Neutralizing aptamer targeting b-cell activating factor and its use in the treatment of systemic lupus erythematosus

Abstract

This invention discloses a neutralizing nucleic acid aptamer that targets and inhibits B-cell activating factors and its application in the treatment of systemic lupus erythematosus (SLE). The neutralizing nucleic acid aptamer described in this invention can efficiently inhibit the binding of BAFF to specific receptors on the B-cell membrane, including the BAFF receptor (BAFF-R), human calmotropic cyclin ligand-interacting molecule (TACI), and B-cell maturation antigen (BCMA), thereby reducing the proportion of plasma cells, plasmablasts, and germinal center B cells, ultimately reducing the production and secretion of autoantibodies, thus exhibiting a targeted therapeutic effect on SLE. Compared with existing BAFF-neutralizing biological agents, the neutralizing nucleic acid aptamer of this invention has advantages such as high specificity, high affinity, ease of synthesis, low immunogenicity, low cost, and designability and programmability, making it a potential novel nucleic acid agent for targeted SLE therapy with excellent prospects for clinical translational applications.

Description

Technical Field

[0001] This invention belongs to the field of screening and application technology of neutralizing nucleic acid aptamers, specifically involving neutralizing nucleic acid aptamers that target and inhibit B cell activating factor (BAFF) and their application in the treatment of systemic lupus erythematosus. Background Technology

[0002] Systemic lupus erythematosus (SLE) is a severe autoimmune disease characterized by abnormal B-cell activation and an abnormal increase in autoantibodies, affecting multiple systems and organs. It is estimated that there are over one million SLE patients in my country. Its pathogenesis is unclear and it is difficult to cure, placing a heavy burden on patients' physical and mental health. Currently, there is no specific drug for SLE treatment. Traditional drugs such as glucocorticoids, immunosuppressants, and antimalarial drugs can only control the disease to a limited extent and require long-term use, thus having significant toxic side effects. In recent years, biologics targeting and neutralizing human BAFF, such as Belimumab and Telitacicept, have effectively inhibited the binding of BAFF molecules to specific receptors on B cell membranes, including BAFF receptor (BAFF-R), human calmotropic cyclin ligand interacting molecule (TACI), and B cell maturation antigen (BCMA), thereby inhibiting plasma cell production and autoantibody secretion, showing some therapeutic effect on SLE. However, these biologics are expensive, and their long-term efficacy and safety require further verification, limiting their clinical application. Therefore, there is an urgent need to develop new, safe, effective, and inexpensive targeted therapies for SLE.

[0003] Nucleic acid aptamers are single-stranded DNA or RNA obtained in vitro through SELEX technology. Their biological functions are similar to and superior to antibodies, possessing advantages such as high specificity, high affinity, ease of synthesis, low immunogenicity, low toxicity, and low cost. Neutralizing nucleic acid aptamers, which neutralize target molecules, can effectively inhibit the binding of target molecules to their specific ligands, and thus can be used to treat corresponding diseases. Based on this, this invention aims to screen for neutralizing nucleic acid aptamers of BAFF, which plays a key role in B cell activation, to block the binding of BAFF to BAFF-R, TACI, and BCMA on the B cell membrane, thereby inhibiting plasma cell maturation and autoantibody secretion, ultimately achieving targeted therapy for SLE. This provides a new technology and solution for targeted therapy of SLE, and has significant scientific and clinical value in addressing the major needs in the field of targeted therapy for SLE. Summary of the Invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a neutralizing nucleic acid aptamer that targets and inhibits B cell activating factors.

[0005] Another technical problem that this invention aims to solve is to provide a method for obtaining neutralizing nucleic acid aptamers.

[0006] The final technical problem to be solved by this invention is to provide the application of the neutralizing nucleic acid aptamer that targets and inhibits B cell activating factors in the preparation of drugs for treating SLE.

[0007] Technical solution: In order to solve the above technical problems, the present invention provides a neutralizing nucleic acid aptamer that targets and inhibits BAFF. The nucleotide sequence of the neutralizing nucleic acid aptamer is any one of those shown in SEQ ID NO.1 to SEQ ID NO.4, or has more than 80% identity with any one of those shown in SEQ ID NO.1 to SEQ ID NO.4.

[0008] The neutralizing nucleic acid aptamer further includes phosphorylation, methoxylation, methylation, amination, thiolation, fluorescent molecule modification, fluorination, isotopization, or conjugation with any drug at any position of any of the types shown in SEQ ID NO.1 to SEQ ID NO.4.

[0009] The neutralizing nucleic acid aptamer also includes a biotin conjugate.

[0010] The concentration of the neutralizing nucleic acid aptamer is 0.01~2 µM. Preferably, the concentration of the neutralizing nucleic acid aptamer is 2 µM.

