Application of small peptide ZmNAMP1 in corn stalk rot resistance

By injecting the small peptide ZmNAMP1 with the amino acid sequence KAMGKLKVVLL into the corn stem, the expression of defense genes was induced, which solved the problem of prevention and control of corn stalk rot, improved the disease resistance of corn, and reduced disease losses.

CN120737151APending Publication Date: 2025-10-03HENAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510991963.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-18
Publication Date
2025-10-03

AI Technical Summary

Technical Problem

Corn stalk rot occurs widely in corn-producing areas around the world, posing a serious threat to corn production. Existing technologies lack effective green prevention and control measures.

Method used

The small peptide ZmNAMP1, with an amino acid sequence of KAMGKLKVVLL, was used to induce the expression of defense-related genes and improve corn's resistance to stalk rot by injecting the small peptide solution into the injection hole of the corn stem.

Benefits of technology

Significantly improves resistance to corn stalk rot, reduces lesion length, slows disease progression, enhances plant health, prevents lodging, and reduces yield losses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120737151A_ABST
    Figure CN120737151A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of plant disease resistance, and relates to a small peptide, in particular to application of a small peptide ZmNAMP1 in corn stem rot resistance. The invention provides a small peptide ZmNAMP1 with a sequence of KAMGKLKVVLL, the research on the functions of the small peptide shows that the small peptide can significantly improve the resistance of the corn stalk rot, and the research on the resistance mechanism shows that the resistance of the small peptide ZmNAMP1 to the corn stalk rot is closely related to the defensive reaction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of plant disease resistance, relates to a small peptide, and particularly to an application of the small peptide. Background Art

[0002] Corn stalk rot, also known as base rot or bacterial wilt, is widespread in corn-producing areas worldwide, severely impacting corn production. Pammel first reported corn stalk rot in the United States in 1914, and the disease subsequently spread to other countries and regions. In my country, stalk rot was first reported in the 1960s. Currently, corn stalk rot occurs in all corn-producing areas of my country, with increasing frequency, posing a serious threat to corn production. The development of stalk rot symptoms is associated with a variety of stress factors, including excessive water, drought, lack of sunlight, high-density planting, and the influence of other pests and diseases (Yang et al., 2010). Statistics show that the incidence of corn stalk rot is approximately 25% in typical years, but can reach over 80% in recurrent years, potentially leading to total crop failure. Regarding quality, the stalk rot pathogen secretes mycotoxins such as deoxynivalenol (dvoxin) and zearalenone, which pose serious health risks to humans and animals. In addition, corn stalk rot can also cause the stalk strength to weaken, leading to problems such as lodging in the later stage, seriously affecting mechanized harvesting.

[0003] The pathogens of corn stalk rot are relatively complex. Due to different soil microenvironments in different countries, different regions of the same country, and different years in the same region, the pathogens may vary greatly. However, the pathogens of corn stalk rot in my country are mainly Fusarium graminearum. Fusarium graminearum ) and Pythium (Pythium cystis Pythium inflatum ) are two major categories, of which Fusarium graminearum is the most frequently isolated and most pathogenic. The pathogen overwinters in soil, fertilizer, diseased debris, or corn seeds, invading through natural openings, wounds caused by humans or insects, and the plant's root system, causing stalk rot and discoloration, premature plant aging and death, and eventually, entire plants to collapse, resulting in reduced or even complete corn yield failure. Climate change, the promotion of cultivation practices such as straw return and no-till or minimum tillage, and the monoculture of corn varieties have led to the continuous accumulation of pathogens in the field, resulting in an increasing severity of stalk rot in my country's corn-producing regions.

[0004] Small peptides, a class of small molecules composed of 2 to 100 amino acids, play important roles in a variety of biological processes and possess high development and application value. For example, the discovery and application of insulin is hailed as one of the greatest scientific achievements of the 20th century. Recent studies in humans and animals have revealed that small peptides (NCPs) derived from previously untranslated regions (such as intergenic regions, untranslated textual receptors, and introns) also play key roles in a variety of biological processes. Previous studies have shown that CPs have shown great potential for application in plant disease control. However, there are currently no reports on the application of NCPs in plant disease research. Summary of the Invention

[0005] The present invention provides a small peptide ZmNAMP1 and an application thereof, which achieves the purpose of green prevention and control of corn stalk rot.

