain E. coli BL21 (DE3) (ΔcysH, 3APPST * ;Δrph,3APPST * ) and obtained a recombinant strain carrying two plasmids, named strain E. coli BL21 (DE3) (ΔcysH, 3APPST * ;Δrph,3APPST * )-PAPS, stored in glycerol.

[0144] Example 4: Shake flask fermentation of recombinant Escherichia coli

[0145] The E. coli BL21 (DE3) (ΔcysH, 3APPST) constructed in Example 3 was * ;Δrph,3APPST * Streak the )-PAPS strain on a plate and pick a single colony to inoculate into LB liquid medium containing 100 μg / mL ampicillin and 50 μg / mL kanamycin. Incubate overnight at 37°C, 220 rpm. Transfer 5 mL of the seed solution to a 500 mL shake flask containing 145 mL of TB medium, supplemented with 100 μg / mL ampicillin, 50 μg / mL kanamycin, 10 mg / mL adenosine, 10 mg / mL ribose, and 20 mM sodium sulfate, for a 3% inoculum.

[0146] Fermentation conditions: initial temperature 37°C, rotation speed 220 rpm, OD 600When the pH reached 0.7, 0.1 mg / mL IPTG was added, the induction temperature was 16°C, and the fermentation speed was 200-250 rpm. Fermentation was continued for 35 hours. After the fermentation was completed, the final volume was measured, and the cells were harvested and disrupted by centrifugation. The cell lysate was collected by centrifugation and the PAPS yield was determined by HPLC. E. coli BL21(DE3) was used as a control.

[0147] The results are as follows Figure 5 As shown, the recombinant strain E. coli BL21 (DE3) (ΔcysH, 3APPST * ;Δrph,3APPST * )-PAPS was fermented in shake flasks, and the PAPS yield was 5.08 g / L.

[0148] Example 5: Fermentation of recombinant Escherichia coli in a 5-L fermenter

[0149] The seed solution was prepared as in Example 4. 2.25 L of fermentation medium was prepared and 250 mL of seed solution was injected into the fermenter through the inoculation port at a 10% inoculum volume, maintaining sterility throughout the process, so that the initial liquid volume was 2.5 L. Fermentation conditions: initial speed 400 rpm, initial ventilation volume 1.0 vvm, initial pH 7.0, temperature 37°C; OD 600 When the pH reached 2.5, IPTG (0.4 mM), adenosine (10 mg / mL), ribose (10 mg / mL), and sodium sulfate (20 mM) were added through the feed port. Fermentation was continued for 20 hours. Throughout the fermentation cycle, concentrated ammonia was automatically added to maintain the pH at 7.0. After the fermentation was completed, the final volume was measured, and the cells were harvested and disrupted by centrifugation. The supernatant was collected and the PAPS yield was determined by HPLC. E. coli BL21(DE3) was used as a control.

[0150] The results are as follows Figure 6 As shown, the recombinant strain E. coli BL21 (DE3) (ΔcysH, 3APPST * ;Δrph,3APPST * )-PAPS was fermented in a 5-L tank, and the PAPS yield was 7.60 g / L.

[0151] Example 6: Construction of PAPS-producing Bacillus subtilis engineered bacteria

[0152] The specific steps are the same as those in Example 3. First, Bacillus subtilis 168 was used as the chassis strain to construct a knockout strain of the cysH gene and insert six copies of APSST. * The recombinant strain B. subtilis 168 (ΔcysH, 6APSST *), the primers used are shown in Table 3, and APSST* is inserted into the cysH site. Further, the pTA-RBSK-PRS-APRT vector ( Figure 7 ) and pHT-APSK-APSST-PPK2 vector ( Figure 8 ), and electroporated into B. subtilis 168 (ΔcysH, 6APSST * ) and obtained a recombinant bacterium carrying two plasmids, named strain B. subtilis 168 (ΔcysH, 6APPST * )-PAPS, stored in glycerol.

[0153] Table 3 Primers and sequences

[0154]

[0155] Example 7: Fermentation of recombinant Bacillus subtilis in a 5-L fermenter

[0156] The B. subtilis 168 (ΔcysH, 6APSST) constructed in Example 6 was * )-PAPS strains were streaked onto plates, and single colonies were picked and inoculated into LB liquid medium containing 100 μg / mL chloramphenicol and 50 μg / mL kanamycin. The culture was incubated overnight at 37°C and 220 rpm. Fermentation conditions were: initial speed 400 rpm, initial aeration 1.0 vvm, initial pH 7.0, temperature 37°C; OD 600 When the pH reached 12.5, xylose (0.4 mM), adenosine (10 mg / mL), ribose (10 mg / mL), and sodium sulfate (20 mM) were added through the feed port. Fermentation was continued for 20 hours. Throughout the fermentation cycle, concentrated ammonia was automatically added to maintain the pH at 7.0. After fermentation, the final volume was measured, and cells were harvested and disrupted by centrifugation. The cell lysate was collected by centrifugation, and PAPS production was determined by HPLC. B. subtilis 168 was used as a control.

