Primer of KLHL14 gene molecular marker related to pig weak litter number character and application of primer

Abstract

The invention relates to a primer of a KLHL14 gene molecular marker related to pig weak litter number character and application of the primer, and belongs to the technical field of biology. The KLHL14 gene molecular marker is located at the 116519104 base of chromosome 6 of a pig reference genome Sscrofa11.1 version, the base is mutated into C or T, and the genotypes are C / C, C / T and T / T. According to the present invention, the forward and reverse primer pair is used to amplify the fragment containing the molecular marker site, and the amplification product is subjected to Sanger sequencing so as to rapidly and accurately identify the genotype of the individual; the molecular marker can be used as a genetic marker for pig breeding to breed pigs with less weak piglets; the method can efficiently and accurately detect the character of the number of the weak piglets of the pigs, improves the survival rate of healthy piglets of a swinery, and has an important value for breeding and production of the pigs.

Description

Technical Field

[0001] The invention relates to a primer for a KLHL14 gene molecular marker related to the piglet weakness trait and application thereof, belonging to the field of biotechnology. Background Art

[0002] Weak piglets, a key indicator of sow reproductive efficiency, are directly related to piglet survival and subsequent pork production costs, making them an essential component of sow breeding. Weak piglets typically refer to piglets born weighing less than 1 kg, excluding genetic defects. Their presence is closely related to a variety of factors, including but not limited to parity, litter size, farrowing interval, assisted delivery methods, number of effective teats, quality of piglet care, and environmental stress.

[0003] Studies have revealed that sows exhibit optimal reproductive performance between parities 3 and 7, while sows with parities 1 to 2 and those with parities 8 and above have relatively weaker disease resistance. While the number of piglets per litter increases with parity, the proportion of weak piglets and stillbirths also increases, a phenomenon particularly pronounced in sows with parities 6 and above. Due to uterine volume limitations in first-born sows, when the number of fetuses exceeds a certain threshold (e.g., more than 12), some fetuses develop poorly due to insufficient space and nutrition, leading to an increase in the number of weak piglets. Furthermore, factors such as prolonged labor, physical injury during delivery, an insufficient number of effective teats, improper lactation management, and environmental stress can all contribute to weak piglets. Summary of the Invention

[0004] The purpose of the present invention is to address the defects of the existing technology and propose a primer for the KLHL14 gene molecular marker related to the weak piglet trait and its application, which can quickly and accurately screen the weak piglet number in multiple periods of pigs. The KLHL14 gene is a gene associated with the retinol transport function, and its role in the reproductive system is particularly prominent. Studies have shown that KLHL14 plays a key regulatory role in the proliferation, migration and apoptosis of endometrial epithelial cells and stromal cells, thereby affecting the implantation process of the embryo and is closely related to the pig's litter size. In addition, KLHL14 is also involved in the regulation of sperm quality and boar fertility traits, and can affect the morphological structure of the testicles and the sperm production process. These findings suggest that the KLHL14 gene may have a profound intrinsic connection with the formation of weak piglet number.

[0005] Given that weak piglets face a higher risk of mortality due to their frail constitution, this not only wastes sow reproductive and feed resources but also exacerbates the spread of disease on pig farms, damaging the overall economic benefits of the farm. Therefore, using advanced molecular marker technology to accurately identify genotypes associated with the KLHL14 gene and applying this technology in early breeding selection is expected to shorten breeding cycles, reduce feeding costs, improve resource utilization efficiency, and provide strong support for the sustainable development of the pig industry.

[0006] The present invention counted the number of weak piglets in pigs, performed genome-wide SNP genotyping using second-generation sequencing technology, and screened the KLHL14 gene molecular marker significantly associated with the weak piglet trait through genome-wide association analysis, providing new gene and molecular marker resources for the selection and breeding of healthy piglet trait.

