Method for detecting alicyclic bacillus contaminants

By detecting the vanillic acid decarboxylase (vdcC) gene variants in Alicyclobacillus strains, the problem of distinguishing spoiled strains from non-spoiled strains is solved, and early spoilage prediction and control of food and beverage products are achieved.

CN120752353APending Publication Date: 2025-10-03INVISIBLE SENTINEL INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202380094629.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-12-23
Filing Date
2023-12-20
Publication Date
2025-10-03

AI Technical Summary

Technical Problem

Existing technologies cannot effectively distinguish between strains of Alicyclobacillus that cause food and beverage spoilage and those that do not, and traditional detection methods cannot predict the likelihood of spoilage.

Method used

A mixture and method have been developed to detect specific variants of the vanillate decarboxylase (vdcC) gene in Alicyclobacillus strains, using primers and probes to bind to target nucleic acid molecules and perform PCR or isothermal amplification to detect the presence of gene variants that cause spoilage.

Benefits of technology

It enables early prediction of spoilage in food and beverage products, accurately identifies guaiacol-producing strains, and prevents spoilage from occurring.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120752353A_ABST
    Figure CN120752353A_ABST
Patent Text Reader

Abstract

The present embodiments relate to mixtures, systems, kits and methods useful for detecting strains of the genus Alicyclobacillus that express new genetic variants of the vdcC gene. Alicyclobacillus strains expressing these variants produce guaiacol that results in deterioration of fruit juice products. The methods and mixtures can be used to predict the likelihood of deterioration of fruit juice products contaminated by alicyclic acid bacillus.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 477,057, filed December 23, 2022, which is incorporated herein by reference in its entirety.

[0002] Sequence Listing This application contains a sequence listing, which is submitted electronically and is incorporated herein by reference in its entirety. The sequence listing is provided as a file created on December 18, 2023, with a size of 11,000 bytes and titled 02138WO-SequenceListing.xml. Technical Field

[0003] This embodiment relates to a method for detecting contaminated food and beverage products with the genus Alicyclobacillus ( Alicyclobacillus The presence of genetic variants in contaminating Alicyclobacillus species can be used to predict the likelihood of spoilage in food and beverage products. Background Art

[0004] The genus Alicyclobacillus includes several species of acidophilic, thermophilic, and spore-forming aerobic and facultative anaerobic motile Gram-positive rod-shaped bacteria that can be grown in the wild. . 5 to 6 . 5 and grow in the temperature range of 4°C to 70°C and can survive harsh environments, such as heat pasteurization, by forming endospores. A major source of spoilage and lost revenue in the food and beverage industry is the contamination of approximately 30% of raw materials used to produce juices with members of the genus Alicyclobacillus. Examples include the species Alicyclobacillus acidoterrestris ( A. acidoterrestris ), soil Alicyclobacillus ( A. terrestris ), A. pomorum 、Alicyclobacillus acidocaldarius( A. acidocaldarius ) and Alicyclobacillus acidophilus ( A. acidiphilus ). Live Alicyclobacillus spores are also heat-resistant, and the high temperatures experienced during heat pasteurization can stimulate spore germination, leading to possible spoilage, unsalable product, and product recalls. However, not all Alicyclobacillus organisms cause spoilage. Furthermore, current assays do not distinguish between Alicyclobacillus that cause spoilage and Alicyclobacillus that do not. There is a need in the art for a sensitive and conclusive detection assay that can detect Alicyclobacillus strains associated with beverage spoilage, as opposed to simply detecting all Alicyclobacillus strains. The present embodiment addresses this need. Summary of the Invention

[0005] The present disclosure relates to mixtures, methods, systems and kits suitable for detecting novel genetic variants of Alicyclobacillus species that contaminate food and beverage products. The presence of genetic variants in contaminating Alicyclobacillus species can be used to predict the likelihood of spoilage of food and beverage products.

[0006] Tests are available to identify the presence of Alicyclobacillus organisms. These are known in the art as ACB tests. However, as shown herein, a positive ACB test alone does not necessarily indicate deterioration; rather, deterioration occurs due to the production of guaiacol by the vanillic acid decarboxylase gene product expressed by some, but not all, Alicyclobacillus strains. The gene variants disclosed herein produce guaiacol, and their identification indicates the potential for deterioration in a test sample.

[0007] The invention described herein may suitably include mixtures that can be used to detect the disclosed gene variants. For example, the mixtures disclosed herein may contain primer pairs that bind to vanillate decarboxylase ( vC ) gene. The three disclosed gene variants have sequences of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. Each primer pair binds to a target nucleic acid molecule having a sequence of one of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a complementary sequence thereof, or a fragment thereof. The mixture may include deoxynucleotide triphosphates, a DNA polymerase, a buffer, and a test sample suspected of having at least one of the three gene variants.

[0008] In one example, the test sample can be a food, a food suspension, a food solution or a beverage. It can be raw fruit, cooked fruit, canned fruit, juice, juice product, mixed juice, carbonated juice drink, fruit-flavored tea, wine or fruit-flavored water.

[0009] The primer pairs in the mixture can be SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, or SEQ ID NO: 8 and SEQ ID NO: 5. In addition, the primer pairs can be the complement of one or more of these sequences.

[0010] In some embodiments, the mixture may include a probe that is bound to one of the target nucleic acid molecules or its complementary sequence or its fragment. The probe may be bound to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or its complementary sequence, or its fragment. The probe may have a sequence of SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11. Specifically, the probe with SEQ ID NO: 9 may be in a mixture of primers that bind to the target nucleic acid molecules of SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 4, and SEQ ID NO: 5. The probe with SEQ ID NO: 10 may be in a mixture of primers that bind to the target nucleic acid molecules of SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6, and SEQ ID NO: 7. The probe with SEQ ID NO: 11 may be in a mixture of primers that bind to the target nucleic acid molecules of SEQ ID NO: 3 or its complementary sequence, SEQ ID NO: 8, and SEQ ID NO: 5. The probe and primer pairs in the disclosed mixtures can also be complementary sequences to the sequences disclosed herein.

[0011] The present disclosure includes a method for detecting an organism (e.g., species of the genus Alicyclobacillus) suspected of having one of three target nucleic acid molecules (gene variants) described herein. For example, the method can include a step of reacting a test sample described herein with the first and second primers in conjunction with the target nucleic acid molecule under conditions sufficient to produce a detectable amplicon. The first and second primers can be one of primer pairs disclosed herein or their complementary sequences. The detectable amplicon can be one of the target nucleic acid molecules disclosed herein or its fragment. The method can also include a step of detecting the presence or absence of the detectable amplicon. In one example, the detectable amplicon is produced by one or more of polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR). In one example, the amplicon can be detected by one or more techniques including directly detecting a measure of a physical property of the amplicon, detecting UV absorbance at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye and detecting the dye; complexing the amplicon with a detectable label and detecting the presence of the label; detecting a detectable signal from a reporter molecule that produces a total detectable signal that is proportional to the number of copies of the amplicon in the sample; and detecting a detectable signal from two or more reporter molecules that produce a total detectable signal that is proportional to the number of copies of the amplicon in the sample.

[0012] The method may further comprise the step of reacting the test sample with a probe as described herein.The probe may be labeled with a detectable label.

[0013] In one embodiment, the primer pairs and probes used in the disclosed methods include a probe having SEQ ID NO: 9 and a primer pair having SEQ ID NO: 4 and SEQ ID NO: 5 to detect a target nucleic acid molecule of SEQ ID NO: 1. In a non-limiting example, this embodiment can be used to detect Alicyclobacillus acidoterrestris ( Alicyclobacillus acidoterrestris ) target nucleic acid molecules in amylolytic strains.

