Ciliate specific primer, ciliate specific long primer suitable for amplicon sequencing technology, kit and application

Abstract

The invention provides a ciliate specific primer, a ciliate specific long primer suitable for an amplicon sequencing technology, a kit and application, and particularly belongs to the technical field of molecular biological detection and high-throughput gene sequencing. According to the present invention, the ciliate specific primer comprises a forward primer CS322F and a reverse primer CS819R, the ciliate specific long primer suitable for amplicon sequencing comprises a forward long primer LCS322F and a reverse long primer LCS819R. The ciliate specific primer disclosed by the invention has ciliate broad-spectrum universality, is adaptive to a short-read-length high-throughput sequencing method, and can be used for comprehensively analyzing the diversity and ecological functions of ciliate communities. Accurate detection and efficient analysis of ciliate communities can be realized, and technical support is provided for environmental monitoring, germplasm resource development and ecological assessment.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology detection and high-throughput gene sequencing, and particularly relates to ciliate-specific primers, ciliate-specific long primers suitable for amplicon sequencing technology, a kit and applications thereof. Background Art

[0002] Ciliophora protozoa, an important group of eukaryotic microorganisms, are widely distributed in water, soil, and inside and outside animals. They are key drivers of material circulation and energy flow in ecosystems. Research on their diversity is important for assessing environmental health, guiding ecological restoration, and developing germplasm resources. However, traditional methods for identifying ciliates (such as morphological observation, silver staining, and Sanger sequencing) are inefficient, time-consuming, and costly, making them difficult to meet the needs of high-throughput analysis of complex environmental samples.

[0003] Morphological identification method: Based on microscopic observation and silver staining, classification relies on the morphological characteristics of ciliates (such as living morphology, ciliary pattern, nuclear structure, etc.). Although this method is intuitive, it is inefficient, time-consuming, has a high threshold, and cannot distinguish between closely related species with similar morphology, thus limiting its accuracy.

[0004] Sanger sequencing technology: amplifies specific genes (such as 18S rRNA gene, cox1) through PCR and performs single template sequencing for species identification and phylogenetic analysis. Although the accuracy is high, the throughput is low and the cost is high, which makes it difficult to meet the needs of large-scale detection of complex environmental samples. For example, the currently designed ciliate-specific primers (amplification length > 800bp) rely on high-cost first- or third-generation sequencing technologies (such as Sanger sequencing, nanopore sequencing, PacBio sequencing technology, etc.), and cannot be adapted to high-throughput short-sequence sequencing platforms such as Illumina and BGI short-read sequencing modes. The cost of long-fragment sequencing is too high, and large-scale detection is unaffordable;

[0005] Universal primer amplicon sequencing and analysis: 18S rRNA gene fragments are amplified using universal eukaryotic primers (such as primers for the V4 region or V8-V9 region of the 18S rRNA gene) and combined with high-throughput sequencing to analyze ciliate diversity. However, non-specific amplification using universal primers results in a large amount of sequencing data being wasted on non-target organisms (such as algae, fungi, and other protozoa), significantly reducing the specificity and cost-effectiveness, sensitivity, and accuracy of ciliate detection.

[0006] Existing Ciliate-specific amplification primers only target specific functional groups (such as the subclass of Psoralea and Oligochaeta) or disease-related species (such as the multi-sperming Ichthyophthirius, the irritating Cryptocaryon, the shield-like ciliates, etc.), lack the broad-spectrum versatility of the Ciliate phylum, and it is difficult to comprehensively analyze the diversity and ecological functions of ciliate communities in environmental samples.

[0007] With the widespread adoption of next-generation sequencing (NGS) technology, amplicon sequencing and analysis have become a mainstream method for studying microbial communities. However, there is an urgent need to develop primer pairs that are both specific for a broad range of ciliate groups and compatible with short-read, high-throughput sequencing. This will enable accurate detection and efficient analysis of ciliate communities, providing technical support for environmental monitoring, germplasm resource development, and ecological assessment. Summary of the Invention

[0008] The present invention aims to provide ciliate-specific primers, long ciliate-specific primers suitable for amplicon sequencing, and kits and applications thereof. The ciliate-specific primers of the present invention possess broad versatility across the phylum Ciliate, are compatible with short-read, high-throughput sequencing methods, and can be used to comprehensively analyze the diversity and ecological functions of ciliate communities. They enable precise detection and efficient analysis of ciliate communities, providing technical support for environmental monitoring, germplasm resource development, and ecological assessment.

[0009] The present invention provides ciliate-specific primers, comprising a forward primer CS322F and a reverse primer CS819R; the nucleotide sequence of the forward primer CS322F is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer CS819R is shown in SEQ ID NO.2.

