Soybean Gmups1 and Gmups2 genes and the encoded proteins in regulating soybean seed size

Abstract

The application relates to the technical field of genetic engineering, and provides application of soybean GmUPS1 and GmUPS2 genes and coded proteins thereof in regulating soybean seed size. The application first discloses that the soybean GmUPS1 and GmUPS2 genes and coded proteins thereof have the function of improving the soybean seed size, and the soybean seed size can be effectively improved by simultaneously mutating the GmUPS1 and GmUPS2 genes and coded proteins thereof in plants. The GmUPS1 and GmUPS2 genes and coded proteins thereof provided by the application can be used for breeding of high-yield soybean varieties, and have wide application prospects.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, in particular, to the application of soybean GmUPS1 and GmUPS2 genes and the encoded proteins in regulating soybean seed size. BACKGROUND

[0002] Soybean is an important food and oil crop, and is an important part of our diet. Global consumption of soybean oil ranks second only to palm oil; soybean protein is one of the few plant proteins that contain all essential amino acids, and also contains a variety of bioactive peptides with health benefits, which makes soybean have important economic value in agriculture, food industry and pharmaceutical industry. China's soybean imports have been more than 80% for a long time, which seriously threatens China's food security, and it is crucial to cultivate high-yield and high-quality varieties with independent intellectual property rights.

[0003] Soybean seed size is a key indicator of high yield of soybean varieties, and soybean seed size is regulated by both genes and environment. In recent years, researchers have identified some key genes that regulate soybean seed size through genetics, molecular biology, and multi-omics technology. For example, GmSWEET10a and GmSWEET10b sugar transport genes; GmSW17 gene affecting seed width; and GmST05, GmCYP78A72, and GmCYP78A5 genes have been verified to regulate soybean seed size. However, there are still many key gene sites that need to be further explored for soybean seed size, which is of great significance for promoting high-yield soybean breeding. SUMMARY

[0004] The purpose of the present application is to provide the application of soybean GmUPS1 and GmUPS2 genes and the encoded proteins in regulating soybean seed size.

[0005] In order to achieve the purpose of the present application, in the first aspect, the present application provides the application of soybean GmUPS1 and GmUPS2 genes and the encoded proteins in regulating soybean seed size.

[0006] The soybean GmUPS1 gene is a gene encoding the following protein (a) or (b):

[0007] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1; or

[0008] (b) a protein derived from (a) by substitution, deletion, or addition of one or more amino acids to the sequence shown in SEQ ID NO: 1 and having equivalent function;

[0009] The soybean GmUPS2 gene is a gene encoding the following protein (c) or (d):

[0010] (c) a protein consisting of the amino acid sequence shown in SEQ ID NO: 3; or

[0011] (d) a protein derived from (d) by substitution, deletion or addition of one or several amino acids and having equivalent function.

[0012] Further, the regulation is negative regulation.

[0013] In a second aspect, the present application provides a method for increasing soybean seed size, wherein the functions of both GmUPS1 and GmUPS2 genes are deleted to increase the soybean seed size.

[0014] Further, the method comprises: taking the conserved sequence common to GmUPS1 and GmUPS2 genes as a target, designing a gRNA sequence based on CRISPR-Cas9, connecting a DNA fragment containing the gRNA sequence to a CRISPR-Cas9-carrying vector, transforming soybean, and then obtaining transgenic soybean with the functions of both GmUPS1 and GmUPS2 genes deleted.

[0015] In one specific embodiment of the present application, GmUPS1 and GmUPS2 are taken as targets, a knockout target sequence based on CRISPR-Cas9 is designed, an oligonucleotide sequence containing the knockout target sequence is first connected to a pBlu gRNA intermediate vector to construct a gRNA, the constructed gRNA is then digested, the digested gRNA is connected to a CRISPR-Cas9 vector, soybean is then transformed, and transgenic soybean with the function of the gene deleted is obtained.

[0016] Preferably, the DNA fragment encoding the gRNA sequence is annealed from F and R as follows:

[0017] F: 5'- gattGTTAGGGCGCAAGTGGTGGGA-3' (SEQ ID NO: 9);

[0018] R: 5'- aaacTCCCACCACTTGCGCCCTAAC-3' (SEQ ID NO: 10).