[0014] In another embodiment, the primer pairs and probes used in the disclosed methods include a probe having SEQ ID NO: 10 and a primer pair of SEQ ID NO: 6 and SEQ ID NO: 7 to detect the target nucleic acid molecule of SEQ ID NO: 2. In one non-limiting example, this embodiment can be used to detect Alicyclobacillus herbalis ( Alicyclobacillus herbarius ) target nucleic acid molecules of amylolytic strains.

[0015] In yet another embodiment, the primer pairs and probes used in the disclosed methods include a probe having SEQ ID NO: 11 and a primer pair of SEQ ID NO: 8 and SEQ ID NO: 5 to detect the target nucleic acid molecule of SEQ ID NO: 3. In one non-limiting example, this embodiment can be used to detect Alicyclobacillus carotovorax ( Alicyclobacillus dauci ) target nucleic acid molecules of amylolytic strains.

[0016] These methods can be used to detect contaminants comprising one of the target nucleic acids disclosed herein, its complement, or a fragment thereof.The methods disclosed herein can also be used to detect the potential for deterioration in a test sample, as disclosed herein.

[0017] In some embodiments, the method includes the step of reacting the test sample with more than one primer pair disclosed herein. In such an example, the method can be used to detect more than one contaminant in the test sample, each contaminant including one of the three target nucleic acid molecules disclosed herein.

[0018] In addition to more than one primer pair, the method can include the step of reacting the test sample with more than one probe disclosed herein. Such a mixture can be used to detect more than one contaminant in the test sample, each contaminant comprising one of the three target nucleic acid molecules disclosed herein.

[0019] The present disclosure also includes a system for detecting the disclosed target nucleic acid molecules or an organism or pollutant containing one or more target nucleic acid molecules. In an example, the system may include a mixture disclosed herein and an instrument configured to carry out amplification assay on the mixture. In some embodiments, the system may include a sample container. In some embodiments, the system may include one or more PCR reaction mixtures, such as a mixture disclosed herein. The PCR reaction mixtures may each be contained in a sample container. In some embodiments, the system further includes one or more sample temperature control devices. The temperature control device may be used to provide the sample with the temperature required for amplification assay.

[0020] The present disclosure also includes a kit. The kit may include reagents that can be used to produce the mixture disclosed herein and perform the method disclosed herein. In one example, the kit may include a first primer and a second primer to form a primer pair. The first primer may be substantially homologous to one of the target nucleic acid molecules disclosed herein, and the second primer may be substantially complementary to the target nucleic acid molecule to which the first primer is substantially homologous. The kit may additionally include deoxynucleotide triphosphates and a buffer. In some embodiments, the kit may further include a DNA polymerase.

[0021] In some embodiments, the kit includes a primer pair disclosed herein. In one example, the first primer has a sequence substantially homologous to the sequence of SEQ ID NO: 4, and the second primer has a sequence substantially homologous to the sequence of SEQ ID NO: 5. In another example, the kit further includes a probe having a sequence substantially homologous or substantially complementary to the sequence of SEQ ID NO: 9.

[0022] In another example, the kit includes a primer pair comprising a first primer having a sequence substantially homologous to the sequence of SEQ ID NO: 6 and a second primer having a sequence substantially homologous to the sequence of SEQ ID NO: 7. In yet another example, the kit further includes a probe having a sequence substantially homologous or substantially complementary to the sequence of SEQ ID NO: 10.

[0023] In another example, the kit includes a primer pair comprising a first primer having a sequence substantially homologous to the sequence of SEQ ID NO: 8 and a second primer having a sequence substantially homologous to the sequence of SEQ ID NO: 5. In yet another example, the kit further includes a probe having a sequence substantially homologous or substantially complementary to the sequence of SEQ ID NO: 11.

[0024] In some embodiments, the probes in the kits disclosed herein can be covalently bound to a detectable label. In another example, the probes in the kits disclosed herein can further include a quencher positioned to quench the signal from the detectable label.

[0025] What is described is: A1. A mixture comprising: a first primer that specifically binds to a target nucleic acid molecule comprising a sequence of any one of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof; a second primer that specifically binds to a complementary sequence of the target nucleic acid molecule; deoxynucleotide triphosphates; DNA polymerase; buffer; and A test sample is suspected of having a nucleic acid that is substantially homologous to the target nucleic acid molecule.

[0026] A2. A mixture of clause A1, wherein The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 4; and The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5.

[0027] A3. A mixture of clause A1, wherein The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 6; and The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7.

[0028] A4. A mixture of clause A1, wherein The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8; and The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5.

[0029] A5. The mixture of any one of clauses A1 to A4, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to the target nucleic acid molecule, or a fragment thereof, or a complementary sequence thereof.

[0030] A6. The mixture of clause A5, further comprising a detectable label, wherein the probe is covalently bound to the detectable label.

[0031] A7. The mixture of clause A5, wherein the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 9 or its complement, and the target nucleic acid molecule sequence comprises SEQ ID NO: 1, its complement, or a fragment thereof.

[0032] A8. The mixture of clause A5, wherein the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 10 or its complement, and the target nucleic acid molecule sequence comprises SEQ ID NO: 2, its complement, or a fragment thereof.

[0033] A9. The mixture of clause A5, wherein the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 11 or its complement, and the target nucleic acid molecule sequence comprises SEQ ID NO: 3, its complement, or a fragment thereof.

[0034] A10. The mixture of clause A1, wherein the test sample comprises a food, a food suspension, a food solution, or a beverage.

[0035] A11. The mixture of clause A10, wherein the test sample comprises one or more of the following: raw fruit, cooked fruit, canned fruit, juice, juice product, juice blend, carbonated juice drink, fruit-flavored tea, wine, and fruit-flavored water.

[0036] B1. A method for detecting an organism comprising a target nucleic acid molecule in a test sample, wherein the target nucleic acid molecule comprises a sequence substantially homologous to one of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof, the method comprising: reacting the test sample with a first primer comprising a sequence that specifically binds to the target nucleic acid molecule under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; and reacting the test sample with a second primer comprising a sequence that specifically binds to a complementary sequence of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; and The presence or absence of the detectable amplicon is detected.

[0037] B2. The method of clause B1, wherein the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule to which the first primer binds.

[0038] B3. The method of any of clauses B1 or B2, wherein The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 4, and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5; The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 6, and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7; or The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8, and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5.

[0039] B4. The method of clause B2, wherein The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 4, the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5, and the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 9; The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 6, the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7, and the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 10; or The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8, the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5, and the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 11.

[0040] B5. The method of clause B1, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0041] C1. A method for detecting an amylolytic strain of Alicyclobacillus acidoterrestris, the method comprising: reacting the test sample with a first primer comprising a sequence that specifically binds to a target nucleic acid comprising a sequence of SEQ ID NO: 1, a fragment thereof, or a complementary sequence thereof, and a second primer under conditions sufficient to produce a detectable amplicon comprising the sequence of SEQ ID NO: 1, a fragment thereof, or a complementary sequence thereof; and the second primer specifically binds to a complementary sequence of the target nucleic acid molecule to which the first primer binds; and The presence or absence of the amplicon is detected.

[0042] C2. The method of clause C1, wherein the first primer is substantially homologous to the sequence of SEQ ID NO: 4 or its complement, and the second primer is substantially homologous to the sequence of SEQ ID NO: 5 or its complement.

[0043] C3. The method of any one of clauses C1-C2, wherein the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule or its complement.

[0044] C4. The method of clause C3, wherein the probe is labeled with a detectable label.