[0006] The technical solution of the present invention is achieved as follows: A small peptide ZmNAMP1, whose amino acid sequence is shown in SEQ ID No. 1: KAMGKLKVVLL.

[0007] The application of the above-mentioned small peptide ZmNAMP1 in resisting corn stalk rot.

[0008] The purity of the small peptide ZmNAMP1 is greater than 90%, the molecular weight is 1198.79 Da, and the isoelectric point is 10.3.

[0009] For the above application, the steps are: (1) A 1 mm injection hole was made in the center of the third internode of the corn stem; the corn was grown to the ten-leaf stage.

[0010] (2) Use a sterile syringe to inject 20 μL of 5 μM ZmNAMP1 solution into the injection hole in step (1) and wrap the injection hole with sterile gauze.

[0011] The present invention has the following beneficial effects: 1. The present application provides a small peptide ZmNAMP1 with a sequence of KAMGKLKVVLL, a purity of >90%, a molecular weight of 1198.79 Da, and an isoelectric point of 10.3.

[0012] 2. Corn was treated with the peptide ZmNAMP1 for one day (the control was treated with sterile water), and then tested for resistance to corn stalk rot. The peptide was found to significantly improve corn stalk rot resistance. Further qPCR analysis of corn treated with the peptide ZmNAMP1 revealed that treatment with the peptide ZmNAMP1 significantly induced the expression of defense-related genes, demonstrating that ZmNAMP1 can enhance corn stalk rot resistance through defense responses. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0014] Figure 1 This is the primary mass spectrum of the synthetic small peptide ZmNAMP1.

[0015] Figure 2 This is the secondary mass spectrum of the synthetic small peptide ZmNAMP1.

[0016] Figure 3 This is the liquid chromatogram of the synthetic small peptide.

[0017] Figure 4 Figure 2 shows the stem rot phenotype and lesion length statistics of the ZmNAMP1-treated and control groups; (A) Phenotypes of the ZmNAMP1-treated and control groups on the 5th and 10th days after inoculation with Fusarium graminearum, with a scale of 1 cm; (B) Lesion length statistics of the ZmNAMP1-treated and control groups on the 5th and 10th days after inoculation with Fusarium graminearum, with a two-tailed Student's t-test. t test.

[0018] Figure 5 WGA staining results of the inoculated sites in the ZmNAMP1-treated and control groups at 5 and 10 days of Fusarium graminearum infection. Scale bar: 200 μm.

[0019] Figure 6 Small peptide ZmNAMP1 mutant zmnamp1-1 and zmnamp1-2 mutation type.

[0020] Figure 7 Small peptide ZmNAMP1 mutant zmnamp1-1、zmnamp1-2 and the wild-type sequencing results.

[0021] Figure 8 The ZmNAMP1 mutant before and after treatment with the ZmNAMP1 peptide zmnamp1-1、zmnamp1-2 Results of identification of stem rot resistance of wild type and small peptide ZmNAMP1 mutant before and after treatment with small peptide ZmNAMP1. zmnamp1-1, zmnamp1-2 Phenotypes of the wild type and the wild type on the 5th day after inoculation with Fusarium graminearum, the scale bar is 1 cm; (B) The small peptide ZmNAMP1 mutant before and after treatment with the small peptide ZmNAMP1 zmnamp1-1、zmnamp1-2The lesion length of the wild type and the wild type on the 5th day after inoculation with Fusarium graminearum was statistically analyzed using a two-tailed Student's t test.

[0022] Figure 9 This is a GO enrichment bar chart of up-regulated genes induced by small peptide ZmNAMP1 treatment; the y-axis represents the GO term name enriched in the up-regulated genes induced by ZmNAMP1, and different filling colors represent different types of GO terms, red for biological process BP, green for cellular component CC, and blue for molecular function MF.

[0023] Figure 10 This is a KEGG enrichment bar chart of up-regulated genes induced by small peptide ZmNAMP1 treatment; the y-axis represents the KEGG pathway name enriched in the up-regulated genes induced by ZmNAMP1.