[0019] In a third aspect, the present application provides a double-gene mutant of soybean GmUPS1 and GmUPS2, which is a CRISPR-Cas9 knockout mutant CR_gmups1 / 2#1 and CR_gmups1 / 2#2;

[0020] In the mutant CR_gmups1 / 2#1, the GmUPS1 mutant gene contained is:

[0021] A1) the nucleotide sequence represented by SEQ ID NO: 5;

[0022] A2) a nucleotide sequence in which the nucleotide sequence represented by SEQ ID NO: 5 is substituted, deleted and / or added with one or more nucleotides and expresses the same functional protein;

[0023] A3) a nucleotide sequence hybridizing under stringent conditions to the sequence represented by SEQ ID NO: 5 and expressing the same functional protein, the stringent conditions being hybridization in a 0.1 x SSPE or 0.1 x SSC solution containing 0.1% SDS at 65°C, and washing the membrane with the solution; or

[0024] A4) a nucleotide sequence having 90% or more homology to the nucleotide sequence of A1), A2) or A3) and expressing the same functional protein;

[0025] In the mutant CR_gmups1 / 2#1, the GmUPS2 mutant gene contained is:

[0026] B1) the nucleotide sequence represented by SEQ ID NO: 6;

[0027] B2) a nucleotide sequence in which the nucleotide sequence represented by SEQ ID NO: 6 is substituted, deleted and / or added with one or more nucleotides and expresses the same functional protein;

[0028] B3) a nucleotide sequence hybridizing under stringent conditions to the sequence represented by SEQ ID NO: 6 and expressing the same functional protein, the stringent conditions being hybridization in a 0.1 x SSPE or 0.1 x SSC solution containing 0.1% SDS at 65°C, and washing the membrane with the solution; or

[0029] B4) a nucleotide sequence having 90% or more homology to the nucleotide sequence of B1), B2) or B3) and expressing the same functional protein;

[0030] In the mutant CR_gmups1 / 2#2, the GmUPS1 mutant gene contained is:

[0031] C1) the nucleotide sequence represented by SEQ ID NO: 7;

[0032] C2) a nucleotide sequence in which the nucleotide sequence represented by SEQ ID NO: 7 is substituted, deleted and / or added with one or more nucleotides and expresses the same functional protein;

[0033] C3) a nucleotide sequence hybridizing under stringent conditions to the sequence shown in SEQ ID NO: 7 and expressing the same functional protein, said stringent conditions being hybridization in a 0.1 x SSPE or 0.1 x SSC solution containing 0.1% SDS at 65°C, and washing the membrane with this solution; or

[0034] C4) a nucleotide sequence having more than 90% homology to the nucleotide sequence of C1), C2) or C3) and expressing the same functional protein;

[0035] The GmUPS2 mutant gene contained in the mutant CR_gmups1 / 2#2 is:

[0036] D1) a nucleotide sequence shown in SEQ ID NO: 8;

[0037] D2) a nucleotide sequence shown in SEQ ID NO: 8 with one or more nucleotides substituted, deleted and / or added and expressing the same functional protein;

[0038] D3) a nucleotide sequence hybridizing under stringent conditions to the sequence shown in SEQ ID NO: 8 and expressing the same functional protein, said stringent conditions being hybridization in a 0.1 x SSPE or 0.1 x SSC solution containing 0.1% SDS at 65°C, and washing the membrane with this solution; or

[0039] D4) a nucleotide sequence having more than 90% homology to the nucleotide sequence of D1), D2) or D3) and expressing the same functional protein.

[0040] In a fourth aspect, the present application provides any one of the following applications of the soybean GmUPS1 and GmUPS2 double-gene mutant or the biological material containing the double-gene mutant:

[0041] (1) for regulating soybean seed size;

[0042] (2) for preparing transgenic plants;

[0043] (3) for soybean variety improvement.

[0044] In a fifth aspect, the present application provides the application of the transgenic soybean obtained according to the above-mentioned application or method in plant breeding.

[0045] Further, the breeding methods include but are not limited to transgenesis, crossbreeding, backcrossing, selfing or vegetative propagation.