[0045] C5. The method of clause C3, wherein the probe is substantially homologous to the sequence of SEQ ID NO: 9 or its complement.

[0046] D1. A method for detecting an amylolytic strain of herbal Alicyclobacillus sp., the method comprising: reacting the test sample with a first primer comprising a sequence that specifically binds to a target nucleic acid comprising a sequence of SEQ ID NO: 2, a fragment thereof, or a complement thereof, and a second primer that specifically binds to a complementary sequence of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the sequence of SEQ ID NO: 2, a fragment thereof, or a complement thereof; and The presence or absence of the amplicon is detected.

[0047] D2. The method of clause D1, wherein the first primer is substantially homologous to the sequence of SEQ ID NO: 6 or its complement, and the second primer is substantially homologous to the sequence of SEQ ID NO: 7 or its complement.

[0048] D3. The method of any one of clauses D1-D2, wherein the method further comprises reacting the test sample with a probe that specifically binds to the target nucleic acid molecule or a complementary sequence thereof.

[0049] D4. The method of clause D3, wherein the probe is labeled with a detectable label.

[0050] D5. The method of clause D3, wherein the probe is substantially homologous to the sequence of SEQ ID NO: 10 or a complementary sequence thereof.

[0051] E1. A method for detecting an amylolytic strain of Alicyclobacillus carotovorax, the method comprising: reacting the test sample with a first primer comprising a sequence that specifically binds to a target nucleic acid comprising a sequence of SEQ ID NO: 3, a fragment thereof, or a complement thereof, and a second primer that specifically binds to a complementary sequence of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the sequence of SEQ ID NO: 3, a fragment thereof, or a complement thereof; and The presence or absence of the amplicon is detected.

[0052] E2. The method of clause E1, wherein the first primer is substantially homologous to the sequence of SEQ ID NO: 8 or its complement, and the second primer is substantially homologous to the sequence of SEQ ID NO: 5 or its complement.

[0053] E3. The method of any one of clauses E1-E2, wherein the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule or its complement.

[0054] E4. The method of clause E3, wherein the probe is labeled with a detectable label.

[0055] E5. The method of clause E3, wherein the probe is substantially homologous to the sequence of SEQ ID NO: 11 or a complementary sequence thereof.

[0056] F1. A method for detecting a contaminant in a test sample, the contaminant comprising a target nucleic acid molecule having a sequence substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof, or a variant thereof, the method comprising: reacting the test sample with a first primer comprising a sequence that specifically binds to the target nucleic acid molecule under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; and reacting the test sample with a second primer comprising a sequence that specifically binds to a complementary sequence of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or its complement; and The presence or absence of the amplicon is detected, wherein the presence of the detectable amplicon indicates the presence of a contaminant in the test sample.

[0057] F2. The method of clause F1, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0058] F3. The method of clause F1, wherein the method for detecting the detectable amplicon comprises one or more steps selected from the group consisting of: Directly detecting a measure of a physical property of the amplicon, detecting UV absorbance at 260 nm; separating the amplicons; sequencing the amplicons; staining the amplicons with a dye and detecting the dye; complexing the amplicons with a detectable label and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the number of amplicon copies in the sample; and detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the number of amplicon copies in the sample.

[0059] G1. A method for detecting the possibility of spoilage in a test sample, comprising: Providing a test sample, wherein the test sample comprises a food, a food suspension, a food solution or a beverage, the method comprising: reacting the test sample with a first primer comprising a sequence that specifically binds to the target nucleic acid molecule, wherein the target nucleic acid molecule comprises the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or a complement thereof; and reacting the test sample with a second primer comprising a sequence that specifically binds to a complementary sequence of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or its complement; and The presence or absence of the detectable amplicon is detected, wherein the presence of the detectable amplicon indicates a positive spoilage likelihood for the test sample.

[0060] The method of clause G1, wherein the test sample comprises raw fruit, cooked fruit, canned fruit, juice, juice product, juice blend, carbonated juice drink, fruit-flavored tea, wine, or fruit-flavored water.

[0061] The method of clause G1, wherein the detectable amplicon is produced by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0062] The method of clause G1, wherein the method for detecting the detectable amplicon comprises one or more steps selected from the group consisting of: Directly detecting a measure of a physical property of the amplicon, detecting UV absorbance at 260 nm; separating the amplicons; sequencing the amplicons; staining the amplicons with a dye and detecting the dye; complexing the amplicons with a detectable label and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the number of amplicon copies in the sample; and detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the number of amplicon copies in the sample.

[0063] H1. A method for detecting at least one contaminant in a test sample, each contaminant comprising one of three target nucleic acid molecules, each of the three target nucleic acid molecules having a sequence substantially homologous to one of the sequences of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof, or a variant thereof, the method comprising: The test sample is reacted with a first primer, a second primer, a third primer, a fourth primer, and a fifth primer under conditions sufficient to produce three detectable amplicons, wherein The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 4, The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5, The third primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 6, The fourth primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7, The fifth primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8, The three detectable amplicons comprise the three target nucleic acid molecules, or fragments thereof, or complementary sequences thereof; and The presence or absence of each of the three amplicons is detected, wherein the presence of any one of the three amplicons indicates the presence of a contaminant in the test sample.

[0064] H2. The method of clause H1, further comprising reacting the test sample with: a first probe comprising a sequence substantially homologous to the sequence of SEQ ID NO: 9; a second probe comprising a sequence substantially homologous to the sequence of SEQ ID NO: 10; and A third probe comprising a sequence substantially homologous to the sequence of SEQ ID NO: 11.

[0065] I1. A system comprising: A mixture of any one of clauses A1-A4; and An instrument configured to perform an amplification assay on the mixture.

[0066] I2. The system of claim I1, further comprising at least one sample container.

[0067] I3. The system of clause I2, further comprising at least one PCR reaction mixture, wherein each of the PCR reaction mixtures is contained in one of the at least one sample container.

[0068] I4. The system of claim I1, further comprising at least one sample temperature control device.

[0069] I5. The system of clause I1, wherein the mixture further comprises a probe comprising a sequence substantially homologous to the target nucleic acid molecule or a fragment thereof or a complementary sequence thereof.

[0070] J1. A kit comprising: a first primer comprising a sequence substantially homologous to a target nucleic acid molecule comprising the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3; a second primer comprising a sequence substantially complementary to the target nucleic acid molecule to which the first primer is substantially homologous; deoxynucleotide triphosphates; and Buffer.

[0071] J2. The kit of item J1, further comprising a DNA polymerase.

[0072] J3. The kit of clause J1, wherein the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 4; and The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5.

[0073] J4. The kit of clause J3, further comprising a probe, wherein the probe comprises a sequence substantially homologous or substantially complementary to the sequence of SEQ ID NO: 9.

[0074] J5. The kit of clause J1, wherein the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 6; and The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7.

[0075] J6. The kit of clause J5, further comprising a probe, wherein the probe comprises a sequence substantially homologous or substantially complementary to the sequence of SEQ ID NO: 10.

[0076] J7. The kit of clause J1, wherein the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8; and The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5.

[0077] J8. The kit of clause J7, further comprising a probe, wherein the probe comprises a sequence substantially homologous or substantially complementary to the sequence of SEQ ID NO: 11.

[0078] J9. The kit of any one of clauses J4, J6 or J8, wherein the probe is covalently bound to a detectable label.

[0079] J10. The kit of clause J9, wherein the probe further comprises a quencher positioned to quench the signal from the detectable label. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] For the purpose of illustrating the embodiments, there are shown in the drawings exemplary embodiments. It should be understood, however, that the embodiments are not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.

[0081] Figure 1 SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 are depicted, each with annotations of primer and probe binding sites.