[0011] The present invention also includes a method for obtaining the neutralizing nucleic acid aptamers, which are obtained in vitro through ligand competition-based magnetic bead (MNP) multiple reverse screening SELEX technology (Multiple Reverse Screening Mag-SELEX).

[0012] The present invention also includes the application of the neutralizing nucleic acid aptamer that targets and inhibits B cell activating factors in the preparation of drugs for treating SLE.

[0013] The drug includes drugs that neutralize BAFF and inhibit its binding to BAFF-R, TACI and / or BCMA on the B cell membrane.

[0014] The drugs include those that reduce the proportion of plasmablasts, plasma cells, and biochemical center B cells.

[0015] The drug includes drugs that inhibit the secretion of IgG1, IgG2, IgG3 and / or IgM.

[0016] The drugs include those that alleviate disease progression in humanized SLE mice that overexpress BAFF.

[0017] The drugs include those that reduce urinary protein levels, anti-dsDNA antibody levels, and decrease kidney tissue damage, inflammatory cell infiltration, and IgG and / or C3 complement deposition in humanized SLE mice.

[0018] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0019] (1) The neutralizing nucleic acid aptamers described in this invention are obtained in vitro through Mag-SELEX multiple reverse screening technology with ligand competition. Compared with existing biological agents, they have the advantages of short screening cycle, easy synthesis, high specificity, high affinity, no batch-to-batch variability, low immunogenicity, few side effects, and low cost;

[0020] (2) The neutralizing nucleic acid aptamers described in this invention are designable and programmable, easy to modify and alter, and can be designed and constructed as needed to produce nucleic acid aptamer drugs with different neutralizing abilities and blocking efficiencies;

[0021] (3) The neutralizing nucleic acid aptamer described in this invention can not only neutralize target molecules, but also has a strong drug loading capacity. With precise design, it can achieve precise drug delivery and combined treatment, thereby improving treatment efficiency. Attached Figure Description

[0022] Figure 1 A schematic diagram illustrating the screening of BAFF neutralizing aptamers and the therapeutic principle of SLE using the Mag-SELEX multiple reverse screening technology based on ligand competition.

[0023] Figure 2 DNAMAN software was used to simulate and predict the secondary structure diagram of nucleic acid aptamers;

[0024] Figure 3 The image shows the results of the identification of the binding ability of candidate neutralizing nucleic acid aptamers to BAFF.

[0025] Figure 4 The image shows the results of BAFF neutralizing aptamer modification based on secondary structure and its affinity assay. Among them, Figure 4 In the diagram, A represents the secondary structure of the nucleic acid aptamer before and after modification, as predicted by DNAMAN software simulation. Figure 4 In the figure, B represents the Kd values ​​of the neutralized aptamers before and after modification.

[0026] Figure 5 The diagram shows the molecular docking results of the modified neutralizing nucleic acid aptamer sequence 1a with BAFF.

[0027] Figure 6 Figure showing the characterization results of the neutralizing ability of BAFF to neutralize nucleic acid aptamer sequence 1a;

[0028] Figure 7Figure showing the results of the BAFF neutralizing aptamer sequence 1a assay on the proliferation and cytotoxicity of human PBMC cells;

[0029] Figure 8 The figure shows the results of the assay of the ability of BAFF to neutralize the nucleic acid aptamer sequence 1a to inhibit the secretion of human PBMC antibodies.

[0030] Figure 9 Figure showing the effects of BAFF neutralizing aptamers on body weight, anti-dsDNA antibody levels, and urinary protein levels in SLE mice; Figure 9 Figure A in the figure shows the effect of BAFF neutralizing nucleic acid aptamers on the body weight of SLE mice. Figure 9 Figure B in the figure shows the effect of BAFF neutralizing nucleic acid aptamers on anti-dsDNA antibodies in SLE mice. Figure 9 In the figure, C represents the effect of BAFF neutralizing aptamers on urinary protein levels in SLE mice.

[0031] Figure 10 Figure showing the effect of BAFF neutralizing aptamers on antibody-secreting B cell subtypes in the spleen of SLE mice;

[0032] Figure 11 The figure shows the effect of BAFF neutralizing nucleic acid aptamers on the pathological damage and immune complex deposition in the kidney tissue of SLE mice. The line segments in the figure represent the scale bar at 100 µm. Detailed Implementation

[0033] The following embodiments are provided to better understand the present invention, but are not intended to limit the scope of protection of the invention. Unless otherwise specified, the experimental methods, materials and reagents used in the following embodiments are conventional methods, and the materials and reagents used are commonly available in the laboratory and can be purchased commercially.