[0046] By means of the above technical solution, the present application has at least the following advantages and beneficial effects:

[0047] The application discloses soybean GmUPS1 and GmUPS2 genes and their encoded proteins for the first time, and the genes and the encoded proteins have the function of regulating soybean seed size. BRIEF DESCRIPTION OF DRAWINGS

[0048] Figure 1 Part of the genomic and transcription sequences of the soybean GmUPS1 gene provided in Embodiment 1 of the application are shown in the figure, wherein the bold font represents an exon sequence, the italic font represents an intron sequence, and ATG represents a start codon.

[0049] Figure 2 Part of the genomic and transcription sequences of the soybean GmUPS1 gene provided in Embodiment 1 of the application are shown in the figure, wherein the bold font represents an exon sequence, the italic font represents an intron sequence, and TAG represents a stop codon.

[0050] Figure 3 Part of the genomic and transcription sequences of the soybean GmUPS2 gene provided in Embodiment 1 of the application are shown in the figure, wherein the bold font represents an exon sequence, the italic font represents an intron sequence, and ATG represents a start codon.

[0051] Figure 4 Part of the genomic and transcription sequences of the soybean GmUPS2 gene provided in Embodiment 1 of the application are shown in the figure, wherein the bold font represents an exon sequence, the italic font represents an intron sequence, and TAG represents a stop codon.

[0052] Figure 5 The figure shows an intermediate vector used for constructing a GmUPS1 and GmUPS2 gene CRISPR-Cas9 double knockout plant provided in Embodiment 2 of the application.

[0053] Figure 6 The figure shows a CRISPR-Cas9 vector used for constructing a GmUPS1 and GmUPS2 gene CRISPR-Cas9 double knockout plant provided in Embodiment 2 of the application.

[0054] Figure 7 The figure shows the mutation mode of two mutants CR_gmups1 / 2#1 and CR_gmups1 / 2#2 generated after constructing a GmUPS1 and GmUPS2 gene double knockout provided in Embodiment 2 of the application.

[0055] Figure 8The GmUPS1 and GmUPS2 double-knock mutant CR_gmups1 / 2#1 and CR_gmups1 / 2#2 provided in Embodiment 3 of the present application are compared with the control variety Williams 82 soybean seeds in terms of length and width, as shown in the schematic diagram. A represents a comparison of the length of the seeds of the control variety Williams 82 and the CR_gmups1 / 2#1 and CR_gmups1 / 2#2 soybeans, and B represents a comparison of the width of the seeds of the control variety Williams 82 and the CR_gmups1 / 2#1 and CR_gmups1 / 2#2 soybeans.

[0056] Figure 9 The GmUPS1 and GmUPS2 double-knock mutant CR_gmups1 / 2#1 and CR_gmups1 / 2#2 provided in Embodiment 3 of the present application are compared with the control variety Williams 82 soybean seeds in terms of area, hundred-grain weight, and total grain weight per plant, as shown in the schematic diagram. A represents a comparison of the area of the seeds of the control variety Williams 82 and the CR_gmups1 / 2#1 and CR_gmups1 / 2#2 soybeans, B represents a comparison of the hundred-grain weight of the seeds of the control variety Williams 82 and the CR_gmups1 / 2#1 and CR_gmups1 / 2#2 soybeans, and C represents a comparison of the total grain weight per plant of the control variety Williams 82 and the CR_gmups1 / 2#1 and CR_gmups1 / 2#2 soybeans. DETAILED DESCRIPTION

[0057] The present application aims to provide the application of soybean GmUPS1 and GmUPS2 genes and the encoded proteins in improving the size of soybean seeds.

[0058] The present application adopts the following technical solutions:

[0059] The present application provides a GmUPS1 protein, comprising an amino acid sequence as shown in SEQ ID NO: 1.

[0060] The GmUPS1 protein is encoded by a nucleotide sequence as shown in SEQ ID NO: 2.

[0061] The present application further provides a nucleic acid for encoding the GmUPS1 protein.

[0062] The nucleic acid comprises genomic DNA, cDNA, recombinant DNA or mRNA, hnRNA encoding the GmUPS1 protein, or a nucleic acid molecule reverse complementary to the above-mentioned DNA, cDNA, recombinant DNA or mRNA.