[0082] Figure 2 A block diagram illustrating an exemplary embodiment of a thermal cycling system according to aspects of the present disclosure is illustrated. DETAILED DESCRIPTION

[0083] The present disclosure provides methods for detecting vanillate decarboxylase (VDC) in Alicyclobacillus species that cause spoilage of contaminated food and beverage products. v ) gene sequence variations. The present disclosure further provides for predicting the expression of the disclosed v Compositions and methods for reducing the potential for spoilage of food and beverage products contaminated with genetically modified Alicyclobacillus organisms. These Alicyclobacillus organisms expressing one of the variants disclosed herein produce guaiacol and, thereby, are responsible for food and beverage spoilage. In contrast, Alicyclobacillus organisms that do not express one of the variants, while representing contamination, do not produce guaiacol and are unable to cause spoilage.

[0084] Various mixtures and methods are described in the embodiments herein. The embodiments may be combined with each other. It should be understood that the terms used herein are only used for the purpose of describing specific embodiments and are not intended to be restrictive. All references cited herein are incorporated by reference in their entirety. This document should not be interpreted as admitting that the subject matter is entitled to preempt such disclosure by virtue of prior invention. The use of examples anywhere in the specification, including examples of any term discussed herein, is merely illustrative and does not limit the scope and meaning of the present disclosure or any exemplified term. Likewise, the present disclosure is not limited to its preferred embodiments.

[0085] The genus Alicyclobacillus includes several species of spore-forming bacteria that can survive harsh environments. A major source of spoilage and lost revenue in the juice and wine industries is contamination of approximately 30% of the raw materials used to produce juice with members of the genus Alicyclobacillus. The strains of Alicyclobacillus that cause spoilage are specifically those that produce guaiacol. Detection and control of viable spores of these guaiacol-producing Alicyclobacillus strains in the raw materials is necessary to control contamination in finished juice products. More specifically, detection of variants of the Alicyclobacillus genome, as disclosed herein, provides a determination of whether the Alicyclobacillus organisms present in the raw materials will produce guaiacol and thus cause spoilage.

[0086] Guaiacol is produced by the enzyme vanillate decarboxylase, which is found in some strains of the genus Alicyclobacillus. v For Alicyclobacillus species, including Alicyclobacillus acidoterrestris, Alicyclobacillus herbalis, and Alicyclobacillus carotenoides, v Gene expression was identified as predictive of juice or wine spoilage.

[0087] Tests are available to identify the presence of Alicyclobacillus organisms. These are known in the art as ACB tests. However, as shown herein, a positive ACB test alone does not necessarily indicate spoilage; rather, spoilage occurs due to the production of guaiacol by the vanillate decarboxylase gene product expressed by some, but not all, Alicyclobacillus strains.

[0088] In the following examples, different species of the genus Alicyclobacillus are shown. v Genetic Variability of Genes. The three gene sequences provided herein as SEQ ID NOs: 1, 2, and 3 were identified in different Alicyclobacillus species.

[0089] Found in Alicyclobacillus acidoterrestris v The genomic region of the gene variant was identified as comprising the sequence of SEQ ID NO: 1: GAGACGGACTACATGGTCGGCGTCAACACCTGCGTGCCCATGTATCAGCAACTCAAGGACGCGTTCCCGAACGAAATCGTGGCCGTCAATGCCATGTACACGCATGGCCTCGTCGCCATTATCTCGACCAAGAAACGGTACGGTGGGTTTGC (SEQ ID NO: 1).

[0090] Found in herbal Alicyclobacillus v The genomic region of the gene variant was identified as comprising the sequence of SEQ ID NO: 2: GAGGTCGACTACATGATTGGGTTGAACACGTCGGTTCCACTCTATCACCAGTTGAAGCAGGCCTATCCGGATGAAATCGTCGCGGTGAACGCGATGTATACGCATGGGCTGGTGGCGATTATTTCGACAAAGACTCGTTATGGGGGCTTTGC (SEQ ID NO: 2).

[0091] Found in Alicyclobacillus carotovora v The genomic region of the gene variant was identified as comprising the sequence of SEQ ID NO: 3: GAGACTGACTACATGGTGGGTGTGAATACATGTGTGCCGATCTACCAGCAGCTGAAGGAAGCTTTTCCGAACGAGATCGTGGCTGTGAATGCAATGTACACGCACGGACTGGTGGCCATCGTCTCGACGAAGAAGCGGTACGGCGGCTTTGC (SEQ ID NO: 3).

[0092] In order that the present disclosure may be more readily understood, selected terms are defined.

[0093] Unless otherwise defined, all technical and scientific terms have the same meaning as commonly understood by those of ordinary skill in the art to which the disclosed embodiments belong. Certain terms are discussed below or elsewhere in the specification to provide additional guidance to practitioners in describing the mixtures and methods of the present disclosure and how to use them. In addition, it will be understood that the same thing can be described in more than one way. Therefore, for any one or more of the terms discussed herein, alternative language and synonyms may be used, and there is no special significance as to whether a term is elaborated or discussed in detail herein.

[0094] Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0095] The articles "a," "an," and "the" are used herein to refer to one or to more than one (ie, to at least one) of the grammatical object of the article. For example, "a sample" means one sample or more than one sample.

[0096] As used herein, the adverb "about" or "approximately" means that the numerical value is approximate and that small variations do not significantly affect the practice of the disclosed embodiments. Where numerical qualifications are used, unless the context indicates otherwise, "about" means that the numerical value may vary by ±5% and still be within the scope of the disclosed embodiments. Thus, about 100 means 95 to 105.

[0097] As used herein, the term "detecting" or "detection" is used in the broadest sense and includes qualitative and / or quantitative measurement of an analyte.

[0098] As used herein, the term "analyte" refers to the substance measured in an analytical procedure. Non-limiting examples of analytes include: RNA, DNA, nucleic acid molecules encoded by cells, synthetic nucleic acid molecules, and amplification products (e.g., amplicons).

[0099] As described herein, an "amplicon" is an amplification product. An amplicon can be produced by amplifying a nucleic acid sequence from a test sample. An amplicon can include, but is not limited to, a PCR product.

[0100] As used herein, "PCR product" refers to any product produced as a result of a PCR reaction.

[0101] As used herein, the term "sample" means any material that may contain a specific item (e.g., an analyte) or is suspected of containing a specific item. For example, the sample can be a fluid medium or a liquid. In some embodiments, a sample with a very high dissolved solid content without the need for further processing can be used. In some embodiments, a sample containing a large amount of solids (undissolved) can be analyzed by using a filter to process the sample or used in combination with additional manual steps. In some embodiments, the sample is unfiltered. In some embodiments, the sample is filtered. In some embodiments, the sample is purified. In some embodiments, the sample is unpurified. The sample can be a liquid, a suspension, an extracted or dissolved sample, or a supercritical fluid. Examples of samples include, but are not limited to, food swabs, food extracts, food suspensions, food cultures, amplification reaction products, PCR reaction products, etc. The sample can also be derived from another sample. For example, a PCR reaction can be performed on a nucleic acid mixture that has been extracted, separated, and / or purified from another sample (e.g., fruit juice). A PCR reaction product is a sample derived from another sample.

[0102] As used herein, the term "beverage" means a liquid for drinking. As used herein, the term "food" refers to any raw, cooked, or processed edible substance, ice cream, beverage, or ingredient that is used or intended for human consumption, in whole or in part. Non-limiting examples of food include raw fruit, cooked fruit, wine, and canned fruit. The term food includes food suspensions and food cultures.