[0024] Figure 11 The expression patterns of defense-related genes before and after treatment with the small peptide ZmNAMP1; 4 defense-related genes ( Cytochrome P450 、 wrky 53 、 Calmodulin binding protein 1 、 Peroxidase ) expression patterns before and after treatment with the small peptide ZmNAMP1, corn 18S Genes were used as internal references, and statistical analysis was performed using two-tailed Student's t test. DETAILED DESCRIPTION

[0025] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Example

[0026] 1 Experimental methods 1.1 Small peptide synthesis We commissioned Wuhan Chentai Biotechnology Co., Ltd. to synthesize the novel peptide using the Fmoc (9-fluorenylmethoxycarbonyl) solid-phase synthesis method, proceeding from the C-terminus (carboxyl terminus) to the N-terminus (amino terminus). The resulting novel sequence, KAMGKLKVVLL, was synthesized by GL Biochem (Shanghai, China) Ltd. (purity >95%), purified by HPLC, and identified by mass spectrometry.

[0027] 1.2 Preparation of peptide solution The synthesized peptide was dissolved in sterile water, and then prepared into a stock solution with a peptide concentration of 10 mM using sterile water and stored at -20°C.

[0028] 1.3 Preparation of Fusarium graminearum spore suspension 1.3.1 Preparation of PDA medium Peel fresh potatoes and cut them into small pieces. Weigh 200 g and put them into a pot. Add distilled water and boil for 30 min. Filter through two layers of gauze to remove the residue. Add 20 g glucose and 15 g agar powder. Heat until completely dissolved, then dilute to 1 L with distilled water. Dispense into conical flasks and sterilize in an autoclave at 121°C for more than 15 min.

[0029] 1.3.2 Preparation of mung bean culture medium Weigh 30 g of mung beans, wash them clean, put them into a pot, add distilled water and boil for 10 min, filter through 4 layers of gauze to remove solids, make up to 1 L with distilled water, dispense into conical flasks, and sterilize in an autoclave at 121°C for more than 15 min.

[0030] 1.3.3 Preparation of Fusarium graminearum spore suspension: ①Inoculate the laboratory-stored Fusarium graminearum onto the PDA plate culture medium and place it in an incubator at 28°C in the dark for 4 days.

[0031] ② Take a small amount of activated Fusarium graminearum and inoculate it into the pre-sterilized mung bean culture medium, and culture it in the dark at 25℃ and 180 rpm for 5 days.

[0032] ③ Filter the bacterial solution through 4 layers of gauze to remove impurities.

[0033] ④ Observe the spore concentration using a hemocytometer under a microscope. The spore suspension concentration should reach 1×106 cells / ml.

[0034] 1.4 Identification of resistance to corn stalk rot (1) When the corn reaches the ten-leaf stage, use a sterile needle to poke a hole with a diameter of 1 mm in the center of the third internode above the ground.

[0035] (2) Use a sterile syringe to inject 20 μL of 5 μM ZmNAMP1 solution (sterile water for control) into the wound site.

[0036] (3) Wrap the wound with sterile gauze.

[0037] (4) After 24 h of treatment, the sterile gauze was removed and 20 μL of 1×10 6 Spore suspension of Fusarium graminearum at a concentration of spores / ml.

[0038] (5) Wrap the wound with sterile gauze.

[0039] (6) Take photos and take samples 5, 10, 15, and 20 days after inoculation.

[0040] (7) The length of the lesions was measured using Image J and statistical analysis was performed using Excel.

[0041] 1.5 zmnamp1 Creation of mutant materials and identification of resistance zmnamp1 The mutants were created by Weimi Biotechnology Co., Ltd. using the B73-329 background. Based on the transcript sequence of ZmNAMP1, two CRISPR-Cas9 target sites were identified. CRISPR-Cas9 technology was then used to edit the ZmNAMP1 gene. The identified target sites and sgRNA sequences were: sgRNA1: GTATGACATCAGGTAACCTTAGG; sgRNA2: CCTTTCCTGTTAGGTTGCCATGG. Seeds of T0-generation positive plants were obtained. Subsequently, T1-generation material was planted in Zhengzhou, Henan Province, and mutant detection primers were designed. T1-generation mutant DNA was used as a template for detection. PCR detection primers are as follows: ZmNAMP1-F: AGTATTGGCAAAACATAGAAGGT; ZmNAMP1-R: CTATTGCTTTGACTGTTGCTATC. zmnamp1 The identification of stem rot resistance of mutant materials is shown in 1.4.