[0063] The present application provides a GmUPS2 protein, comprising an amino acid sequence as shown in SEQ ID NO: 3.

[0064] The GmUPS2 protein is encoded by a nucleotide sequence as shown in SEQ ID NO: 4.

[0065] The application also provides a nucleic acid for encoding the GmUPS2 protein.

[0066] The nucleic acid includes genomic DNA, cDNA, recombinant DNA or mRNA, hnRNA encoding the GmUPS2 protein, or a nucleic acid molecule reverse complementary to the above-mentioned DNA, cDNA, recombinant DNA or mRNA.

[0067] The application also provides GmUPS1 and GmUPS2 gene CRISPR-Cas9 double knock mutants (CR_gmups1 / 2#1 and CR_gmups1 / 2#2), including: a CR_gmups1 / 2#1 nucleotide sequence as shown in SEQ ID NO: 5 and SEQ ID NO: 6, and a CR_gmups1 / 2#2 nucleotide sequence as shown in SEQ ID NO: 7 and SEQ ID NO: 8.

[0068] The application also provides a biological material including the nucleic acid or the GmUPS1 and GmUPS2 gene double knock mutant, and the biological material includes but is not limited to recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineering bacteria or transgenic cell line.

[0069] The application also provides a kit including one or more of the GmUPS1 and GmUPS2 protein, the nucleic acid, the GmUPS1 and GmUPS2 gene double knock mutant or the biological material.

[0070] The application further provides application of the GmUPS1 and GmUPS2 protein, the nucleic acid, the GmUPS1 and GmUPS2 gene double knock mutant, the biological material or the kit in improving soybean seed size.

[0071] The following examples are used to illustrate the application, but not to limit the scope of the application. If not specifically indicated, the technical means used in the examples are conventional means known to those skilled in the art, and the raw materials used are commercially available.

[0072] The soybean variety Williams 82 was provided by the Soybean Molecular Design Breeding Laboratory of Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences. See the literature Ye, Y., et al. (2025). LRM3 positively regulates stem lodging resistance by degradating MYB6 transcriptional repressor in soybean. Plant biotechnology journal, 23(7), 2978–2993.

[0073] Example 1

[0074] This example provides a method for isolating soybean GmUPS1 and GmUPS2 genes and analyzing their structures, which specifically includes the following procedures:

[0075] 1. Isolation of the GmUPS1 gene

[0076] In this invention, total RNA was extracted from the soybean variety Williams 82. Using the total RNA as a template, the oligonucleotide sequence (T)17 was used as a primer to synthesize the first strand of cDNA. Using the first strand of this cDNA as a template, PCR amplification was carried out using the forward primer (5’-ATGGTGTTTGAGGAAACTGAG -3’, SEQ ID NO:11) and the reverse primer (5’- CTAGCTCCTGTTCTTGCATTT -3’, SEQ ID NO:12) respectively. A cDNA fragment of the GmUPS1 gene with a length of 741bp was obtained. This fragment was ligated to the pEasy-Blunt vector (https: / / www.gene-star.com / Kangrun Biology) and named Blunt-GmUPS1.

[0077] For the obtained GmUPS1 gene, its CDS sequence is as shown in SEQ ID NO:2. The full length of the GmUPS1 gene CDS is 741bp in total; the amino acid sequence of the protein encoded by this gene is as shown in SEQ ID NO:1, with a total of 246 amino acids.

[0078] 2. Structure analysis of the GmUPS1 gene

[0079] DNA was extracted from the young leaves of the soybean variety Williams 82. Using this genomic DNA as a template, the GmUPS1 genomic fragment was amplified. The GmUPS1 genomic sequence is as Figure 1 and Figure 2 shown, with a full length of 3489bp, containing 5 exons and 4 introns.