[0103] The terms "food suspension" and "food solution" are used interchangeably throughout this application and refer to raw, cooked or processed food that is in solution, or that has been placed or suspended in solution. Non-limiting examples of food suspensions include fruit juices, mixed juice products, carbonated fruit juice drinks, teas, wines and flavored waters. Food suspensions can be mixed, vortexed or blended. Food suspensions can also be filtered or unfiltered. As used herein, a "food culture" is a food sample that has been cultured under conditions that enrich the sample. This process may also be referred to as "enrichment."

[0104] As used herein, the term "juice" refers to juice at any stage in the process of making the juice before it is packaged into any container that can hold the juice.

[0105] As used herein, the term "juice product" includes any food or beverage produced in the process of producing juice.

[0106] As used herein, the term "spoilage" refers to the process by which a food becomes unfit for digestion. Spoilage of a juice product can include changes in taste, flavor, aroma, viscosity, body, fragrance, odor, and appearance in an undesirable manner, or the presence of components that cause spoilage, such as guaiacol.

[0107] The term "spoiler" refers to any microorganism that can cause a food or beverage to spoil. A juice spoiler is any microorganism that can alter the flavor, aroma, or appearance of a juice in a manner that is considered undesirable by the manufacturer or that otherwise causes the juice to spoil. Non-limiting examples of juice spoilers include members of the genus Alicyclobacillus, including the species Alicyclobacillus acidoterrestris ( A. acidoterrestris ), soil Alicyclobacillus ( A. terrestris ), A. pomorum 、Alicyclobacillus acidocaldarius( A. acidocaldarius ), A. suci, Alicyclobacillus carotovora A. dauci ) 、 Herbal Alicyclobacillus A. herbarious ) and Alicyclobacillus acidophilus ( A. acidiphilus ).

[0108] As used herein, the terms "nucleic acid," "nucleic acid molecule," and "nucleotide" are intended to be consistent with their use in the art, and include naturally occurring species or their functional analogs. Nucleic acid comprises one or more nucleotides, and may include oligonucleotides and polynucleotides. As used herein, "polynucleotide," "nucleic acid molecule," and "nucleic acid" are used interchangeably, and may refer to polymeric forms of nucleotides of any length. As used herein, "oligonucleotide" represents from about 2 to 200 nucleotides, and illustrates, from about 15 to about 40 nucleotide lengths, about 150 nucleotide lengths, about 152 nucleotide lengths, about 16 to about 25 nucleotide lengths, about 18 to about 22 nucleotide lengths, about 26 to about 34 nucleotide lengths, or about 28 to about 32 nucleotide lengths of nucleotide single-stranded polymers, such as 18, 19, 20, 21, or 22 nucleotides (including for primers) and such as 28, 29, 30, 31, or 32 nucleotides (such as for probes). Oligonucleotides can be synthetic, or can be prepared enzymatically. An exemplary nucleic acid molecule is DNA, which may include deoxyribonucleotides or modified deoxyribonucleotides. As used herein, the term "nucleotide" is also intended to include any nucleotide analogs as types of nucleotides, including modified nucleobases, sugars, and / or phosphate moieties compared to naturally occurring nucleotides.

[0109] As used herein, "target nucleic acid" or grammatical equivalents thereof may refer to a nucleic acid molecule or sequence that is desired to be identified, detected, hybridized, sequenced, analyzed, and / or further manipulated.

[0110] As used herein, the term "primer" is defined as an isolated, at least partially single-stranded and typically completely single-stranded polynucleotide, such as an oligonucleotide, having a single strand containing a free 3' hydroxyl (-OH) group. The primer may also have a modification at the 5' end to allow for a coupling reaction or to couple the primer to another moiety, such as a detectable moiety, a detectable label, etc. The primer may also contain an auxiliary moiety, such as a region that is non-complementary to the target nucleic acid, which can serve as a label for the hybridization complex or the amplicon produced by the amplification reaction.

[0111] As used herein, the term "probe" is defined as a detectable, for example partially single-stranded and typically completely single-stranded, polynucleotide, such as an oligonucleotide, that is capable of specifically hybridizing to a target nucleic acid to provide detection of the target nucleic acid.

[0112] As used herein, "specific hybridization" means that probes, primers or oligonucleotides recognize substantially complementary nucleic acids (e.g., sample nucleic acids) under high stringency conditions and physically interact (i.e., base pairing) with them, and do not substantially base pair with other nucleic acids. So-called "high stringency conditions" means conditions configured to allow identification of target nucleic acid sequences. Such conditions typically occur at about Tm minus 5 ° C (5 ° lower than the Tm of the probe). Functionally, high stringency conditions are used to identify nucleic acid sequences with at least 80% sequence identity. In some embodiments, this can mean at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity.

[0113] As used herein, "substantially complementary" nucleic acids means that the nucleic acid specifically hybridizes to a specified sequence. As used herein, "substantially homologous" means that the nucleic acid specifically hybridizes to the complement of a specified sequence.

[0114] As used herein, "conditions sufficient to produce a detectable amplicon" include conditions that support specific amplification of a target region to which a nucleic acid molecule used as a primer has specifically hybridized (e.g., any of temperature, pH, salt conditions, buffering agents, polymerization agents, extension agents, and ligation agents). Such conditions can support, for example, temperature-cycling amplification reactions, including polymerase chain reaction (PCR), isothermal amplification reactions (e.g., NASBA, TMA, etc.), ligase chain reaction (LCR), or other nucleic acid amplification methods.

[0115] As used herein, the term "simultaneously" refers to the simultaneous or near simultaneous detection of multiple analytes. As used herein, "a method of simultaneously detecting multiple analytes with a single signal" or variations thereof may refer to a method or single-use device that uses a single assay (e.g., a single well, a single spot, a single location on an array) to detect multiple analytes with a single signal. Simultaneously may also mean the simultaneous or near simultaneous detection of multiple analytes in separate devices.

[0116] As used herein, the term "single signal" means to detect a signal based on a single part or method. For example, if a single signal is red, multiple analytes are indicated only when red exists. That is, in this non-limiting example, red indicates that multiple analytes are present in the sample. In contrast, if a type of analyte is indicated by red and a second type of analyte is indicated by yellow, the use of two colors (i.e., signal) is not to detect multiple analytes with a single signal. Signal is not limited to colorimetric detection. The example of a usable signal is provided herein. This is in contrast to using different signals to detect the presence of multiple analytes in a sample in the same reaction or requiring the execution of separate reactions and methods to detect multiple analytes, thereby detecting the presence of multiple analytes. That is, embodiments described herein partially provide a method for detecting multiple analytes with a single signal simultaneously, so that the detection indication of a single signal indicates the presence of multiple analytes in the sample, or lacks a single signal indication that multiple analytes are not present in the sample.

[0117] As used herein, the term "heterologous" when referring to an interaction unit means a group, molecule or part that is not natural to the analyte. For example, the amplified product may comprise only nucleic acid molecules or nucleotide bases. However, the amplified product may be conjugated or connected to a heterologous label, including but not limited to a hapten, biotin, digoxin and a fluorescent molecule (e.g., fluorescein or rhodamine). Examples of heterologous interaction units include but are not limited to a hapten, biotin, nucleic acid molecules, peptide fragments (e.g., His tag, GST tag), enzyme, streptavidin, avidin and a fluorescent molecule. This list is non-restrictive and any interaction unit can be used. The analyte can be labeled with a molecule including digoxin, rhodamine, fluorescein, DNP, BRDU, which is then detected by a capture reagent specific for a given molecule.