[0042] 1.6 Analysis of defense-related gene expression 1.6.1 Extraction and detection of plant total RNA The mortar, medicine spoon and other items required for RNA extraction were ignited with anhydrous ethanol for more than 5 minutes, and the required centrifuge tubes, pipette tips, etc. were sterilized in a high-pressure sterilizer at 121℃ for more than 15 minutes.

[0043] (1) Place the leaves stored at -80°C in a mortar and grind them into fine powder. Transfer them quickly to a 2.0 ml centrifuge tube.

[0044] (2) Add appropriate amount of Trizol extract, let it stand at room temperature for 5 minutes, and then use an electrophoresis homogenizer to fully homogenize for 2 minutes.

[0045] (3) Centrifuge at 12,000 rpm for 5 minutes and collect the supernatant.

[0046] (4) Add chloroform in a ratio of 200 μL chloroform to 1 ml Trizol, shake well (do not use vortexing), and let it stand for 15 minutes.

[0047] (5) Centrifuge at 12,000 rpm at 4°C for 15 min.

[0048] (6) Pipette the top liquid phase into a new 1.5 ml centrifuge tube, add isopropanol at a ratio of 0.5 ml isopropanol: 1 ml Trizol, and let it stand for 10 min.

[0049] (7) Centrifuge at 12,000 rpm at 4°C for 10 min and remove the supernatant.

[0050] (8) Add ethanol in a ratio of 1 ml 75% ethanol to 1 ml Trizol, gently shake the centrifuge tube, and resuspend the pellet.

[0051] (9) Centrifuge at 8000 rpm at 4°C for 5 min and discard the supernatant.

[0052] (10) Dry at room temperature for 5 min, add 50 μL of DEPC H2O preheated at 65°C, and store at -80°C.

[0053] 1.6.2 Synthesis and detection of the first strand of cDNA Follow the instructions of the reverse transcription kit. The specific steps are as follows: RNase-free ddH2O 7 μL 5xg DNA digester mix 3 μL Total RNA 5 μL Incubate at 42°C for 2 min. Incubation product 15 μL 4xHifair III SuperMix plus 5 μL Set up the reverse transcription program as follows: 25℃ 5 min 55℃ 15 min 85℃ 5min 4℃ forever The PCR products were stored at -20°C.

[0054] The quality of cDNA was tested using maize 18S gene primers.

[0055] The PCR detection system is as follows: Premix Taq 12.5 μL 18S F 1 μL 18S R 1 μL cDNA 1 μL ddH2O 9.5 μL Set up the PCR assay as follows: 95℃ 5 min 95℃ 1 min 58°C for 1 min, 35 cycles 72℃ 20 s 72℃ 10 min 4℃ forever PCR products were detected by gel electrophoresis.

[0056] 1.6.3 Real-time quantitative PCR (qRT-PCR) Follow the qRT-PCR instructions. The specific steps are as follows: Prepare the qRT-PCR system as follows: Hieff qPCR SYBR Green Master Mix 10 μL Forward Primer 0.4 μL Reverse Primer 0.4 μL cDNA 1 μL ddH2O 8.2 μL Set up the qRT-PCR program as follows: 95℃ 5 min 95℃ 10 sec 60℃ 20 sec 40 cycles 72℃ 20 sec The melting curve is the instrument default; The qRT-PCR results were analyzed by relative quantitative method to detect the expression of the corresponding genes and 18S in each sample. Each sample was repeated 3 times and the average value was calculated. The 2 -△△CT The value is calculated as follows: ①△CT calibration sample = sample - internal reference; ②△CT of the sample to be tested = sample - internal reference; ③△△CT=△CT of the sample to be tested -△CT of the calibration sample; ④Calculation 2 -△△CT value.

[0057] 2 Results Analysis 2.1 Synthesis and mass spectrometric identification of the small peptide ZmNAMP1 To verify the function of the peptide ZmNAMP1 in corn stalk rot resistance, we commissioned Wuhan Chentai Biotechnology Co., Ltd. to chemically synthesize ZmNAMP1. Mass spectrometry analysis revealed that the structure and molecular weight of the peptide ZmNAMP1 were consistent with expectations ( Figure 1-Figure 2 ), the purity of the synthesized corn non-traditional peptide was further analyzed by high performance liquid chromatography and it was found that the purity of the synthesized peptide was >90% ( Figure 3 ), which meets the requirements and can be used for subsequent experiments.