[0007] The present invention solves the technical problem through the following technical solution: first, a KLHL14 gene molecular marker related to the number of weak piglets is provided, the molecular marker is located at base 116519104 of pig chromosome 6, the base mutates to C or T, the sequence is shown as base 312 as shown in SEQ ID NO:3 or SEQ ID NO:4, and the nucleotide sequence of the pig DNA specific primer pair required for molecular marker detection is shown as shown in SEQ ID NO:1 and SEQ ID NO:2.

[0008] The present invention further provides an application of a KLHL14 gene molecular marker associated with piglet weakness, including a method for detecting SNP genotypes associated with piglet weakness. Specifically, the method is applied to a method for detecting SNP genotypes associated with piglet weakness using PCR amplification combined with Sanger sequencing, comprising the following steps: The first step is to provide a pig DNA sample to be tested, and perform PCR amplification using a DNA-specific primer pair designed for the KLHL14 gene molecular marker to obtain an amplified product, wherein the pig DNA sample to be tested contains the SNP molecular marker at base 116519104 of porcine chromosome 6; Step 2: Sanger sequencing of the PCR product; The third step is to determine the SNP molecular marker genotype at base 116519104 of pig chromosome 6 based on the sequencing results of the second step.

[0009] Wherein, the deoxyribonucleotide sequence of the DNA specific primer pair described in the first step is: Upstream primer: 5'-AGCCAAAATAAGTGCTTGCCT-3' (SEQ ID NO: 1) Downstream primer: 5'- GGTGGACGGAATGAAACTGG -3' (SEQ ID NO: 2) The amplified product in the first step is 630 bp in length, including the 116519104th base on porcine chromosome 6.

[0010] The final concentration of the reaction system (25 μl) is: 50 ng of pig DNA to be tested 2 x Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl.

[0011] The reaction conditions of the PCR amplification are as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 4°C.

[0012] In the third step, the judgment standard is that the number of weak piglets in each period of the T / T genotype pigs with SNP sites is lower than that of the C / T and C / C genotype individuals, and the number of weak piglets in each period of the C / T genotype pigs is lower than that of the C / C genotype individuals.

[0013] The present invention discovered that at a specific locus on the KLHL14 gene, pigs with a specific genotype have significantly lower numbers of weak piglets than those with other genotypes. Specifically, pigs with the T / T genotype have fewer weak piglets at all stages of development than those with the C / T and C / C genotypes, while pigs with the C / T genotype have fewer weak piglets at all stages of development than those with the C / C genotype. This discovery provides new genetic markers and selection tools for pig breeding and production.

[0014] To rapidly and accurately identify weak piglets, the present invention uses genomic DNA from the pig being tested as a template and performs PCR amplification using specific primers. These primers are designed based on a single nucleotide polymorphism (SNP) site in the KLHL14 gene associated with the target trait and accurately amplify a DNA fragment containing that SNP. The PCR amplification product is then subjected to Sanger sequencing, and the SNP molecular marker genotype of the pig KLHL14 gene can be determined based on the sequencing results.

[0015] In breeding, according to the breeding goals, breeders can eliminate individuals with C / T and C / C genotypes and retain individuals with T / T genotypes. The beneficial effect is that this molecular marker can be used as a genetic marker for pig breeding, thereby breeding pigs with a large number of healthy piglets. This method can not only efficiently and quickly identify the weak piglet trait in pigs, but also significantly improve the survival rate of healthy piglets in the pig herd, providing a scientific basis for early pig breeding, and is of great value to pig breeding. In addition, the detection method disclosed in the present invention is simple and easy to operate, and can be widely carried out under laboratory conditions, providing great convenience for pig breeding and production practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the Manhattan plot of the longitudinal trait association analysis of the number of weak piglets in four periods.

[0017] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION

[0018] The following examples are applicable to pig breeding.

[0019] Example 1 In this example, 500 Large White pigs were tested for piglet weakness. Whole-genome SNP genotyping was performed using second-generation sequencing technology. A genome-wide association analysis was performed to screen for KLHL14 gene molecular markers that were significantly associated with piglet weakness. The results were as follows: Figure 1 shown.