[0010] The present invention also provides ciliate-specific long primers suitable for amplicon sequencing, comprising a forward long primer LCS322F and a reverse long primer LCS819R; the forward long primer LCS322F comprises, in order from the 5′ end to the 3′ end, a first linker sequence and the forward primer CS322F in the above technical solution, and the nucleotide sequence of the forward long primer LCS322F is shown in SEQ ID NO.3; the reverse long primer LCS819R comprises, in order from the 5′ end to the 3′ end, a second linker sequence and the reverse primer CS819R in the above technical solution, and the nucleotide sequence of the reverse long primer LCS819R is shown in SEQ ID NO.4.

[0011] Preferably, the first adapter sequence includes a P5 sequence, a tag sequence and a first sequencing reaction primer sequence in order from the 5′ end to the 3′ end, and the second adapter sequence includes a P7 sequence, a tag sequence and a second sequencing reaction primer sequence in order from the 5′ end to the 3′ end.

[0012] Preferably, the nucleotide sequence of the P5 sequence is shown as SEQ ID NO.5; the nucleotide sequence of the P7 sequence is shown as SEQ ID NO.6; the tag sequence is a sequence formed by 8 bases in different arrangements and combinations; the nucleotide sequence of the first sequencing reaction primer sequence is shown as SEQ ID NO.7; and the nucleotide sequence of the second sequencing reaction primer sequence is shown as SEQ ID NO.8.

[0013] Preferably, the nucleotide sequence of the forward long primer LCS322F is shown as SEQ ID NO.9 or SEQ ID NO.10, and the nucleotide sequence of the reverse long primer LCS819R is shown as SEQ ID NO.11 or SEQ ID NO.12.

[0014] The present invention also provides a kit for ciliate-specific amplification or analysis of ciliate diversity, which comprises the ciliate-specific primers described in the above technical solution or the ciliate-specific long primers suitable for amplicon sequencing described in the above technical solution and a reaction solution.

[0015] The present invention also provides the use of the ciliate-specific primer described in the above technical solution, or the ciliate-specific long primer suitable for amplicon sequencing described in the above technical solution, or the kit described in the above technical solution in the effects as described in any one of items ① to ④:

[0016] ① Accurately detect and efficiently analyze the community structure and biodiversity of ciliate groups;

[0017] ② Perform short-read high-throughput amplicon sequencing;

[0018] ③ Reduce sequencing costs;

[0019] ④ Specific amplification of a wide range of ciliate groups.

[0020] The present invention provides ciliate-specific primers. The ciliate-specific primers of the present invention are primers that specifically amplify the variable regions V2 to V4 of the ciliate 18S rRNA gene. The ciliate-specific primers of the present invention are highly specific, and the primers only amplify ciliate target sequences in artificial and natural communities, eliminating interference from non-target organisms such as fungi and other protozoan groups, thereby ensuring efficient utilization of sequencing data. The ciliate-specific primers of the present invention have broad versatility across the ciliate phylum, are compatible with short-read high-throughput sequencing methods, and can be used to comprehensively analyze the diversity and ecological functions of ciliate communities. They can achieve accurate detection and efficient analysis of ciliate communities, providing technical support for environmental monitoring, germplasm resource development, and ecological assessment. Test results show that the ciliate-specific primer pair CS322F and CS819R exhibited high specificity for ciliates in the test, and their amplification specificity for ciliates was greatly improved compared to the universal primers for eukaryotes (82F / EUKB).

[0021] On this basis, the present invention adds a high-throughput sequencing adapter sequence and designs a ciliate-specific long primer (specific amplicon long primer) suitable for amplicon sequencing. The ciliate-specific long primer suitable for amplicon sequencing of the present invention has high specificity and high sensitivity, can accurately amplify all ciliate target sequences in artificial communities, and comprehensively analyze the ciliate biodiversity in artificial communities and environmental samples. The ciliate-specific long primer suitable for amplicon sequencing of the present invention can be directly applied to short-read high-throughput amplicon sequencing and analysis technology, quickly and efficiently analyzing the community structure and biodiversity of the entire ciliate group in environmental samples and inferring ecological functions. Moreover, the application of the ciliate-specific long primer suitable for amplicon sequencing of the present invention can greatly reduce the cost of library construction and sequencing. The experimental results show that the present invention is verified by using an artificial community composed of a mixture of 13 ciliates and 4 other eukaryotic microbial DNAs and communities in environmental samples, confirming that the primers only specifically amplify the ciliate target sequence in the artificial community and can completely cover all target ciliate sequences. Compared with the universal long primers (L1889F / L1889R), the specificity is greatly improved and the sensitivity is not reduced; at the same time, it is further confirmed by real repeated environmental samples that compared with the universal long primers (L18V4F / L18V4R), the primers have high specificity and high sensitivity (the proportion of characteristic sequences of the ciliate group is greatly increased); the specific amplicon length of the present invention is The results of amplicon analysis from artificial communities and environmental samples show that the proportion of ciliate-specific sequences amplified by specific long primers is significantly higher than that obtained by universal eukaryotic primers (the proportion of ciliate-specific sequences in artificial community verification is 100%, while the proportion of ciliate-specific sequences obtained by amplicon sequencing using universal eukaryotic primers is 12.91%; the proportion of ciliate-specific sequences in environmental sample verification is 99.7%, while the proportion of ciliate-specific sequences obtained by amplicon sequencing using universal eukaryotic primers is 29.46%). This means that to obtain the same amount of target ciliate sequences, the sequencing amount using universal primers needs to be increased several times. The present invention reduces reagent consumption, operation time, and sequencing data waste, significantly lowering costs and enabling a more comprehensive analysis of ciliate diversity and ecological functions in environmental samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other implementation scenarios can be obtained based on these drawings without paying any creative work.