[0058] Implementation effect analysis 1. Identification of corn stalk rot resistance induced by the small peptide ZmNAMP1 1) Plant corn in an artificial climate chamber. When the corn reaches the 10-leaf stage, 2) Use an electric drill and a suitable drill bit to make a horizontal hole in the middle of the third internode of the corn field, inject 20 μL of 10 μM ZmNAMP1 peptide solution, and then seal the hole with paper tape.

[0059] 3) After 24 h of peptide treatment, the paper tape was removed and 20 μL of Fusarium graminearum spore suspension was injected into the injection hole.

[0060] 4) 5 and 10 days after inoculation, remove the inoculated internodes and split them longitudinally along the inoculation hole. Then take photos and measure the length of the lesions.

[0061] like Figure 4 As shown in middle A, at different times after inoculation, the lesions in the control group of corn gradually expanded along the vascular bundles of the stems, and the disease continued to worsen; while the necrotic lesions in the group treated with the small peptide ZmNAMP1 were significantly lighter. Figure 4 As shown in B, the statistics of lesion length showed that the lesion length of the ZmNAMP1-treated group was significantly lower than that of the control group, indicating that the small peptide ZmNAMP1 can enhance the resistance of corn to stalk rot.

[0062] To further study the function of the peptide ZmNAMP1 in corn stalk rot resistance at the cellular level, we used wheat germ agglutinin (WGA) to stain the fungal hyphae in the samples of the peptide ZmNAMP1 treatment group and the control group to observe the growth of Fusarium graminearum hyphae in corn tissues.

[0063] WGA staining was commissioned to Wuhan Sewell Biotechnology Co., Ltd. The experimental procedures are briefly described as follows.

[0064] Carnoy's fixative, PBS buffer, PI staining solution, and anti-fading mounting medium were all provided by Wuhan Sewell Biotechnology Co., Ltd., with catalog numbers G1120, G0002, G1021, and G1401. WGA-AF488 storage solution was provided by Sigma, with catalog number L4895.

[0065] 1) Preparation of staining solution: 0.2% Tween-PBS solution: Dissolve 0.2 ml Tween-20 in 100 ml PBS. WGA staining solution: Add 10 μL of WGA stock solution and 20 μL of PI stock solution to 970 μL of 0.2% Tween-PBS solution and mix thoroughly. Prepare this solution immediately and store in the dark.

[0066] 2) Fixation: Fix the sample using Carnoy's fixative.

[0067] 3) Transparent: Transfer the stem tissue to a 10% KOH solution and incubate at 85°C for 4 hours. Then wash 4-5 times with a 0.2% Tween-PBS solution.

[0068] 4) Staining: Add WGA staining solution to the centrifuge tube containing the stem sample and filter with a vacuum pump four times for 5 minutes each time, with a 5-minute interval at normal pressure.

[0069] 5) Photography: Wash the sample 2-3 times with PBS solution, mount it with anti-fluorescence quenching mounting medium, store it at 4°C in the dark, and then take pictures using a fluorescence microscope or confocal microscope.

[0070] The results are as follows Figure 5 As shown, fungal hyphae appeared green after WGA staining. Over time, the number of hyphae in both the control group and the ZmNAMP1-treated group gradually increased. However, the number of hyphae in the ZmNAMP1-treated group was significantly less than that in the control group. In particular, on the 10th day after inoculation, a large number of hyphae were observed inside the cells of the control group, and the tissue cells showed a lot of damage, while the hyphae in the ZmNAMP1-treated group did not obviously invade the cells. These results further confirm the important positive role of the ZmNAMP1-treated group in corn stalk rot resistance.