[0020] In this example, the following experiments were conducted to identify and apply the KLHL14 gene molecular marker associated with weak piglet numbers.

[0021] 1. Phenotypic and genotypic testing (1) Experimental materials and weak offspring phenotype determination 500 Large White pigs were selected as experimental animals and raised under the same feeding conditions with free access to food and water throughout the whole process. The number of weak piglets in the 500 pigs was recorded as the phenotypic data of the number of weak piglets.

[0022] (2) Extraction of genomic DNA ① Place 25 mg of left and right ear tissue into a centrifuge tube, add it to a 1.5 ml centrifuge tube, add 400 µl of Buffer Digestion, and vortex to mix. Incubate at 65°C in a water bath for 1 hour until the cells are completely lysed.

[0023] ② Add 20 μL of Proteinase K solution, shake to mix, and place in a 56°C water bath for overnight digestion.

[0024] ③ Add 200 µl of Buffer PA, mix thoroughly by inversion, and place in a -20°C refrigerator for 5 min.

[0025] ④ Centrifuge at 10,000 rpm for 5 min at room temperature and transfer the supernatant (500-550 µl) to a new 1.5 ml centrifuge tube.

[0026] ⑤ Add an equal volume of isopropanol, invert 5-8 times to mix thoroughly, and let stand at room temperature for 2-3 minutes. Centrifuge at 10,000 rpm for 5 minutes at room temperature and discard the supernatant.

[0027] ⑥Add 1 ml of 75% ethanol, rinse by inversion for 1-3 minutes, centrifuge at 10,000 rpm for 2 minutes, and discard the supernatant.

[0028] ⑦Repeat step 6.

[0029] ⑧ Open the lid and invert at room temperature for 5-10 minutes to allow any residual ethanol to evaporate. ⑨ Dissolve the resulting DNA in 50-100 µl of TEBuffer. The extracted DNA can be used immediately for the next step or stored at -20°C.

[0030] ⑩ Determine the concentration. After checking the mass and concentration using a spectrophotometer, dilute the sample to 50 ng / μL and store at -20°C for later use.

[0031] (3) PCR amplification The fragment containing the 116519104th base of chromosome 6 was amplified using the genomic DNA extracted as a template.

[0032] Upstream primer: 5'-AGCCAAAATAAGTGCTTGCCT-3' (SEQ ID NO: 1) Downstream primer: 5'- GGTGGACGGAATGAAACTGG -3' (SEQ ID NO: 2) The final concentration of the reaction system (25 μl) is: DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl.

[0033] The PCR amplification reaction conditions were: 94°C pre-denaturation for 5 minutes; 30 cycles of 94°C denaturation for 30 seconds, 55°C annealing for 30 seconds, and 72°C extension for 60 seconds; 72°C extension for 2 minutes; and storage at 4°C. A 10 μl sample was used for agarose gel analysis, yielding a single target band of 630 bp in length. This amplified product contained the SNP marker at base 116519104 on porcine chromosome 6.

[0034] The amplified product sequence is shown in SEQ ID NO: 3 GTTGACATCATTATTCATTTCTTTAATGTGTGTGGTAACTTCAGAGTAATCCTATCTGCAGGAGAGCCAAAATAAGTGCTTGCCTAAGGGTACTGCTAATTTACACAGAGTGGATTTTATTTGGTCAACATGTTTTTTACTTGGTTAACTATGATTA TCTAACGAGAAACCCCTAGCAAGAGGCATGAGATGCAAATGTTATTGTGATTTAAAAAAAAAAAAAAAGACCTTTCAAATGATTTCCTCCAATTGCATACAAGCGATCATTCATTACAGCCAAAGTGTGGATGGCACGTTTTGTGTTCATATCTTG TTTTCGAGCCCAGACATCCATGACGGGGTCATAGCAATAGAGCCATGGGACATATTCTCCATTGTGTACACCCCCTGTGAGTTAAACATAGACATACAAGTCAAGAAAGTGCTTGGGAACTGAATTTTGTAACAGAAAGCAGAGGAATGACTTGCCT GAAATGTATATTTTCCCATTGTGCACTGCTCCCGCATGAGCTGCCAGAGGCTGGGGCAAAGAGGACACGTAACGCCATTCATTTGTTTCTAGGTTATAGCACTCCACGCTGGACAAGTAGCCAGTTTCATTCCGTCCACCAATAACGTATAAGTGTTT Or shown in SEQ ID NO: 4 .