[0080] 3. Isolation of GmUPS2 gene

[0081] The total RNA was extracted from soybean variety Williams 82, and a first strand of cDNA was synthesized from the total RNA as a template and oligonucleotide sequence (T) 17 as a primer. The first strand of cDNA was used as a template, and forward primer (5'-ATGGTGTTTGAGGAAACTGAGC-3', SEQ ID NO: 13) and reverse primer (5'-CTAGCTCCTGTTCTTGCATTTCT-3', SEQ ID NO: 14) were used for PCR amplification, respectively. A 747 bp long GmUPS2 gene cDNA fragment was obtained, and the fragment was connected with pEasy-Blunt vector (https: / / www.gene-star.com / ), and named as Blunt-GmUPS2.

[0082] The obtained GmUPS2 gene has a CDS sequence as shown in SEQ ID NO: 4, and the full length of the GmUPS2 gene CDS is 747 bp; the amino acid sequence of the protein encoded by the gene is as shown in SEQ ID NO: 1, and the protein has 248 amino acids.

[0083] 4. Analysis of GmUPS2 gene structure

[0084] The DNA in the tender leaves of soybean variety Williams 82 was extracted, and the genomic fragment of GmUPS2 gene was amplified from the genomic DNA as a template, and the genomic sequence of GmUPS2 gene is as shown in SEQ ID NO: 2 and SEQ ID NO: 3, and the full length is 3202 bp, containing 5 exons and 4 introns. Figure 3 and Figure 4

[0085] Example 2

[0086] The GmUPS1 and GmUPS2 double knock mutant (CR_gmups1 / 2#1, CR_gmups1 / 2#2) was constructed by CRISPR-Cas9 technology, and the specific process is as follows:

[0087] 1. Design of GmUPS1 and GmUPS2 gene knockout target sequence

[0088] The GmUPS1 gene was searched in Arabidopsis database (www.arabidopsis.org), and the amino acid sequence was obtained. The BLAST tool (https: / / phytozome-next.jgi.doe.gov / blast-search) was used to search the protein sequence of GmUPS1 in Phytozome database (https: / / phytozome.jgi.doe.gov / pz / portal.html), and the homologous sequence of GmUPS1 in soybean was obtained. Glycine max ​The corresponding homologous genes in the (soybean) genome were searched. The DNA sequences of GmUPS1 and GmUPS2 were inputted into the CRISPR design tool (http: / / cfans-pmorrell.oit.umn.edu / CRISPR / ) to select the DNA sequences conserved in both genes and design and synthesize the target oligonucleotide sequence (oligo) containing a sticky end.

[0089] Oligonucleotide sequence:

[0090] F: 5'- gattGTTAGGGCGCAAGTGGTGGGA-3' (SEQ ID NO: 9)

[0091] R: 5'- aaacTCCCACCACTTGCGCCCTAAC-3' (SEQ ID NO: 10)

[0092] 2. gRNA cloning

[0093] The synthesized target oligonucleotide sequence (oligo) was diluted and annealed (50°C, 6 hours), and the pBlu gRNA (https: / / stuparlab.cfans.umn.edu / protocols / crisprcas9-glycine-max) vector was digested with BbsI (New England Biolabs, Ipswich, MA, USA). Figure 5 The enzyme digestion product was separated by gel electrophoresis, and the 3500 bp vector fragment was extracted. The annealed oligonucleotide sequence (oligo) was ligated with the enzyme-digested pBlu gRNA vector (using T4 ligase, 16°C overnight). The ligation product was transformed into E. coli (DH5a), and positive clones were screened. The plasmid was extracted and sequenced (using T3 primer 5'-aattaaccctcactaaaggg-3', SEQ ID NO: 15), and the gRNA sequence was confirmed to be correct. The nucleotide sequence of the gRNA knockout target is shown in SEQ ID NO: 5.

[0094] 3. gRNA insertion into Cas9 vector

[0095] The verified pBlu gRNA vector and the target Cas9 vector were digested with EcoRI. The enzyme digestion product was separated by gel electrophoresis, and the 557 bp gRNA fragment was extracted. The gRNA fragment was ligated with the enzyme-digested Cas9 vector (https: / / stuparlab.cfans.umn.edu / protocols / crisprcas9-glycine-max) (New England Biolabs, Ipswich, MA, USA). Figure 6) and the ligation product was transformed into E. coli (DH5a) and positive clones were screened. Positive clones were screened by colony PCR to confirm the correct insertion of the gRNA fragment. Plasmids were extracted and sequenced to ensure the correct construction of the vector.