[0023] Figure 1 A technical roadmap for the ciliate-specific primers and their applications suitable for amplicon sequencing technology provided by the present invention;

[0024] Figure 2 Schematic diagram of the division of the variable region of the ciliate 18S rRNA gene (V1-V5, V7-V9 regions) and the structure of the amplicon long primers provided by the present invention, using the variable region of the Saccharomyces cerevisiae 18S rRNA gene as a reference;

[0025] Figure 3 The present invention provides morphological photos of artificial colony ciliates, wherein: (A): Colpoda aspera; (B): Colpoda elliotti; (C): Colpodasteinii; (D): Metanophrys cf.sinensis; (E): Glauconema trihymene; (F): Euplotes rariseta; (G): Tetrahymenapyriformis; (H): Paramecium biaurelia; (I): Uronema apomarinum; (J): Apourosomoida sp.; (K): Chaenea vorax); (L): Euplotes vannus; (M): Blepharismasinuosum;

[0026] Figure 4The present invention provides gel electrophoresis results of ciliate-specific primers (CS322F & CS819R) and eukaryotic universal primers (82F & EUKB); wherein: a) electrophoresis diagram of PCR amplification of target fragments of different species using ciliate-specific primers (CS322F / CS819R); b) electrophoresis diagram of PCR amplification of 18S rRNA genes of different species using eukaryotic universal primers (82F / EUKB); M: DNA relative molecular standard (DL2000); 1: Colpoda steinii; 2: Colpoda elliotti; 3: Colpoda aspera; 4: Blepharismasinuosum; 5: Chaenea vorax; 6: Paramecium spp. biaurelia); 7: Tetrahymenapyriformis; 8: Uronema apomarinum; 9: Glauconema trihymene; 10: Metanophrys cf. sinensis; 11: Euplotes rariseta; 12: Euplotes vannus; 13: Apourosomoida sp.; 14: Rhodotorula mucilaginosa; 15: Saccharomyces cerevisiae; 16: Schizosaccharomyces pombe; 17: Poterioochromonas sp.

[0027] Figure 5 A bar chart showing relative abundance of species in artificial communities provided by the present invention;

[0028] Figure 6 This is a bar chart showing the relative abundance of various groups in the soil environmental samples provided by the present invention. DETAILED DESCRIPTION

[0029] The present invention provides ciliate-specific primers, including a forward primer CS322F and a reverse primer CS819R; the nucleotide sequence of the forward primer CS322F is shown in SEQ ID NO.1: 5′GATGGTAGTGTATTGGAC3′, and the nucleotide sequence of the reverse primer CS819R is shown in SEQ ID NO.2: 5′CTATTCCATTATTCCATGCT3′. Based on the complete sequence analysis of 18S rRNA genes of 102 species of ciliates (including all 13 classes of the Ciliophora) and 19 other protozoan groups, the present invention determines that the V2 to V4 region is a highly variable region, and screens out primer pairs that are conserved within the Ciliophora and amplify the V2 to V4 region. The ciliate-specific primers of the present invention are primers that target amplification of highly variable regions, can optimize species detection, and are compatible with amplicon sequencing. The V2-V4 variable regions are highly variable in the ciliate 18S rRNA gene, effectively distinguishing closely related species and significantly improving the accuracy of species identification. The V2-V4 regions (450-550 bp) are selected to adapt to short-read sequencing adapters for short-read amplicon sequencing, which can be used to construct amplicon libraries and adapt to high-throughput sequencing platforms of various domestic and foreign brands for direct high-throughput sequencing.