[0118] As used herein, the term "different analytes" means that the analytes are not identical. However, different analytes may be referred to by the same name but have different physical and / or functional characteristics. For example, different organisms may contain different gene variants and their protein products. These variants may have the same function and therefore be given the same name. For example, there are multiple species in the genus Alicyclobacillus, which may include v The present method can be used, for example, to detect different strains of bacteria from a plurality of species of the genus Alicyclobacillus that have a high potential for spoilage. v Multiple analytes for gene variants.

[0119] In some embodiments, one or more primers are provided that specifically hybridize to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof.

[0120] In some embodiments, the primer is substantially homologous to the sequence of SEQ ID NO: 4, or its complement: GAGACGGACTACATGGTCGG (SEQ ID NO: 4).

[0121] In some embodiments, the primer is substantially homologous to the sequence of SEQ ID NO: 5 or its complement: GCAAAGCCGCCGTACCG (SEQ ID NO: 5).

[0122] In some embodiments, the primer is substantially homologous to the sequence of SEQ ID NO: 6, or its complement: GAGGTCGACTACATGATTGG (SEQ ID NO: 6).

[0123] In some embodiments, the primer is substantially homologous to the sequence of SEQ ID NO: 7, or its complement: GCAAAGCCCCCATAACG (SEQ ID NO: 7).

[0124] In some embodiments, the primer is substantially homologous to the sequence of SEQ ID NO: 8, or its complement: GAGACTGACTACATGGTGGG (SEQ ID NO: 8).

[0125] In some embodiments, one or more probes are provided that specifically hybridize to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof.

[0126] In some embodiments, the probe has a sequence substantially homologous to the sequence of SEQ ID NO: 9 or its complement, or a fragment thereof: ATGCGTATACATCGCGTTCACCGCGACGATT (SEQ ID NO: 9). The probe of SEQ ID NO: 9 binds to SEQ ID NO: 1.

[0127] In some embodiments, the probe has a sequence substantially homologous to the sequence of SEQ ID NO: 10, or its complement, or a fragment thereof: GTGCGTGTACATTGCATTCACAGCCACGATC (SEQ ID NO: 10). The probe of SEQ ID NO: 10 binds to SEQ ID NO: 2.

[0128] In some embodiments, the probe has a sequence substantially homologous to the sequence of SEQ ID NO: 11 or its complement, or a fragment thereof: ATGCGTGTACATGGCATTGACGGCCACGATT (SEQ ID NO: 11). The probe of SEQ ID NO: 11 binds to SEQ ID NO: 3.

[0129] In some embodiments, the primer specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 1, or a fragment thereof, or a complementary sequence thereof, wherein the primer is substantially homologous to the sequence of SEQ ID NO: 4, the complementary sequence of SEQ ID NO: 4, SEQ ID NO: 5, or the complementary sequence of SEQ ID NO: 5.

[0130] In some embodiments, the probe specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 1, or a fragment thereof, or a complementary sequence thereof, wherein the probe is substantially homologous to SEQ ID NO: 9 or a complementary sequence thereof.

[0131] In some embodiments, the primer specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 2, or a fragment thereof, or a complementary sequence thereof, wherein the primer is substantially homologous to the sequence of SEQ ID NO: 6, the complementary sequence of SEQ ID NO: 6, SEQ ID NO: 7, or the complementary sequence of SEQ ID NO: 7.

[0132] In some embodiments, the probe specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 2, or a fragment thereof, or a complement thereof, wherein the probe is substantially homologous to SEQ ID NO: 10 or a complement thereof.

[0133] In some embodiments, the primer specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof, wherein the primer is substantially homologous to the sequence of SEQ ID NO: 8, the complementary sequence of SEQ ID NO: 8, SEQ ID NO: 5, or the complementary sequence of SEQ ID NO: 5.

[0134] In some embodiments, the probe specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof, wherein the probe is substantially homologous to SEQ ID NO: 11 or a complementary sequence thereof.