[0157] The results are as follows Figure 9 As shown, the recombinant strain B. subtilis 168 (ΔcysH, 6APSST * )-PAPS was fermented in a 5-L tank, and the PAPS yield was 5.03 g / L.

[0158] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A novel biosynthetic pathway for producing 3'-adenosine 5'-phosphosulfate, characterized in that: It is composed of the following enzymes: ribokinase, phosphoribosyl pyrophosphokinase, phosphoribosyltransferase, adenine sulfur transferase, adenosine phosphosulfate kinase, and polyphosphate kinase 2.

2. The synthetic route according to claim 1, characterized in that The nucleotide sequence of the gene encoding ribokinase is shown as SEQ ID NO.1; the nucleotide sequence of the gene encoding phosphoribosylpyrophosphokinase is shown as SEQ ID NO.2; the nucleotide sequence of the gene encoding phosphoribosyltransferase is shown as SEQ ID NO.3; the nucleotide sequence of the gene encoding adenine sulfur transferase is shown as SEQ ID NO.4 or SEQ ID NO.7; the nucleotide sequence of the gene encoding adenosine phosphosulfate kinase is shown as SEQ ID NO.5; and the nucleotide sequence of the gene encoding polyphosphate kinase 2 is shown as SEQ ID NO.

6.

3. Use of the synthetic route according to any one of claims 1 to 2 in the production of 3'-adenosine phosphate-5'-phosphosulfate, characterized in that: Specifically, the enzyme in the synthetic route is used as a catalyst, and ribose and adenosine are used as substrates to catalyze the reaction to obtain 3'-adenosine phosphate-5'-phosphosulfate.

4. The use according to claim 3, characterized in that The addition amounts of the enzymes in the synthesis pathway are 0.005-0.015 mM of ribokinase, 0.01-0.03 mM of phosphoribosyl pyrophosphokinase, 0.05-0.07 mM of phosphoribosyltransferase, 0.05-0.15 mM of adenine sulfur transferase, 0.05-0.15 mM of adenosine phosphosulfate kinase and 0.05-0.15 mM of polyphosphate kinase 2; the addition amount of ribose is 1-10 mM and the addition amount of adenosine is 1-10 mM.

5. The use according to claim 3, characterized in that The reaction conditions of the catalytic reaction are 25-35° C., 200-300 rpm, and 10-60 min.

6. A nucleic acid vector, characterized in that The nucleic acid vector comprises coding sequences for the following enzymes: ribokinase, phosphoribosyl pyrophosphokinase, phosphoribosyltransferase, adenine sulfur transferase, adenosine phosphosulfate kinase and polyphosphate kinase 2, wherein the coding sequences for the enzymes are in one, two or more expression frames.

7. An engineered bacterium expressing the synthetic pathway according to any one of claims 1 to 2, characterized in that: The engineered bacteria express the following enzymes: ribokinase, phosphoribosyl pyrophosphokinase, phosphoribosyltransferase, adenine sulfur transferase, adenosine phosphosulfate kinase and polyphosphate kinase 2.

8. The engineered bacteria according to claim 7, characterized in that The host cell of the engineering bacteria is Escherichia coli or Bacillus subtilis.

9. The engineered bacteria according to claim 8, characterized in that When the host of the engineered bacteria is Escherichia coli, it also includes inserting three copies of the gene encoding adenine sulfotransferase as shown in SEQ ID NO.7 into the cysH gene site in the genome, and inserting three copies of the gene encoding adenine sulfotransferase as shown in SEQ ID NO.7 into the rph pseudogene site; when the host of the engineered bacteria is Bacillus subtilis, it also includes inserting six copies of the gene encoding adenine sulfotransferase as shown in SEQ ID NO.7 into the cysH gene site in the genome.

10. Use of the engineered bacteria according to any one of claims 7 to 9 in the fermentation production of 3'-adenosine 5'-phosphosulfate, characterized in that: The application is to use ribose and adenosine as substrates and adopt the engineered bacteria to synthesize 3'-adenosine phosphate-5'-phosphosulfate from scratch.

Images