[0030] The present invention also provides a ciliate-specific long primer suitable for amplicon sequencing, comprising a forward long primer LCS322F and a reverse long primer LCS819R; the forward long primer LCS322F comprises, in order from 5' to 3' end, a first linker sequence and the forward primer CS322F in the above technical solution, and the nucleotide sequence of the forward long primer LCS322F is as shown in SEQ ID NO.3: AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGT CAGATGTGTATAAGAGACAGGATGGTAGTGTATTGGAC, in the sequence of the present invention, the letter N represents any one of the bases A, T, C and G, the reverse long primer LCS819R comprises, in order from 5' to 3' end, a second linker sequence and the reverse primer CS819R in the above technical solution, and the nucleotide sequence of the reverse long primer LCS819R is as shown in SEQ ID As shown in NO.4: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAG ATGTGTATAAGAGACAGCTATTCCATTATTCCATGCT. The present invention has confirmed through artificial community verification experiments that the ciliate-specific long primers suitable for amplicon sequencing of the present invention have high sensitivity, high specificity, and high amplification efficiency; they can be directly applied to short-read high-throughput amplicon sequencing and analysis technology to quickly and efficiently analyze the community structure and biodiversity of the entire ciliate group in environmental samples and infer ecological functions. Moreover, the application of the ciliate-specific long primers suitable for amplicon sequencing of the present invention can greatly reduce the cost of library construction and sequencing.

[0031] In a specific embodiment, the first adapter sequence includes a P5 sequence, a tag sequence and a first sequencing reaction primer sequence in order from the 5′ end to the 3′ end, and the second adapter sequence includes a P7 sequence, a tag sequence and a second sequencing reaction primer sequence in order from the 5′ end to the 3′ end. In a specific embodiment, the nucleotide sequence of the P5 sequence is shown in SEQ ID NO.5: AATGATACGGCGACCACCGAGATCTACAC; the nucleotide sequence of the P7 sequence is shown in SEQ ID NO.6: CAAGCAGAAGACGGCATACGAGAT; the sample barcode tag sequence (Index, or Barcode) refers to a short nucleotide sequence of a fixed length (8 bp is used in the present invention) that is artificially synthesized and added to both ends of the sequencing library (DNA or cDNA fragment) to distinguish different samples; the nucleotide sequence of the first sequencing reaction primer sequence is shown in SEQ ID NO.7: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG; the nucleotide sequence of the second sequencing reaction primer sequence is shown in SEQ ID NO.8: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG. In a specific embodiment, the nucleotide sequence of the forward long primer LCS322F is as shown in SEQ ID NO.9 (AATGATACGGCGACCACCGAGATCTACACAGCACCTCTCGTCGGCAGCG TCAGATGTGTATAAGAGACAGGATGGTAGTGTATTGGAC) or SEQ ID NO.10 (AATGATACGGCGACCACCGAGATCTACACCCGAAGTATCGTCGGCAGCG TCAGATGTGTATAAGAGACAGGATGGTAGTGTATTGGAC), and the nucleotide sequence of the reverse long primer LCS819R is as shown in SEQ ID NO.11 (CAAGCAGAAGACGGCATACGAGATACGCTCGAGTCTCGTGGGCTCGGA GATGTGTATAAGAGACAGCTATTCCATTATTCCATGCT) or SEQ ID NO.12 (CAAGCAGAAGACGGCATACGAGATAAGGTGCGGTCTCGTGGGCTCGGA GATGTGTATAAGAGACAGCTATTCCATTATTCCATGCT).

[0032] The ciliate-specific long primers suitable for amplicon sequencing described herein can be used to construct an amplicon sequencing library. The construction method comprises constructing the amplicon sequencing library using the ciliate-specific long primers suitable for amplicon sequencing described in the above technical solution via a one-step amplification method. In a specific embodiment, the reaction system for the one-step amplification method comprises, per 25 μl, 12.5 μl of 2×KeyPo MasterMix, 1 μl each of a 10 μM forward long primer LCS322F and a 10 μM reverse long primer LCS819R, 2 μl of DNA, and 8.5 μl of ultrapure water. In a specific embodiment, the reaction procedure for the one-step amplification method comprises: 98°C for 30 seconds; 32 cycles of 98°C for 30 seconds, 46°C for 5 seconds, and 72°C for 5 seconds; and finally, 72°C for 1 minute. The present invention adopts one-step PCR amplification to construct the library. Combined with the high-specificity amplification advantage of the primers of the present invention, it can achieve dual-effect cost reduction. Specifically, compared with the traditional two-step amplification method (first amplifying the target fragment, purifying it, and then connecting the adapter and label to achieve library construction), the one-step PCR amplification method can achieve rapid and low-cost (several times lower than the price of sequencing companies) amplicon library construction by integrating the primer adapter and amplification steps; compared with universal amplicon primers for eukaryotes, the primers of the present invention eliminate most non-target biological interference, avoid wasting sequencing data on non-ciliate groups, and can significantly reduce library construction and sequencing costs while ensuring the acquisition of target sequences.