[0096] 4. Transformation of soybean and screening of positive plants

[0097] The constructed CRISPR-Cas9 vectors were introduced into Williams 82 soybean callus by Agrobacterium-mediated transformation method. The positive transformed plants were screened using the selection marker Bar cassette. The genomic DNA of the transformed plants was extracted, and the knockout of the target gene was verified by PCR and sequencing to confirm whether it was a homozygous knockout plant. The knockout results are shown in Figure 7 CR_gmups1 / 2#1 CR_gmups1 deleted 5 bases near the mutation site, and CR_gmups2 deleted 2 bases near the mutation site. CR_gmups1 / 2#2 CR_gmups1 deleted 1 base near the mutation site, and CR_gmups2 deleted 1 base near the mutation site.

[0098] Example 3

[0099] CRISPR-Cas9 double knockout mutants (CR_gmups1 / 2#1, CR_gmups1 / 2#2) and Williams 82 seed size determination, with Williams 82 seed size as control, the specific method is as follows:

[0100] Randomly take 10 full seeds of each variety, tightly arrange them in a row, with the hilum of each seed all facing the same direction, then measure the total length of the row of seeds, and then calculate the average length of the row of seeds. The length is taken as the seed length of the variety Figure 8 A).

[0101] Randomly take 10 full seeds of each variety, tightly arrange them in a row, with the hilum of each seed tightly arranged to the previous seed, then measure the total length of the row of seeds, and then calculate the average length of the row of seeds. The length is taken as the seed width of the variety Figure 8 B).

[0102] Williams 82, CR_gmups1 / 2#1 and CR_gmups1 / 2#2 were harvested from 10 single plants, respectively, and the seed area, hundred seed weight and single plant seed number of each single plant were determined. The average value of the determination results of all single plants of each variety was taken as the seed area, hundred seed weight and single plant seed number of each variety, and the determination results are shown in Figure 9 .

[0103] From the above experimental results, compared with the control group (Williams 82), the size and hundred seed weight of CR_gmups1 / 2#1 and CR_gmups1 / 2#2 were significantly improved, indicating that GmUPS1 and GmUPS2 proteins negatively regulate soybean size, and mutation of GmUPS1 and GmUPS2 can effectively improve soybean seed size, so GmUPS1 and GmUPS2 can be used as potential targets for high-yield soybean breeding.

[0104] Although the present application has been described in detail with general description and specific embodiments above, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of protection required by the present application.

Claims

1. Application of knockout of soybean GmUPS1 and GmUPS2 genes and their encoded proteins in improving soybean seed size; in, The soybean GmUPS1 gene is a gene that encodes a protein with the amino acid sequence shown in SEQ ID NO:1, and the soybean GmUPS2 gene is a gene that encodes a protein with the amino acid sequence shown in SEQ ID NO:

3.

2. A method for increasing soybean seed size, characterized in that, The soybean GmUPS1 and GmUPS2 genes were modified to lose their function, thereby increasing the size of soybean seeds. Among them, the soybean GmUPS1 gene is a gene that encodes a protein with an amino acid sequence as shown in SEQ ID NO:1, and the soybean GmUPS2 gene is a gene that encodes a protein with an amino acid sequence as shown in SEQ ID NO:

3.

3. The method according to claim 2, characterized in that, The method includes: using the common conserved sequence of soybean GmUPS1 and GmUPS2 genes as a target, designing a CRISPR-Cas9-based gRNA sequence, ligating a DNA fragment containing the encoding the gRNA sequence into a vector carrying CRISPR-Cas9, transforming soybeans, and thus obtaining transgenic soybeans with the loss of function of both GmUPS1 and GmUPS2 genes. The DNA fragment encoding the gRNA sequence is formed by F and R annealing as follows: F:5'- gattGTTAGGGCGCAAGTGGTGGGA-3'; R:5'-aaacTCCCACCACTTGCGCCCTAAC-3'.

4. The application of the transgenic soybean obtained according to claim 1 or the method of claim 2 or 3 in breeding to improve soybean seed size.

5. The application according to claim 4, characterized in that, Breeding methods include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

Images