[0034] The main reagents and materials used included: Ficoll solution (Cytiva, catalog number 17-1440-03), DPBS (10×) buffer (Gibco, catalog number 14200075), human BAFF protein (Genscript Biotech, catalog number Z02976), human serum albumin (MedChemExpress, catalog number HY-P1956), human IgG (Sangon Biotech (Shanghai) Co., Ltd., catalog number D110501), and carboxyl magnetic beads (MNPs). -COOH (Sangon Biotech (Shanghai) Co., Ltd., catalog number D149007), Streptavidin magnetic beads SA-MNPs (Sangon Biotech (Shanghai) Co., Ltd., catalog number D112005), EDC (Sangon Biotech (Shanghai) Co., Ltd., catalog number C600433), Sulfo-NHS (Shanghai Yuanye Biotechnology Co., Ltd., catalog number S30615), Carboxyl magnetic bead activation buffer (Sangon Biotech (Shanghai) Co., Ltd., catalog number D601030) Carboxylated magnetic bead coupling buffer (Sangon Biotech, catalog number D601031), SLE mice overexpressing human BAFF (B6-hBAFF, Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.), SA-HRP (Sangon Biotech (Shanghai) Co., Ltd., catalog number D111054), bovine serum albumin (BSA) (Sangon Biotech (Shanghai) Co., Ltd., catalog number A600332), salmon sperm DNA (Soleb, D8030), human BAFF-R (nearshore protein, CO2U), human T ACI (nearshore protein, C07R), human BMCA (nearshore protein, CS79), human BAFF ELISA kit (Proteintech, KE00215), mouse anti-dsDNA antibody detection kit (Huamei Biotechnology, CSB-E11194m), urine protein detection kit (Nanjing Jiancheng Bioengineering Institute, C035-2-1), rabbit anti-mouse C3 antibody (Proteintech, catalog number 21337-1-AP), Fluorescein (FITC) conjugated goat anti-mouse IgG antibody (Proteintech, catalog number SA00003-1), CoraLite594 conjugated goat anti-rabbit IgG (Proteintech, catalog number SA00013-4), mouse Fc receptor blocker (BD Biosciences, catalog number 553141). TM(Biolegend, catalog number 423101), CD3 (Biolegend, catalog number 100204), B220 (Biolegend, catalog number 103222), IgD (Biolegend, catalog number 405710), CD138 (Biolegend, catalog number 142523), GL-7 (Biolegend, catalog number 144606), FAS (Biolegend, catalog number 152608), cyclophosphamide CTX (Merck Biotech, catalog number C0768), R848 (MedChemExpress, catalog number HY-13740), 1640 medium (KGI Biotech, catalog number KGL1501), CCK8 kit (Beyotime, catalog number C0038), etc.

[0035] The single-stranded DNA random library, primer sequences, and subsequent nucleic acid aptamer sequences and biotin modifications in the following examples were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0036] Example 1: Screening and Identification of BAFF Neutralizing Aptamers

[0037] (1) Design the following randomized library and primer sequences according to the screening objectives:

[0038] Random Library: AGCAGGTTCACGACCCGATAAGNNNNNNNNNNNNNNNNNNN

[0039] NNNNNNNNNNNNNNNNNNNGAGTTACATACCAATCGTCGCAG SEQ ID NO.7

[0040] Upstream primer: AGCAGGTTCACGACCCGATAAG SEQ ID NO.5

[0041] Downstream primer: Biotin-CTGCGACGATTGGTATGTAACTC SEQ ID NO.6

[0042] (2) Preparation of 2× binding solution: Dilute 10× DPBS buffer to 2× with sterile water, and then add MgCl2 to a final concentration of 10 mM, salmon sperm DNA to a final concentration of 0.2 mg / mL and bovine serum albumin (BSA) to a final concentration of 2 mg / mL.

[0043] (3) Preparation of washing solution: Add 5 mM MgCl2 to 1× DPBS buffer;

[0044] (4) Preparation of magnetically bead-coupled human BAFF protein (BAFF-MNPs): Take 10 mg of MNPs-COOH, wash it 3 times with pre-cooled carboxyl magnetic bead activation buffer, add 1 mL of carboxyl magnetic bead activation buffer containing 5 mg EDC and 5 mg Sulfo-NHS, and incubate at room temperature (20~30 °C) for 20 min by rotation; magnetically separate and discard the supernatant, add 2 mL of carboxyl magnetic bead coupling buffer containing 500 µg human BAFF protein, 5 mg EDC and 5 mg Sulfo-NHS to the activated MNPs-COOH, and incubate at 4 °C for 12 h by rotation; magnetically separate and discard the supernatant, add 1 mL of freshly prepared 2× binding solution, and store at 4 °C for later use.

[0045] The preparation of magnetic bead-conjugated human serum albumin (HSA-MNPs) and magnetic bead-conjugated human immunoglobulin (IgG-MNPs) is the same as that of BAFF-MNPs.