[0071] 2. Mutation of the small peptide ZmNAMP1 significantly reduces corn's resistance to stalk rot In order to further verify the function of the small peptide ZmNAMP1 in corn stalk rot resistance, we commissioned Weimi Bio to use B73-329 as the basic material, such as Figure 6 As shown in Figure 2, two CRISPR-Cas9 target sites were found based on the sequence of ZmNAMP1, and then the small peptide ZmNAMP1 was knocked out using CRISPR-Cas9 technology. Figure 6 、 Figure 7 As shown, by sequencing the PCR amplification products and comparing them with the wild-type corresponding sequences, we identified two types of homozygous mutants, which we named zmnamp1-1 and zmnamp1-2 The PCR detection primers are as follows: ZmNAMP1-F: AGTATTGGCAAAACATAGAAGGT; ZmNAMP1-R: CTATTGCTTTGACTGTTGCTATC. zmnamp1-1 missing The 144 bp DNA fragment containing the entire ZmNAMP1 peptide sequence was lost. zmnamp1-2 missing A 145 bp DNA fragment containing the entire ZmNAMP1 peptide sequence was lost. zmnamp1-1 、 zmnamp1-2 The stalk rot resistance of WT and wild type (WT) was identified. zmnamp1-1 and zmnamp1-2 The third internode of the aboveground stem was inoculated with Fusarium graminearum and the phenotypic investigation was carried out 5 days after inoculation. Figure 8 As shown, zmnamp1-1 and zmnamp1-2 The length of the stalk rot lesions in the mutant was significantly longer than that in the WT, indicating that the mutation of the small peptide ZmNAMP1 weakened the resistance of maize to stalk rot.

[0072] 3. External application of the peptide ZmNAMP1 can replenish zmnamp1 Disease-susceptible phenotype of the mutant To verify zmnamp1 To determine whether the disease-susceptibility phenotype of the mutant is caused by the mutation of the small peptide ZmNAMP1, we conducted experiments on WT and zmnamp1-1 and zmnamp1-2 First, the plants were treated with the small peptide ZmNAMP1, and then inoculated with Fusarium graminearum. The resistance to stem rot was identified 5 days after inoculation. Figure 8 As shown, compared with the control maize plants, the treatment with the small peptide ZmNAMP1 complemented the ZmNAMP1 mutant. zmnamp1-1 and zmnamp1-2 The above results further confirmed the important function of the small peptide ZmNAMP1 in maize resistance to stalk rot.

[0073] 4. Mechanism of stem rot resistance induced by the small peptide ZmNAMP1 The GO (Gene Ontology) database is one of the world's largest sources of information on gene function. The GO database categorizes gene function into three main categories: biological process (BP), which describes the biological activity in which a gene participates; molecular function (MF), which describes the molecular activity of a gene product; and cellular component (CC), which describes the localization of a gene product within the cell. Enrichment analysis uses statistical methods (such as the hypergeometric distribution test) to assess whether the distribution of a group of genes in specific GO terms is significantly higher than random noise, thereby identifying the functional categories in which the genes participate or influence.

[0074] To preliminarily explore the molecular mechanism by which ZmNAMP1 regulates maize stalk rot resistance, we performed GO enrichment analysis on genes whose expression was upregulated by the small peptide ZmNAMP1.

[0075] Transcriptome sequencing and upstream and downstream analyses were performed by Shanghai Paisono Biotechnology Co., Ltd. The specific procedures are briefly described below.

[0076] 1) Maize was grown in a greenhouse. At the ten-leaf stage, a hole was drilled into the third internode above ground and injected with 20 μL of 5 μM ZmNAMP1 or sterile double-distilled water. The hole was sealed with paper tape. After 24 hours, the injected internode was excised and the epidermis was trimmed, leaving only the pith. The sample was plunged into liquid nitrogen. Each sample group included three biological replicates and was subsequently sent to Shanghai Paisonno Biotechnology Co., Ltd.

[0077] 2) Total RNA from each sample was extracted using Trizol Reagent, and RNA quality control was performed using an Agilent 5400 fragment analyzer.

[0078] 3) Qualified RNA is isolated from mRNA using magnetic beads. The mRNA is then fragmented and reverse transcribed into cDNA. The cDNA is then 5' end-repaired and 3' end-tailed, and sequencing adapters are added. Fragments approximately 300 bp in length are recovered, amplified by PCR, and sequenced.

[0079] 4) After sequencing is completed, the raw image data is obtained and converted into FASTQ raw data using the sequencing platform's built-in software, and quality indicators such as Q30 are calculated.

[0080] 5) Cutadapt was used to remove 3' adapters from reads that overlapped with the known adapter sequence (AGATCGGAAG) by at least 10 bp, allowing for 20% base mismatches. Reads with an average quality score below 20 were also removed.

[0081] 6) Use HISAT2 software to align the filtered reads to the reference genome.

[0082] 7) Use HTSeq software to calculate the read count value mapped to each gene as the original gene expression level. Then convert it to FPKM value, and then perform correlation analysis between samples and principal component analysis (PCA).