[0033] The present invention also provides a kit for ciliate-specific amplification or analysis of ciliate diversity, comprising the ciliate-specific primers described in the above technical solution or the ciliate-specific long primers suitable for amplicon sequencing described in the above technical solution, and a reaction solution. In a specific embodiment, the reaction solution comprises 2×KeyPo MasterMix.

[0034] The present invention also provides the use of the ciliate-specific primer described in the above technical solution, or the ciliate-specific long primer suitable for amplicon sequencing described in the above technical solution, or the kit described in the above technical solution in the effects as described in any one of items ① to ④:

[0035] ① Accurately detect and efficiently analyze the community structure and biodiversity of ciliate groups;

[0036] ② Perform short-read high-throughput amplicon sequencing;

[0037] ③ Reduce sequencing costs;

[0038] ④ Specific amplification of a wide range of ciliate groups.

[0039] The primers of the present invention can specifically amplify the variable regions V2 to V4 of the ciliate gene sequence, and are compatible with short-read, high-throughput amplicon sequencing and analysis technology. They can quickly and efficiently analyze the community structure and biodiversity of the entire ciliate group in environmental samples and infer ecological functions, such as in biodiversity surveys. The primers of the present invention have high specificity and can solve problems such as the serious waste of sequencing throughput caused by the use of non-specific primers, the low proportion of target group sequences, and incomplete analysis of community diversity. At the same time, the primers of the present application can perform amplicon sequencing on a wide range of ciliate groups, achieving more accurate detection and more efficient analysis of ciliate communities, providing technical support for environmental monitoring, germplasm resource development, and ecological assessment.

[0040] To further illustrate the present invention, the ciliate-specific primers, ciliate-specific long primers suitable for amplicon sequencing technology, and kits and applications provided by the present invention are described in detail below in conjunction with Example 1 (Verification of the specificity of long primers for ciliate amplicon based on artificial communities) and Example 2 (Verification of the specificity of long primers for ciliate amplicon based on soil communities). However, these should not be construed as limiting the scope of protection of the present invention.

[0041] Example 1

[0042] 1. Experimental Materials

[0043] 1.1 Experimental supplies:

[0044] Table 1 Main reagents and instruments

[0045]

[0046] 1.2 Experimental samples:

[0047] A total of 17 species (including 13 ciliates and 4 non-ciliate eukaryotes, see Table 2 for details) were isolated and identified from soil samples, seawater samples and the germplasm resource bank of the Evolutionary Genomics Laboratory of Ocean University of China for use in constructing artificial communities.

[0048] Table 2 Species used to construct artificial communities and their related information

[0049]

[0050]

[0051] 2. Experimental Methods

[0052] 2.1 Primer design and synthesis: Based on the 18S rRNA gene sequences downloaded from the NCBI nucleotide database, covering all 13 classes of Ciliates and 19 other common non-ciliate protozoa. A new primer combination of ciliate-specific forward primer CS322F and reverse primer CS819R was designed. MEGA v11.0.13 was used for multiple sequence alignment to screen for conserved regions. The design strategy was as follows: (1) Forward primer CS322F targeted the hypervariable region V2; (2) Reverse primer CS819R targeted the conserved region V4, amplifying a fragment length of 450-550 bp (V2-V4 region), which is suitable for amplicon sequencing. Primer specificity was further verified by Primer-BLAST v2.5.0 (matching only ciliate sequences), and primer dimers (ΔG <-5 kcal / mol), hairpin structure, and Tm value (forward 46°C, reverse 51°C) were evaluated using Oligo v7.56. At the same time, by adding Illumina high-throughput sequencing adapters, the present invention newly designed a specific amplicon long primer set (forward LCS322F and reverse LCS819R), as well as a eukaryotic V8-V9 region amplicon long primer (forward primer L1889F and reverse primer L1889R) used as the control primers.