[0046] (5) Utilizing Mag-SELEX technology for multiple reverse screening based on ligand competition ( Figure 1 Using BAFF-MNPs as the target and HSA-MNPs and IgG-MNPs as controls, neutralizing aptamers that can specifically block the binding of BAFF to its ligands were screened. The specific procedure was as follows: a 10 nmoles random library was dissolved in 500 μL of sterile water, heated at 95°C for 10 min and immediately placed on ice for 10 min. Then, 2 mg of BAFF-MNPs dispersed in 500 μL of 2× binding buffer was added, and the mixture was incubated at 37°C for 60 min. After incubation, unbound sequences were discarded, and 200 μL of sterile water was added and boiled in a boiling water bath for 10 min. The supernatant was collected by magnetic separation to obtain the target-bound sequence.

[0047] (6) Preparation of secondary libraries: Using the supernatant collected in (5) as a template, PCR amplification was performed with unlabeled upstream primers and biotin-labeled downstream primers (shown in SEQ ID NO.5 and SEQ ID NO.6) (specific amplification conditions are shown in Table 1). Take 5 mg of streptavidin magnetic beads (SA-MNPs), wash 3 times with PBS buffer (0.01M, pH 7.4, the same below), and then add them to the PCR amplification product. Incubate at room temperature for 60 min by rotation. Magnetic separation was performed to discard the supernatant. The supernatant was washed 3 times with PBS buffer, and 50 μL of 0.2 M NaOH solution was added and incubated at room temperature for 5 min. Magnetic separation was performed to collect the supernatant. 50 μL of 0.2 M HCl solution was added to adjust the pH to 7.0. After desalting with a desalting column, the supernatant was used as the secondary library for the next round of screening.

[0048] Table 1 PCR amplification system

[0049]

[0050] Amplification conditions: 95 °C: 5 min, 95 °C: 30 s, 64 °C: 30 s, 72 °C: 30 s, 72 °C: 5 min, store at 12 °C.

[0051] (7) Reverse screening: Repeat steps (5) and (6) twice. Add 0.5 mL of the secondary library prepared after the third round of screening to an equal volume of 2× binding buffer containing 0.5 mg HSA-MNPs or IgG-MNPs after heating at 95 °C for 10 min and immediately placing it on ice for 10 min. Incubate at 37 °C for 30 min. Magnetic separation is performed, and the supernatant is added to 2 mg BAFF-MNPs. Incubate at 37 °C for another 60 min. Magnetic separation is performed, and the supernatant is discarded. Add 200 μL of sterile water to the BAFF-MNPs and boil in a water bath for 10 min. Magnetic separation is performed, and the supernatant is obtained to obtain the sequence bound to BAFF-MNPs. Repeat step (6) to prepare a new secondary library for the next round of screening.

[0052] (8) Multiple rounds of screening and competitive screening: After repeating (7) 3 times, during the incubation with BAFF-MNPS after the 8th round of reverse screening, 5 μg of BAFF-R, TACI, or BCMA were added sequentially to compete with the nucleic acid aptamers for binding to BAFF-MNPS. Finally, the supernatant was discarded by magnetic separation, and 200 μL of sterile water was added to BAFF-MNPs and boiled in a boiling water bath for 10 min. The supernatant was then magnetically separated to obtain the sequence that binds to BAFF-MNPs. Step (6) was repeated to prepare a new secondary library for the next round of screening.

[0053] To improve the affinity and specificity of nucleic acid aptamers during the screening process, the screening pressure was gradually increased. This included reducing the secondary library (from 10 nmoles to 100 pmoles), the amount of target (2 mg to 200 μg), the amount of control molecule (from 0.5 mg to 2 mg), shortening the positive screening time (from 60 min to 15 min), increasing the reverse screening time (from 30 min to 90 min), and increasing the number of washing cycles (from 3 to 6). After 13 rounds of screening, the enrichment of the secondary library reached a plateau. The products from the last round of screening were selected, amplified by PCR, and then cloned and sequenced. Three candidate nucleic acid aptamer sequences (Sequence 1, Sequence 2, and Sequence 3) capable of binding BAFF were obtained. The secondary structure of the nucleic acid aptamers was simulated and predicted using DNAMAN software. The results are as follows: Figure 2As shown, these three candidate nucleic acid aptamers all have abundant stem-loop structures, which play an important role in determining the higher-order structure, specificity, affinity, and neutralizing ability of nucleic acid aptamers.