[0135] In some embodiments, the probe is covalently bound to a detectable label. In some embodiments, the detectable label is selected from the following list: 1,5-IAEDANS; 1,8-ANS; 2′-chloro-7′phenyl-1,4-dichloro-6-carboxyfluorescein (VIC); 3(4)-carboxyfluorescein dipivalate NHS ester; 3(4)-carboxyfluorescein dipivalate hydroxyhexylcarboxamide; 3(4)-carboxyfluorescein dipivalate hydroxyhexylcarboxamide phosphoramidite; 3(4)-carboxyfluorescein dipivaloyl-N-succinimidyl ester; 4-methylumbelliferone; 5-carboxy-2,7-dichlorofluorescein; 5-carboxyfluorescein (5-FAM); 5-carboxynaphthylfluorescein; 5-carboxyfluorescein dipivalate; 5-carboxytetramethylrhodamine (5-TAMRA); 5-FAM (5-carboxyfluorescein); 5-HAT (hydroxytryptamine); 5-hydroxytryptamine (HAT); 5-ROX (carboxy-X-rhodamine); 5-TAMRA (5-carboxytetramethylrhodamine); 6-carboxyfluorescein (6-FAM); 6-carboxyfluorescein dipivalate; 6-carboxynaphthylfluorescein; 6-carboxyrhodamine 6G; 6-CR 6G; 6-JOE; 7-amino-4-methylcoumarin; 7-aminoactinomycin D (7-AAD); 7-hydroxy-4-methylcoumarin; 9-amino-6-chloro-2-methoxyacridine; ABQ; ABY; acid fuchsin; ACMA (9-amino-6-chloro-2-methoxyacridine); acridine orange; acridine red; acridine yellow; acriflavin; acriflavin Feulgen SITSA; Alexa Fluor 350; Alexa Fluor 405; Alexa Fluor 430; Alexa Fluor 488; Alexa Fluor 500; Alexa Fluor 514; Alexa Fluor 532; Alexa Fluor 546; Alexa Fluor 555; Alexa Fluor 568; Alexa Fluor 594; Alexa Fluor 610; Alexa Fluor 633; ​​Alexa Fluor 635; Alizarin complex indicator; Alizarin Red; AMC; AMCA-S; AMCA (aminomethylcoumarin); AMCA-X; aminoactinomycin D; aminocoumarin; aminomethylcoumarin (AMCA); Aniline Blue; Anthrocyl stearate; APTRA-BTC; APTS; Astrazon Brilliant Red 4G; Astrazon Orange R; Astrazon Red 6B; Astrazon Yellow 7 GLL; Atabrine; ATTO 390; ATTO 425;ATTO 465; ATTO 488; ATTO 495; ATTO 520; ATTO 532; ATTO 550; ATTO 565; ATTO 590; ATM 594; ATTO 610; ATTO 611X; ATTO 620; ATTO 633; ​​ATTO 635; ATTO 647; ATTO 647N; ATTO ATTO 655; ATTO 680; ATTO 700; ATTO 725; ATTO 740; ATTO-TAGCBQCA; ATTO-TAG FQ; Auramine; Aurophosphine G; Aurophosphine; BAO 9 (Bisaminophenyloxadiazole); BCECF (High pH); (low pH); berberine sulfate; Bimane; bisbenzamide; bisbenzimide (Hoechst); bis-BTC; Blancophor FFG; Blancophor SV; BOBO-1; BOBO-3; Bodipy 492 / 515; Bodipy 493 / 503; Bodipy 500 / 510; Bodipy 505 / 515; Bodipy 530 / 550; Bodipy 542 / 563; Bodipy 558 / 568; Bodipy 564 / 570; Bodipy 576 / 589; Bodipy 581 / 591; Bodipy 630 / 650-X; Bodipy 650 / 665-X; Bodipy 665 / 676; Bodipy FL; Bodipy FL ATP; Bodipy Fl-ceramide; Bodipy R6G; Bodipy TMR; Bodipy TMR-X conjugate; Bodipy TMR-X; SE; Bodipy TR; Bodipy TRATP; Bodipy TR-X SE; BO-PRO-1; BO-PRO-3; Brilliant Sulphoflavin FF; BTC; BTC-5N; Calcein; Calcein Blue; Calcein Red; CAL Fluor Gold 540; CAL Fluor Orange 560; CAL Fluor Red 590; CAL Fluor Red 610; CAL Fluor 635; Calcium Green; Calcium Green-1 Ca2+ dye; Calcium Green-2 Ca2+; Calcium Green-5N Ca2+; Calcium Green-C18 Ca2+; Calcium Orange; Calcofluor White; carboxyfluorescein diacetate; carboxyfluorescein diacetate succinimidyl ester; carboxyfluorescein dipivalate succinimidyl ester; carboxyfluorescein succinimidyl ester (CFSE);Carboxy-X-rhodamine (5-ROX); Cascade Blue; Cascade Yellow; catecholamine; CCF2 (GeneBlazer); CFDA; chromomycin A; chromomycin A; CL-NERF; CMFDA; coumarin phalloidin; CPM-methylcoumarin; CTC; CTC formazan; Cy2; Cy3.1 8; Cy3.5; Cy3; Cy5.1 8; cyclic AMP fluorescent sensor (FiCRhR); Dabcyl; dansyl; dansylamide; dansylcadaverine; dansyl chloride; dansyl DHPE; dansyl fluoride; DAPI; Dapoxyl; Dapoxyl 2; Dapoxyl 3′ DCFDA; DCFH (dichlorodihydrofluorescein diacetate); DDAO; DHR (dihydrorhodamine 123); di-4-ANEPPS; di-8-ANEPPS (phenoxyethanol); DiA (4-di-16-ASP); dichlorodihydrofluorescein diacetate (DCFH); DiD—lipophilic tracer; DiD (DiIC18(5)); DIDS; dihydrorhodamine 123 (DHR); DiI (DiIC18(3)); dinitrophenol; DiO (DiOC18(3)); DiR; DiR (DiIC18(7)); dipivaloyl-3(4)-(N-(6'-hydroxyhexyl))-formamide; DM-NERF (high pH); DNP; dopamine; DTAF; DY-630-NHS; DY-635-NHS; DyLight 405; DyLight 488; DyLight 549; DyLight 633; ​​DyLight 649; DyLight 680; DyLight 800; ELF97; Eosin; Erythrosine; Erythrosine ITC; Ethidium bromide; Ethidium homodimer-1 (EthD-1); Euchrysin; EukoLight; Europium(III) chloride; Fast Blue; FDA; Feulgen (Feulgen); FIF (formaldehyde-induced fluorescence); FITC; Flazo Orange; Fluo-3; Fluo-4; Fluorescein (FITC); Fluorescein amidite (FAM); Fluorescein diacetate; Fluorescein diacetate 6-isothiocyanate; Fluorescein bis-pivaloylamidate; Fluorescein phosphoramidite; Fluoro-Emerald; Fluoro-Gold (hydroxystilbene); Fluor-Ruby; FluorX; FM 1-43; FM 4-46; FuraRed (high pH); Fura Red / Fluo-3; Fura-2; Fura-2 / BCECF; Genacryl Brilliant Red B;Genacryl Brilliant Yellow 10GF; Genacryl Pink 3G; Genacryl Yellow SGF; GeneBlazer (CCF2); Gloxalic Acid; Granular Blue; Hematoporphyrin; HEX; Hoechst 33258; Hoechst 33342; Hoechst 34580; HPTS; Hydroxycoumarin; Hydroxystilbamidine (FluoroGold); Hydroxytryptamine; Indo-1; High Calcium; Indo-1; Low Calcium; Indo-dicarbocyanine (DiD); Indotricarbocyanine (DiR); Intrawhite Cf; JC-1; JOE; JO-JO-1; JO-PRO-1; JUN; LaserPro; Laurodan; LDS 751 (DNA); LDS 751 (RNA); Leucophor PAF; Leucophor SF; Leucophor WS; Lissamine Rhodamine; Lissamine Rhodamine B; Calcein / Ethidium Homodimer; LOLO-1; LO-PRO-1; Lucifer Yellow; Lyso Tracker Blue; Lyso Tracker Blue-White; Lyso Tracker Green; Lyso Tracker Red; Lyso Tracker Yellow; LysoSensor Blue; LysoSensor Green; LysoSensor Yellow / Blue; Mag Green; Magdala Red (Phloxin B); Mag-Fura Red; Mag-Fura-2; Mag-Fura-5; Mag-Indo-1; Magnesium Green; Magnesium Orange; Malachite Green; Marina Blue; Maxilon Brilliant Flavin 10 GFF; Maxilon Brilliant Flavin 8 GFF; Merocyanine; Methoxycoumarin; Mitotracker Green FM; Mitotracker Orange; Mitotracker Red; Mithramycin; Monobromobimane; Monobromobimane (mBBr-GSH); Monochlorobimane; MPS (Methyl Green Pyronitrile); NBD; NBD Amine; Nile Red; Nitrobenzoxadiazole; Norepinephrine; Nuclear Fast Red; Nuclear Yellow;Nylosan Brilliant Flavin EBG; Oregon Green; Oregon Green 488-X; Oregon Green; Oregon Green 488; Oregon Green 500; Oregon Green 514; Pacific Blue; Feulgen; PBFI; Phloxin B (MagdalaRed); Phorwite AR; Phorwite BKL; Phorwite Rev; Phorwite RPA; Phosphine 3R; PKH26 (Sigma); PKH67; PMIA; Pontochrome Blue Black; POPO-1; POPO-3; PO-PRO-1; PO-PRO-3; Primrose Yellow; Procion Yellow; Propidium Iodide (PI); PyMPO; Pyrene; Pyronine; Pyronine B; Pyrozal Brilliant Flavin 7GF; QSY 7; Quinazoline; Resorufin; RH 414; Rhod-2; Rhodamine; Rhodamine 110; Rhodamine 123; Rhodamine 5 GLD; Rhodamine 6G; Rhodamine B; Rhodamine B 200; Rhodamine B extra; Rhodamine BB; Rhodamine BG; Rhodamine Green; Rhodamine Phallicidine; Rhodamine Phallicidine; Rhodamine Red; Rhodamine WT; Rose Bengal; S65A; S65C; S65L; S65T; SBFI; Serotonin; Sevron Brilliant Red 2B; Sevron Brilliant Red 4G; Sevron Brilliant Red B; Sevron Orange; Sevron Yellow L; SITS; SITS (Primrose Yellow); SITS (Stilbene Isosulfonic Acid); SNAFL Calcein; SNAFL-1; SNAFL-2; SNARF Calcein; SNARF1; Sodium Green; Spectrum Aqua; Spectrum Green; Spectrum Orange; Spectrum Red; SPQ (6-methoxy-N-(3-sulfopropyl)quinolinium); Stilbene; Sulforhodamine B can C; Sulforhodamine Extra; SUN; SYBR Green; SYTO 11; SYTO 12; SYTO 13; SYTO 14; SYTO 15; SYTO 16; SYTO 17; SYTO 18; SYTO 20; SYTO 21; SYTO 22; SYTO 23; SYTO 24; SYTO 25; SYTO 40; SYTO 41;SYTO 42; SYTO 43; SYTO 44; SYTO 45; SYTO 59; SYTO 60; SYTO 61; SYTO 62; SYTO 63; SYTO 64; SYTO 80; SYTO 81; SYTO 82; SYTO83; SYTO 84; SYTO 85; SYTOX Blue; SYTOX Green; SYTOX Orange; TAMARA; Tetracycline; Tetrachlorofluorescein (TET); Tetramethylrhodamine (TAMRA); Texas Red; Texas Red-X conjugate; Thiazine Red R; Thiazole Orange; Thioflavin 5; Thioflavin S; Thioflavin TCN; Thiolyte; Thiozole Orange; Tinopol CBS (Calcofluor White); TMR; TO-PRO-1; TO-PRO-3; TO-PRO-5; TOTO-1; TOTO-3; TRITC (tetramethylrhodamine isothiocyanate); True Blue; TruRed; Ultralite; Uranine B; Uvitex SFC; WW 781; X-rhodamine; XRITC; Xylene Orange; Y66F; Y66H; Y66W; Yamika Yellow; YO-PRO-1; YO-PRO-3; YOYO-1; or YOYO-3, and any combination thereof. ;