[0035] (4) Sanger sequencing and genotyping The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peaks of different genotypes were obtained as shown in the following figure. Figure 2 shown.

[0036] (5) Pig genome 60K SNP chip genotyping and genome-wide association analysis Pig genome-wide genotyping was performed according to the company's standard procedures. SNP genotyping was performed on individual pigs with a history of low litter size using the "Zhongxin No. 1" pig 50K SNP chip. Quality control was performed on all SNP marker test results. Genome-wide association analysis revealed that significant SNPs were concentrated on porcine chromosome 6.

[0037] 2. Correlation Analysis Five hundred Large White pigs with clear records of the weak litter size phenotype were selected, and 500 of these pigs were recorded for weak litter size. Statistical tests were performed using the ANOVA function in R 4.2 statistical plotting software, using a pairwise mean comparison model to compare the genotypes and the weak litter size trait. P < 0.05 indicated significant differences. The results showed that the mean number of weak litters in individuals with the T / T genotype was 0.45, lower than the 0.52 for individuals with the C / T genotype and the 0.55 for individuals with the C / C genotype (P < 0.05). These results indicate that the porcine KLHL14 gene molecular marker is significantly associated with the weak litter size trait. Based on practical breeding goals, pigs with fewer weak litters from individuals with the T / T genotype can be selected to improve piglet survival and uniformity, thereby enhancing breeding efficiency.

[0038] In addition to the above embodiments, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the scope of protection required by the present invention.

Claims

1. A primer for a molecular marker of the KLHL14 gene associated with the piglet trait, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO: 1 and SEQ ID NO:

2. The molecular marker site is located at base 116519104 of chromosome 6 of the pig reference genome Sscrofa11.1 version. The base mutation is C or T, and the genotypes are C / C, C / T and T / T.

2. The use of primers for the KLHL14 gene molecular marker associated with the piglet weakness trait according to claim 1, characterized in that: The primers are used to detect SNP genotypes related to piglet weakness traits, and the detection method includes the following steps: The first step is to perform PCR amplification on the pig DNA sample to be tested using the SNP primers shown in SEQ ID NO: 1-2 to obtain an amplified product. The amplified product is 312 bp in length and contains base 116519104 on chromosome 6 of the pig reference genome S scrofa11.1 version; The second step is to perform Sanger sequencing on the PCR products; The third step is to determine the SNP molecular marker genotype of base 116519104 on chromosome 6 of the pig reference genome Sscrofa11.1 based on the sequencing results of the second step.

3. The use of primers for the KLHL14 gene molecular marker associated with the piglet weakness trait according to claim 2, characterized in that: In the first step, the PCR reaction system is based on 25 μl. 50 ng of pig DNA to be tested 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl.

4. The use of primers for the KLHL14 gene molecular marker associated with the piglet weakness trait according to claim 3, characterized in that: The reaction conditions for PCR amplification in the first step are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 4°C.

5. The use of primers for the KLHL14 gene molecular marker associated with the piglet weakness trait according to claim 2, characterized in that: The nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO:

4.

6. The use of primers for the KLHL14 gene molecular marker associated with the piglet weakness trait according to claim 2, characterized in that: The judgment criterion of the third step is that the number of weak piglets in each period of the T / T genotype pigs with SNP sites is lower than that of the C / T and C / C genotype individuals, and the number of weak piglets in each period of the C / T genotype pigs is lower than that of the C / C genotype individuals.

Images