[0054] Sequence 1: AGCAGAGTTCACGACCCGATAAGAGGCCACCGCTACTCAA AAGCCATATCAGAGCAGTAGGTCGAGTTACATACCAATCGTCGCAG SEQ ID NO.1

[0055] Sequence 2: AGCAGAGTTCACGACCCGATAAGTCGCTTGATAGGGCTAA AGGTGTTACG GGGTCAAATTATGGAGTTACATACCAATCGTCGCAG SEQ ID NO.2

[0056] Sequence 3: AGCAGAGTTCACGACCCGATAAGAGTTCATGAGACGCGGC AGCCCCTCCGAGCCAGATTCGCCGAGTTACATACCAATCGTCGCAG SEQ ID NO.3

[0057] (9) Identification of nucleic acid aptamers: The three candidate neutralizing nucleic acid aptamers modified with biotin synthesized by Sangon Biotech and a randomized library (control) were prepared to a working concentration of 100 nM using 1× binding buffer. 100 µL of each aptamer was added to each well of a 96-well plate coated with BAFF, HSA, or IgG, and incubated at 37°C for 60 min. The plates were washed three times with washing buffer. 100 µL of horseradish peroxidase-conjugated streptavidin (SA-HRP) solution was added to each well and incubated at 37°C for 60 min. The plates were then washed six times with washing buffer, and 100 µL of TMB chromogenic substrate was added. The plates were incubated at 37°C for 10 min, and 50 µL of stop buffer was added. The absorbance of each well at 450 nm was measured using a microplate reader to identify the specificity of the three nucleic acid aptamers binding to BAFF. Results are as follows: Figure 3 As shown, compared with the control randomized library group, among these three neutralizing aptamers, sequence 1 has a stronger binding ability to BAFF and a weaker binding ability to HSA and IgG, indicating that sequence 1 has the strongest specificity.

[0058] Example 2: Modification, optimization, and affinity determination of BAFF neutralizing aptamers

[0059] Based on the secondary structure of the aforementioned neutralizing aptamer sequence 1, the aptamer's structure was modified by removing redundant sequences that could not effectively form a core stem-loop structure, thereby improving its affinity and neutralizing ability. For example... Figure 4As shown in Figure A, the modified neutralizing aptamer sequence 1a retains the core structure of the original sequence, but its length has been shortened from 86 bp to 47 bp, resulting in a shorter sequence and smaller structure. Furthermore, the affinity between the original neutralizing aptamer sequence 1a and the modified neutralizing aptamer sequence 1a was determined using aptamer-based ELISA technology. Specifically, human BAFF protein was dissolved in PBS buffer (0.01 M, pH=7.4) to a concentration of 10 µg / mL, and then added to 100 µL per well of a 96-well microplate, incubated overnight at 4°C. After washing three times, 100 µL of different concentrations of biotin-conjugated neutralizing nucleic acid aptamers (0 nM, 1 nM, 5 nM, 10 nM, 30 nM, 50 nM, 80 nM, 100 nM, 200 nM, 300 nM, 500 nM) were added to each group (3 replicates per group). After incubation at 37°C for 60 min, the wells were washed three times with washing buffer, and 100 µL of SA-HRP was added. The reaction was carried out at 37°C for 60 min, and the wells were washed six times with washing buffer. Then, 100 µL of the chromogenic substrate TMB solution was added, and the reaction was carried out at 37°C for 10 min. Finally, 50 µL of stop solution was added, and the absorbance of each well at a wavelength of 450 nm was measured using a microplate reader. The difference between the average absorbance of each group and the average absorbance of the blank control group was plotted on the ordinate, and the concentration of the neutralizing aptamer was plotted on the abscissa. The Kd value of the neutralizing aptamer was calculated using the aptamer affinity formula Y = BmaxX / (Kd + X) fitted to a curve. Y: relative average absorbance; Bmax: maximum absorbance; X: concentration of the neutralizing aptamer; Kd: dissociation constant (the smaller the value, the greater the affinity, and vice versa). Results are as follows: Figure 4 As shown in Figure B, after structural modification, the Kd value of the neutralizing aptamer decreased from 27.53 ± 7.7 nM in the original sequence to 8.14 ± 2.0 nM, indicating that the modified neutralizing aptamer sequence 1a has a higher affinity than sequence 1. Finally, the tertiary structure of sequence 1a was simulated using 3dRNA / DNA software, and sequence 1a was molecularly docked with the BAFF protein using HDOCK software. The molecular docking results are shown in Figure B. Figure 5 As shown, the neutralizing nucleic acid aptamer sequence 1a binds to the BAFF protein through the formation of salt bridges, electrostatic interactions, hydrogen bonds, and C-H bonds, and its docking score reaches -364.27, indicating strong affinity.