[0053] 2.2 Collection, identification and DNA extraction of artificial community species: Single cells were isolated using a mouth pipette (0.5 mm diameter capillary glass tube stretched to 50-100 μm diameter), washed with double-distilled water gradients and then inoculated into 96-well plates for culture. After 2 days of culture, PCR amplification was performed using the supernatant of a mixture of 4 μl of insect fluid and 4 μl of lysate as the DNA template. A 25 μl PCR system was constructed: 2 μl of DNA, 12.5 μl of 2× KeyPo MasterMix, 1 μl each of primers 82F and EUKB (82F: GAAACTGCGAATGGCTC, SEQ ID NO. 13; EUKB: TGATCCTTCTGCAGGTTCACCTAC, SEQ ID NO. 14, see Table 3 for details), and 8.5 μl of ultrapure water. The PCR program was as follows: initial denaturation at 98°C for 30 s, gradient cycling (98°C for 30 s, 69-51°C (ΔT = -1°C) for 5 s, 72°C for 5 s; 18 cycles), conventional cycling (98°C for 30 s, 51°C for 5 s, 72°C for 5 s; 18 cycles), and a final extension at 72°C for 1 min. Products were sequenced by Sanger sequencing and compared using BLAST (identity was determined to be ≥99% identical). Morphological observations were made using a Nikon Eclipse Ni-u microscope with a DS-RI2 camera. Samples were enriched based on size: organisms <50 μm were centrifuged at 2500 rpm (14°C, 5 min) and sorted using CytoFLEX SRT flow cytometry; organisms >50 μm were enriched by single-cell isolation and DNA extraction using MasterPure TM The kit was stored at -20°C for a long term after the concentration was detected by Qubit 3.0.

[0054] 2.3 Evaluation of specific primers: The ciliate specificity of primers CS322F and CS819R was confirmed by bioinformatics methods. 13 ciliate and 4 non-ciliate eukaryotic organisms were collected. For each species, specific primers were used to perform PCR amplification of the target region, and the results were evaluated. The evaluation effect was verified by PCR. The reaction system was 25μl: 12.5μl 2×KeyPo MasterMix, 1μl each of primers CS322F and CS819R (10μM), 2μl DNA, and 8.5μl ultrapure water. The PCR program was set as follows: pre-denaturation at 98℃ for 30s, (98℃ for 30s, 46℃ for 5s, 72℃ for 5s, 32 cycles), and final extension at 72℃ for 1min. Electrophoresis verification was performed using 1.5% agarose gel (Biowest ), run at 220 V for 20 min, and stain with YeaRed nucleic acid dye (Cat: 10202ES76). The target band was determined to be within the range of 450 to 550 bp by comparison with DL2000Plus Marker.

[0055] 2.4 Amplicon long primer library construction and sequencing: DNA of artificial community species was mixed in equal amounts, and amplicon library was constructed using a one-step amplification method. The reaction system and PCR procedure for the specific amplicon long primers (using primer combinations: LCS322F_1F (SEQ ID NO. 9) + LCS322F_1R (SEQ ID NO. 11) and LCS322F_2F (SEQ ID NO. 10) + LCS322F_2R (SEQ ID NO. 12), see Table 5 for details) were consistent with the PCR verification steps in the "Specific Primer Evaluation" section; the reaction system and PCR procedure for the eukaryotic universal long primers (using primer combinations: L1889F_1F (SEQ ID NO. 15) + L1889R_1R (SEQ ID NO. 17) and L1889F_2F (SEQ ID NO. 16) + L1889R_2R (SEQ ID NO. 18), see Table 5 for details) were consistent with the steps in the "Artificial Community Species Collection, Identification and DNA Extraction" section. The library was sent to Beijing Novogene Technology Co., Ltd. for PE300 sequencing using the BGI DNBSEQ-G99 instrument.

[0056] 2.5 Evaluation of Specific Amplicon Long Primers: Amplicon-based community composition analysis was performed on the offline data to evaluate the results. Amplicon analysis was performed using QIIME2 v2023.7. Raw reads were denoised and spliced ​​using qiime dada2, and chimera filtering was performed using qiime vsearch uchime-denovo. Categorical bar charts were plotted using ggplot2.

[0057] 3. Results

[0058] 3.1 Primer design and synthesis results: In the present invention, based on the ciliate-specific forward primer CS322F, a short reverse primer CS819R (Table 3) located in the conserved region of the V4 region was designed. This pair of primers amplifies the target gene spanning the V2 to V4 region (see Figure 2 The present invention developed a specific amplicon long primer set (forward LCS322F and reverse LCS819R) for one-step PCR amplicon library construction (Table 4).

[0059] Table 3 Ciliate-specific primer sequences and eukaryotic universal primer sequences

[0060]

[0061]

[0062] Table 4 Ciliate-specific amplicon long primers and internal structure sequences

[0063]

[0064] Note: The bold part in the forward primer is the P5 sequence, the bold part in the reverse primer is the P7 sequence, the wavy "NNNNNNNN" part is the sample barcode tag sequence (index), the italic part is the sequencing reaction primer sequence (sequencing primer), and the single underlined part is the primer of the target genomic region (primer of the target genomic region).