[0083] 8) Differential expression analysis was performed using the DESeq R package. The criteria for screening differentially expressed genes were: p-value < 0.05 and |Fold Change| > 2.

[0084] 9) Finally, GO and KEGG enrichment analysis was performed on the differentially expressed genes using topGO and clusterprofiler software. The p-value was calculated using hypergeometric distribution. The standard for significant enrichment of GO terms or KEGG pathways was p-value < 0.05.

[0085] like Figure 9 As shown in the figure, GO terms are mainly enriched in transcriptional regulation, pathogen response, hormone decomposition and synthesis, and toxic substance response. Specifically, they include DNA template transcriptional regulation, protein transport from the Golgi apparatus to the plasma membrane, chitin response, antibiotic biosynthesis, hormone level regulation, gibberellin decomposition and metabolism process, salicylic acid biosynthesis process, and aldehyde-related cellular detoxification.

[0086] KEGG (Kyoto Encyclopedia of Genes and Genomes) is a comprehensive bioinformatics database developed by Kyoto University in Japan in 1995. It integrates information on genomes, chemical substances, and biochemical pathways to analyze the functions of genes in biological processes. Its core sub-database, KEGG PATHWAY, links genes to specific biological pathways, facilitating a holistic understanding and analysis of complex gene expression changes.

[0087] Similarly, we performed KEGG enrichment analysis on genes whose expression was upregulated by the small peptide ZmNAMP1. Figure 10 As shown, genes upregulated by the peptide ZmNAMP1 were mainly enriched in pathways such as brassinosteroid (BR) biosynthesis, diterpenoid biosynthesis, and tyrosine metabolism. The above GO and KEGG enrichment results showed that the peptide ZmNAMP1 treatment induced significant enrichment of pathways such as disease resistance-related hormones and secondary metabolite biosynthesis, suggesting that the peptide ZmNAMP1 may regulate maize resistance to stalk rot through disease resistance-related metabolic pathways.

[0088] The previous GO and KEGG enrichment results suggested that the small peptide ZmNAMP1 may function through disease resistance-related metabolic pathways. Therefore, in order to further study ZmNAMP1 To investigate the molecular mechanisms of improving corn stalk rot resistance, we selected four defense-related genes for analysis. These four genes are involved in defense response signal transduction. Calmodulin binding protein 1 , involved in the transcriptional regulation of defense responses wrky 53 , involved in the synthesis of secondary metabolites Cytochrome P450 and those involved in ROS regulation and cell wall strengthening Peroxidase Specific primers were designed for the above genes, and their expression levels were analyzed using qRT-PCR.

[0089] Table 1 Primer sequences of four defense-related genes like Figure 11 As shown, the expression of these four genes was induced after treatment with the small peptide ZmNAMP1. These results further indicate that the small peptide ZmNAMP1 enhances maize resistance to stalk rot through disease defense response-related pathways.

[0090] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A small peptide ZmNAMP1, whose amino acid sequence is shown in SEQ ID No.

1.

2. Use of the small peptide ZmNAMP1 according to claim 1 in resisting corn stalk rot.

3. The use according to claim 2, characterized in that: The purity of the small peptide ZmNAMP1 is greater than 90%.

4. The use according to claim 2 or 3, characterized in that The steps are: (1) Make an injection hole on the corn stalk; (2) Use a sterile syringe to inject the ZmNAMP1 solution into the injection hole in step (1), and wrap the injection hole with sterile gauze.

5. The use according to claim 4, characterized in that: The corn in step (1) is corn that has grown to the ten-leaf stage.

6. The use according to claim 5, characterized in that: The injection hole is located at the center of the third internode above the ground.

7. The use according to claim 6, characterized in that: The diameter of the injection hole is 2 mm.

8. The use according to claim 7, characterized in that: The concentration of the ZmNAMP1 solution in step (2) is 5 μM.

9. The use according to any one of claims 5 to 8, characterized in that: The injection volume of the ZmNAMP1 solution was 20 μL.

10. A method for improving corn stalk rot resistance, characterized in that: The steps are: inject 20 μL of 5 μM ZmNAMP1 solution into the center of the third node on the ten-leaf stage corn field to achieve the purpose of improving the resistance of corn to stalk rot.