[0060] Sequence 1a: CGACCCGATAAGAGGCTACTCAAAAGCCATATCAGAGCAG TAGGTCG SEQ ID NO.4

[0061] Example 3: Determination of the neutralizing capacity of BAFF neutralizing aptamers

[0062] The ability of the optimized neutralizing aptamer sequence 1a to neutralize BAFF was investigated using a human BAFF ELISA kit. 100 µL of sequence 1a at different concentrations (0 nM, 10 nM, 100 nM, 500 nM) was mixed with 100 ng / mL BAFF protein solution and added to 96-well microplates coated with BAFF-R, TACI, or BCMA, and incubated at 37°C for 60 min. After washing three times with washing buffer, 100 µL of biotin-conjugated BAFF antibody from the human BAFF ELISA kit was added, and incubation was continued at 37°C for 60 min. After washing three times with washing buffer, 100 µL of SA-HRP was added, and incubation was continued at 37°C for another 60 min. Then, wash six times with washing buffer, add 100 µL of TMB chromogenic solution, and incubate at 37°C for 10 min. Afterward, add 50 µL of stop solution to each well, and measure the absorbance of each well at 450 nm using a microplate reader. Results are as follows: Figure 6 As shown, the absorbance values ​​of each well gradually decreased as the concentration of the neutralizing nucleic acid aptamer sequence 1a increased. When the concentration reached 500 nM, the absorbance value no longer decreased, indicating that the neutralizing nucleic acid aptamer sequence 1a can block the binding of BAFF to its specific ligands BAFF-R, TACI and BCMA.

[0063] Example 4: Investigation of the proliferation and toxicity of BAFF neutralizing aptamers on human peripheral blood mononuclear cells (PBMCs)

[0064] (1) Isolation of PBMCs from healthy individuals: Mix 1 mL of 2.5 U / mL heparin sodium solution with 12.5 mL of whole blood and 11.5 mL of PBS, and then slowly add 7.5 mL of Ficoll solution along the tube wall. Centrifuge at 18°C, 600 g for 30 min, and carefully aspirate the middle layer of liquid, which is PBMC. Wash the PBMC once with 15 mL of PBS solution, and finally centrifuge at 4°C, 500 g for 10 min, collect the precipitate, resuspend it in freshly prepared 1640 complete culture medium, and count the precipitate.

[0065] (2) CCK8 assay: The PBMCs obtained above were added to 96-well cell culture plates, 5 × 10⁶ cells per well. 5Cells were stimulated with 1 μg / mL R848 and cultured at 37°C and 5% CO2 for 24 h. Then, 0 μM, 0.1 μM, 0.5 μM, 1 μM, 2 μM, and 4 μM of neutralizing aptamer sequence 1a were added to each well, and the cells were cultured at 37°C and 5% CO2 for 24 h. Subsequently, 10 μL of CCK8 reagent was added to each well, and the cells were cultured for another 4 h. The absorbance at 450 nm was measured using a microplate reader. The results are as follows: Figure 7 As shown, the cell viability of the experimental group and the control group was comparable, with no significant difference, indicating that the neutralizing nucleic acid aptamer sequence 1a has low toxicity and good biosafety to PBMC cells.

[0066] Example 5: Determination of the ability of BAFF neutralizing aptamers to inhibit the secretion of human PBMC antibodies

[0067] Isolate healthy human PBMCs (same as step (1) in Example 4) and add them to 24-well cell culture plates, 2 × 10⁶ per well. 6 Cells were simultaneously stimulated with 1 μg / mL R848. Neutralizing aptamer sequence 1a was added to each experimental group at concentrations of 0 μM (control), 0.5 μM, 1 μM, and 2 μM, respectively. Cells were cultured at 37°C and 5% CO2 for 5 days, and the cell culture supernatant was collected. The concentrations of IgG1, IgG2, IgG3, and IgM in the supernatant of each group were detected using ELISA. Results are as follows: Figure 8 As shown, compared with the control group, the neutralizing aptamer effectively inhibited the secretion of IgG1, IgG2, IgG3, and IgM in PBMCs, and its ability to inhibit the secretion of these antibodies gradually increased with increasing dosage. When the dosage reached 2 μM, the secretion of all four types of antibodies showed significant differences. These results indicate that the neutralizing aptamer sequence 1a can significantly inhibit the secretion of IgG1, IgG2, IgG3, and IgM in human PBMCs in vitro.

[0068] Example 6: Evaluation of the therapeutic effect of BAFF neutralizing aptamers on humanized SLE mice

[0069] Humanized SLE mice (6-8 weeks old, female, approximately 20g, 15 mice in total) expressing human BAFF were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. The mice were divided into three groups of five mice each. Each group received a tail vein injection of PBS, cyclophosphamide (CTX), and neutralizing aptamer sequence 1a, respectively. Treatment began at 11 weeks of age, with a frequency of once daily at 2.5 µmoles. Changes in body weight, urinary protein, and blood anti-dsDNA antibodies were monitored regularly. From week 10 to week 20 of continuous treatment, the mice were euthanized under anesthesia by cervical dislocation. Spleens were collected to detect B-cell subtypes. Kidneys from both sides were collected for HE staining and immunofluorescence staining to detect histopathological changes and the deposition of IgG and C3 complement. Specific procedures are as follows:

[0070] (1) Mouse weight monitoring: Starting from the day of drug administration, the weight of mice in each group was measured every two weeks. The results are as follows: Figure 9 As shown in Figure A, the weight of mice treated with neutralizing aptamer sequence 1a did not change significantly compared to those treated with PBS and CTX, indicating that neutralizing aptamer sequence 1a has little effect on the weight of mice and has good safety.