[0065] Table 5 Specific sequences of long primers for ciliate-specific amplicons and sequences of universal long primers for eukaryotes

[0066]

[0067] Note: S, Y and R are degenerate bases, R is A or G; Y is C or T; S is G or C.

[0068] 3.2 Collection, identification and DNA extraction of artificial colony species: 13 ciliate species were isolated and identified from soil and seawater samples and the germplasm resource bank of the Evolutionary Genomics Laboratory of Ocean University of China by Sanger sequencing using primers 82F and EUKB. Their taxonomic status is detailed in Table 2 and their morphological photos are detailed in Figure 3 , scale bar is 10 μm.

[0069] 3.3 Specific primer evaluation: Primer-BLAST v2.5.0 results showed that the length of the PCR products of the ciliate-specific primers CS322F and CS819R in the collected ciliate 18S rRNA gene sequences was distributed between 475 and 490 bp. According to the results of Oligo v7.56, the Tm value of the forward primer CS322F was 48.98°C, the GC content was 44.44%, and the Tm value of the reverse primer CS819R was 50.26°C, the GC content was 35%. Neither the forward nor the reverse primers formed a hairpin structure, and the probability of mismatch between the two was extremely low. The specific primer prediction results were in line with expectations. At the same time, the PCR products corresponding to the artificial community species were subjected to gel electrophoresis, and the electrophoresis results were detailed. Figure 4 The results of primers 82F and EUKB amplification were used as controls. The results showed that the electrophoresis bands of the universal primers 82F and EUKB for eukaryotic 18SrRNA gene sequences were bright and the sequence lengths were mostly 1,500 to 2,000 bp, which was consistent with the target fragment length of the universal primers ( Figure 4 In the experimental groups (CS322F and CS819R), the brightness of each band was relatively obvious, the bands were distributed in the range of 450 to 550 bp, and the band distribution was different among species ( Figure 4 (a) Except for Ciliostoma (pore 5), all other species showed a single distinct band, while the four non-ciliate species (pores 14-17) showed no band. This experimental test showed that the ciliate-specific short primers CS322F & CS819R had a high ciliate specificity of 100%.

[0070] Evaluation of specific amplicon long primers: Analyze the relative abundance of each species and draw a classification bar chart ( Figure 5 ). No non-ciliate sequences were analyzed from the amplicons using the specific amplicon long primers, thus obtaining high specificity (100%) and high sensitivity (100%) for the amplification of ciliates by the specific amplicon long primers, which greatly improved the specificity and maintained the sensitivity compared to the universal long primers for eukaryotes. Among them, the analysis results showed that the proportion of ciliate characteristic sequences amplified by the specific amplicon long primers was 100%, while the proportion of ciliate characteristic sequences amplified by the universal long primers for eukaryotes widely used today was 12.91%, which means that to obtain the same target ciliate sequence, the sequencing amount needs to be increased by 7.75 times. Therefore, the high-specificity ciliate amplicon long primers designed by the present invention have amplified target sequences spanning the V2 to V4 variable regions, have high variability, and can distinguish more ciliate species. At the same time, based on the one-step amplification and self-library construction method, compared with the conventional two-step amplification and library construction method, the present invention reduces reagent consumption and operation time, avoids the waste of sequencing data, greatly reduces costs, and can comprehensively analyze the diversity of ciliates in environmental samples.

[0071] Example 2

[0072] 1. Experimental Materials

[0073] 1.1 Experimental supplies:

[0074] Table 6 Main reagents and instruments

[0075]

[0076] 1.2 Experimental samples:

[0077] Four replicate soil samples were collected within 5 m of each other at the Yushan Campus of Ocean University of China (see Table 7 for sampling information).

[0078] Table 7 Soil sample sampling information

[0079]

[0080] 2. Experimental Methods

[0081] 2.1 Primer design and synthesis: The experiment used the newly designed specific amplicon long primer set of the present invention (forward LCS322F and reverse LCS819R), and also designed eukaryotic V4 region amplicon long primers (forward primer L18V4F and reverse primer L18V4R) for use as a control.

[0082] 2.2 Soil sample RNA extraction and cDNA reverse transcription: RNA was extracted from four soil samples using the Soil RNA Kit, and then reverse-transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (with cDNAwiper). DNA concentration was determined using Qubit 3.0 and stored at -20°C.

[0083] 2.3 Amplicon long primer library construction and sequencing: The cDNA obtained by reverse transcription was amplified using a one-step amplification method to construct an amplicon library. The primer combination, reaction system, and PCR procedure for the specific amplicon long primers were consistent with the steps in "2.4 Amplicon long primer library construction and sequencing" of Example 1; the reaction system and PCR procedure for the eukaryotic universal long primers (using primer combinations: L18V4F_1F (SEQ ID NO.19) + L18V4R_1R (SEQ ID NO.21) and L18V4F_2F (SEQ ID NO.20) + L18V4R_2R (SEQ ID NO.22), sequence information is detailed in Table 5) were consistent with the steps in "2.2 Artificial community species collection, identification, and DNA extraction" of Example 1. The library was sent to Beijing Novogene Technology Co., Ltd. for PE300 sequencing using the BGI DNBSEQ-G99 instrument.

[0084] 2.4 Evaluation of Specific Amplicon Long Primers: Amplicon-based community composition analysis was performed on the offline data to evaluate the results. Amplicon analysis was performed using QIIME2 v2023.7. Raw reads were denoised and spliced ​​using qiime dada2, and chimera filtering was performed using qiime vsearch uchime-denovo. Categorical bar charts were plotted using ggplot2.

[0085] 3. Results

[0086] 3.1 Evaluation of specific amplicon long primers: In the above Example 1, the composition of the detected ciliate group and its ratio relative to other eukaryotic microorganisms cannot reflect their true proportion in nature. Given that soil is a hotspot ecosystem rich in a variety of eukaryotic microbial groups, natural soil samples can be used as a representative test scenario for measuring the true proportion of ciliates. To this end, the present invention analyzed the relative abundance of ciliates in soil samples and drew a classification bar chart ( Figure 6 The analysis results showed that the proportion of ciliate-specific sequences amplified by the specific long primers was 99.7%, while the proportion of ciliate-specific sequences amplified by the universal long eukaryotic primers was 29.59%. Therefore, environmental samples further confirmed that the ciliate amplicon long primers designed by this invention have high specificity and sensitivity, and are expected to comprehensively analyze ciliate diversity in environmental samples.

[0087] Although the above two embodiments describe the present invention in detail, they are only partial embodiments of the present invention, not all embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A ciliate-specific primer, characterized in that: It includes a forward primer CS322F and a reverse primer CS819R; the nucleotide sequence of the forward primer CS322F is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer CS819R is shown in SEQ ID NO.

2.

2. A ciliate-specific long primer suitable for amplicon sequencing, characterized in that: It includes a forward long primer LCS322F and a reverse long primer LCS819R; the forward long primer LCS322F includes a first linker sequence and the forward primer CS322F in claim 1 in order from the 5′ end to the 3′ end, and the nucleotide sequence of the forward long primer LCS322F is shown in SEQ ID NO.3; the reverse long primer LCS819R includes a second linker sequence and the reverse primer CS819R in claim 1 in order from the 5′ end to the 3′ end, and the nucleotide sequence of the reverse long primer LCS819R is shown in SEQ ID NO.

4.

3. The ciliate-specific long primer suitable for amplicon sequencing according to claim 2, characterized in that: The first adapter sequence includes a P5 sequence, a tag sequence and a first sequencing reaction primer sequence in order from the 5′ end to the 3′ end, and the second adapter sequence includes a P7 sequence, a tag sequence and a second sequencing reaction primer sequence in order from the 5′ end to the 3′ end.

4. The ciliate-specific long primer suitable for amplicon sequencing according to claim 3, characterized in that: The nucleotide sequence of the P5 sequence is shown in SEQ ID NO.5; the nucleotide sequence of the P7 sequence is shown in SEQ ID NO.6; the tag sequence is a sequence formed by 8 bases in different arrangements and combinations; the nucleotide sequence of the first sequencing reaction primer sequence is shown in SEQ ID NO.7; and the nucleotide sequence of the second sequencing reaction primer sequence is shown in SEQ ID NO.

8.

5. The ciliate-specific long primer suitable for amplicon sequencing according to claim 2, characterized in that: The nucleotide sequence of the forward long primer LCS322F is shown as SEQ ID NO.9 or SEQ ID NO.10, and the nucleotide sequence of the reverse long primer LCS819R is shown as SEQ ID NO.11 or SEQ ID NO.

12.

6. A kit for ciliate-specific amplification or analysis of ciliate diversity, characterized in that: The kit comprises the ciliate-specific primer according to claim 1 or the ciliate-specific long primer suitable for amplicon sequencing according to any one of claims 2 to 5 and a reaction solution.

7. Use of the ciliate-specific primer according to claim 1, the ciliate-specific long primer suitable for amplicon sequencing according to any one of claims 2 to 5, or the kit according to claim 6 for the effects described in any one of items ① to ④: ① Accurately detect and efficiently analyze the community structure and biodiversity of ciliate groups; ② Perform short-read high-throughput amplicon sequencing; ③ Reduce sequencing costs; ④ Specific amplification of a wide range of ciliate groups.

Images