[0071] (2) Anti-dsDNA antibody detection: The mouse anti-dsDNA antibody detection kit was used according to the instructions. First, 100 µL of mouse whole blood was collected and centrifuged at 10,000 rpm for 10 min, and the supernatant was collected. Then, the serum and standard were diluted with sample diluent at a volume ratio of 1:20, and then added to the microplate, 100 µL per well, and incubated at 37°C for 120 min. After removing the liquid, 100 µL of biotin-labeled conjugate was added to each well and incubated at 37°C for 60 min. After removing the liquid, the wells were washed 3 times with washing buffer, and 100 µL of SA-HRP solution was added to each well and incubated at 37°C for 60 min, followed by washing 6 times with washing buffer. After removing the liquid, 90 µL of TMB solution was added to each well and the wells were developed at 37°C for 10-20 min. Then, 50 µL of stop solution was added to each well, and the absorbance at 450 nm was measured using a microplate reader. The results are as follows. Figure 9 As shown in Figure B, with increasing age, the concentration of anti-dsDNA antibodies in the CTX-treated group remained at a low level; the concentrations of anti-dsDNA antibodies in both the PBS and neutralizing aptamer sequence 1a-treated groups showed a gradual increasing trend, but the rate of increase and concentration of anti-dsDNA antibodies in the neutralizing aptamer sequence 1a-treated group were significantly lower than those in the PBS-treated group. These results indicate that neutralizing aptamer sequence 1a can reduce the level of anti-dsDNA antibodies in SLE mice to a certain extent.

[0072] (3) Urine protein detection: The urine protein content of mice was detected according to the instructions of the urine protein detection kit. First, Coomassie Brilliant Blue working solution was diluted at a volume ratio of 1:4. Then, 5 µL each of pure water, urine protein standard, and urine from each group of mice were added to 96-well plates. 300 µL of the prepared Coomassie Brilliant Blue working solution was added to each well, and after standing for 5 min, the absorbance value of each well was measured at 595 nm using a microplate reader. Finally, the urine protein content was calculated according to the formula: Urine protein concentration = (Measured OD - Blank OD) × Standard concentration (52.4 mg / dL) / (Standard OD - Blank OD). The results are as follows. Figure 9 As shown in Figure C, with increasing age, the urinary protein levels in the CTX-treated group remained at a low level; the urinary protein levels in both the PBS and neutralizing aptamer sequence 1a-treated groups showed a gradual increasing trend, but the rate of increase and concentration of urinary protein in the neutralizing aptamer sequence 1a-treated group were significantly lower than those in the PBS-treated group, with a P-value of 0.0523 at the treatment endpoint. These results indicate that neutralizing aptamer sequence 1a can reduce urinary protein levels in SLE mice to a certain extent.

[0073] (4) Flow cytometry detection of B cells: Spleens from the mice in each group were placed in a 6-well cell culture plate. 1 mL of erythrocyte lysis buffer was added, and the spleen was gently ground to prepare a single-cell suspension. Lysis continued for 3-5 min until the solution became clear. 20 mL of PBS was added to stop the lysis. Tissue debris was removed by filtering through a 70 µm cell filter. The spleen cells were centrifuged at 4°C and 600 g for 5 min to obtain a single-cell suspension. The cells were resuspended in complete cell culture medium and counted. 1 × 10⁻⁶ cells were collected. 6 Cells were added to flow cytometry tubes, washed once with PBS, and 50 µL of 0.1% BSA solution containing 0.5 µL of mouse Fc receptor blocker was added to each tube. The tubes were incubated at room temperature for 20 min to block the Fc receptor. Then, cells containing Zombie Aqua were added... TM A 50 µL solution of 0.1% BSA was added to a mixture of CD3, B220, IgD, CD138, GL-7, and FAS. The mixture was incubated at room temperature for 60 min, washed three times with PBS, and resuspended in 200 µL of PBS in each tube before flow cytometry analysis. Results are as follows: Figure 10 As shown, compared with the control PBS treatment group, the proportions of plasma cells, plasmablasts, and biochemical center B cells in the spleen of BAFF humanized SLE mice treated with neutralizing nucleic acid aptamer sequence 1a were significantly reduced, indicating that neutralizing nucleic acid aptamer sequence 1a can inhibit the production of plasma cells, plasmablasts, and biochemical center B cells.

[0074] (5) HE staining of kidney tissue: Freshly collected kidneys from each group of mice were placed in 2 mL centrifuge tubes, filled with 4% paraformaldehyde solution, and fixed for 24 h. After dehydration and clearing, paraffin-embedded tissue was prepared. Then, 5 µm tissue sections were cut using a microtome and fixed onto tissue slides. Before staining, the tissue sections were baked in a 60℃ oven for 2 h, dewaxed using conventional xylene, and then treated sequentially with ethanol and ultrapure water at increasingly lower concentrations. Hematoxylin staining was then added for 10 min, followed by rinsing with running water and sequentially treated with 0.7% hydrochloric acid ethanol (10 s), running water (1 min), 95% ethanol (30 s), and running water (1 min). Then, the tissue was soaked in eosin staining solution for 3-5 min, rinsed with running water, and then treated with ethanol and xylene at increasingly higher concentrations until the tissue was dehydrated and cleared, with each step taking 1 min. Finally, the slides were mounted with neutral resin and observed and photographed under a microscope. The results are as follows: Figure 11 As shown, the pathological damage and inflammatory cell infiltration in the kidney tissue of BAFF humanized SLE mice treated with neutralized nucleic acid aptamer sequence 1a were significantly reduced compared with the PBS-treated group, indicating that neutralized nucleic acid aptamer sequence 1a can significantly reduce the pathological damage and inflammatory cell infiltration in the kidney tissue of SLE mice.

[0075] (6) Immunofluorescence detection of kidney tissue: Freshly collected kidneys from the other side of each group of mice were rapidly frozen in liquid nitrogen and then embedded in OCT embedding medium. 5 µm tissue sections were cut using a cryostat and fixed onto absorbent tissue slides. The slides were dried at room temperature for 30 min, and then washed three times with PBS for 5 min each time to remove the OCT embedding medium. 100 µL of blocking solution was added to the tissue and placed in a light-protected humidified chamber. The tissue was incubated at 37°C for 60 min, washed once with PBS, and the liquid was shaken off. 100 µL of Fluorescein (FITC) conjugated with goat anti-mouse IgG antibody or rabbit anti-mouse C3 antibody was added to the tissue and incubated at 37°C for 60 min. The tissue was then shaken off and washed three times with PBS. For the IgG detection group, after washing, an appropriate amount of mounting medium containing DAPI was added for mounting, and the slides were ready for fluorescence microscopy observation and image acquisition. For the C3 detection group, after washing, the corresponding CoraLite594-conjugated goat anti-rabbit IgG was added, and the mixture was incubated at 37°C for 60 min, followed by washing three times with PBS. A suitable amount of mounting medium containing DAPI was added for mounting, and the slides were observed and images acquired under a fluorescence microscope. Results are as follows: Figure 11 As shown, the deposition of IgG antibodies and C3 complement in the kidney tissue of BAFF humanized SLE mice treated with neutralizing nucleic acid aptamer sequence 1a was significantly reduced compared with the PBS-treated group, indicating that neutralizing nucleic acid aptamer sequence 1a can reduce the deposition of immune complexes in the kidney tissue of SLE mice to a certain extent.

Claims

1. A neutralizing nucleic acid aptamer that targets and inhibits B cell activating factors, characterized in that, The nucleotide sequence of the neutralizing nucleic acid aptamer is shown in SEQ ID NO.1 or SEQ ID NO.

4.

2. The neutralizing nucleic acid aptamer according to claim 1, characterized in that, The neutralizing nucleic acid aptamer also includes conjugation with biotin.

3. The use of the neutralizing nucleic acid aptamer targeting and inhibiting B cell activating factor as described in any one of claims 1 to 2 in the preparation of a medicament for treating systemic lupus erythematosus.

4. The application according to claim 3, characterized in that, The concentration of the neutralizing nucleic acid aptamer is 0.01~2 µM.

5. The application according to claim 3, characterized in that, The neutralizing nucleic acid aptamer can neutralize BAFF and inhibit its binding to BAFF-R, TACI, and / or BCMA on the B cell membrane.

6. The application according to claim 3, characterized in that, The neutralizing nucleic acid aptamer can reduce the proportion of plasmablasts, plasma cells, and / or biochemical center B cells.

7. The application according to claim 3, characterized in that, The neutralizing nucleic acid aptamer can inhibit the secretion of IgG1, IgG2, IgG3 and / or IgM.

8. The application according to claim 3, characterized in that, The neutralizing aptamer can alleviate disease progression in humanized SLE mice overexpressing BAFF.

9. The application according to claim 3, characterized in that, The neutralizing nucleic acid aptamer can reduce urinary protein levels, anti-dsDNA antibody levels, and decrease kidney tissue damage, inflammatory cell infiltration, and IgG and / or C3 complement deposition in humanized SLE mice.

Images