[0136] In some embodiments, the probe further comprises a quencher of a detectable label, wherein the quencher of the detectable label is covalently bound to the isolated nucleic acid molecule. In some embodiments, the probe comprises a quencher selected from the group consisting of BBQ-650, BHQ-1, BHQ-2, BHQ-3, Black Hole Quencher (BHQ), Dabcyl, Eclipse, IBFQ, Iowa Black, TAMARA, TAMRA, ZEN, or ZEN Iowa Black, and any combination thereof.

[0137] In some embodiments, quenching of the detectable label ceases upon hydrolysis of a covalent bond within the probe, wherein: the first hydrolysis product comprises the detectable label and the second hydrolysis product comprises a quencher for the detectable label; the detectable label and the quencher become uncoupled; or hydrolysis prevents the quencher molecule from quenching the detectable signal.

[0138] In some embodiments, a mixture is provided, wherein the mixture comprises a target nucleic acid molecule and a probe as described herein, wherein: the target nucleic acid molecule is substantially homologous to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof; and the primers and, optionally, the probes, specifically bind to the target nucleic acid molecule. In some embodiments, the mixture comprises one or more primers as described herein. In some embodiments, the mixture comprises one or more probes as described herein. In some embodiments, the mixture comprises one or more primers and one or more probes as described herein.

[0139] In some embodiments, the mixture further comprises a detectable label as described herein. In some embodiments, the detectable label is covalently bound to the probe. In some embodiments, the mixture further comprises a quencher for the detectable label as described herein. In some embodiments, the quencher for the detectable label is covalently bound to the probe.

[0140] In some embodiments, the mixture comprises a target nucleic acid molecule substantially homologous to SEQ ID NO: 1 or a fragment thereof, a first primer substantially homologous to SEQ ID NO: 4, and a second primer substantially homologous to SEQ ID NO: 5. In some embodiments, the mixture further comprises a probe substantially homologous to SEQ ID NO: 9.

[0141] In some embodiments, the mixture comprises a target nucleic acid molecule substantially homologous to SEQ ID NO: 2 or a fragment thereof, a first primer substantially homologous to SEQ ID NO: 5, and a second primer substantially homologous to SEQ ID NO: 6. In some embodiments, the mixture further comprises a probe substantially homologous to SEQ ID NO: 10.

[0142] In some embodiments, the mixture comprises a target nucleic acid molecule substantially homologous to SEQ ID NO: 3 or a fragment thereof, a first primer substantially homologous to SEQ ID NO: 8, and a second primer substantially homologous to SEQ ID NO: 5. In some embodiments, the mixture further comprises a probe substantially homologous to SEQ ID NO: 11.

[0143] In some embodiments, the mixture is an amplification reaction mixture. In such embodiments, the mixture comprises: primers as described herein; deoxynucleoside triphosphates; a polymerase; and a buffer, to which the target nucleic acid may be added. In some embodiments, the mixture further comprises a test sample as described herein.

[0144] In some embodiments, the deoxynucleoside triphosphate nucleotide (dNTP) comprises a mixture of dATP, dCTP, dGTP and dTTP. In some embodiments, dNTP comprises deoxyuridine triphosphate (dUTP) in addition, is combined with uracil DNA glycosylase (UDG) pre-treatment, as a strategy for preventing the contamination of PCR. In some embodiments, dNTP comprises a mixture of dATP, dCTP, dGTP and dUTP. In some embodiments, dUTP is modified. In some embodiments, dUTP is aminoallyl-dUTP, fluorescein-12-dUTP, 5-bromo-dUTP or biotin-11-dUTP. Other natural or non-natural dNTPs can be used.

[0145] In some embodiments, the polymerase is derived from Thermus aquaticus ( Thermus aquaticus )(Taq), Pyrococcus furiosus( Pyrococcus furiosus ) (Pfu polymerase) 、Thermococcus litoralis (Wind or Tli polymerase or Vent polymerase) or Thermus thermophilus ( Thermus thermophilus ) (Tth polymerase). In some embodiments, the polymerase is specifically modified for uracil incorporation. In some embodiments, the polymerase is specifically modified for incorporation of modified dNTPs.

[0146] In some embodiments, the buffer comprises Tris-HCl and magnesium chloride (MgCl 2 ).In some embodiments, the buffer comprises Tris-HCl, ammonium sulfate ((NH 4 ) 2 SO 4 ) and magnesium chloride (MgCl 2 ).

[0147] In some embodiments, the mixture further comprises a second target nucleic acid molecule as described herein. In some embodiments, the mixture further comprises a primer as described herein that hybridizes to the second target nucleic acid molecule or its complement. In some embodiments, the second nucleic acid is selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0148] In some embodiments, the mixture comprises a second and a third target nucleic acid molecule as described herein. In some embodiments, the mixture further comprises a primer as described herein that hybridizes to the second and third target nucleic acid molecules or their complements or fragments thereof. In some embodiments, the second and third target nucleic acids are selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0149] In some embodiments, the mixture further comprises a test sample. In some embodiments, the test sample comprises a food, a food suspension, a food solution, or a beverage. In some embodiments, the test sample comprises raw fruit, cooked fruit, canned fruit, juice, juice product, mixed juice, carbonated juice drink, fruit-flavored tea, wine, or fruit-flavored water.

[0150] In some embodiments, the test sample comprises a solid suspension. In some embodiments, the test sample comprises Alicyclobacillus cells. In some embodiments, the test sample comprises Alicyclobacillus cells separated from a solid suspension. In some embodiments, the test sample comprises genomic DNA from Alicyclobacillus cells. In some embodiments, the test sample comprises digested genomic DNA from Alicyclobacillus cells. In some embodiments, the Alicyclobacillus species is Alicyclobacillus acidoterrestris. In some embodiments, the Alicyclobacillus species is Alicyclobacillus herbalus. In some embodiments, the Alicyclobacillus species is Alicyclobacillus carrotus.

[0151] In some embodiments, the mixture further comprises a detectable amplicon, wherein the amplicon is detectable by direct detection or indirect detection. In some embodiments, the detectable amplicon comprises a sequence substantially homologous to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof. In some embodiments, the detectable amplicon is a PCR product.

[0152] In some embodiments, a container comprising a mixture as described herein is provided. In some embodiments, the container is a tube, a plate, a reaction vessel, or the like.

[0153] How to use Without wishing to be bound by theory, amplicons can be generated by amplifying target nucleic acid molecules in many ways, and amplicons can be detected in many ways. Non-limiting examples of DNA amplification reactions include polymerase chain reaction (PCR), isothermal amplification, ligase chain reaction (LCR), and rolling circle replication (RCR). Non-limiting examples of PCR reactions include emulsion PCR, real-time PCR (RT-PCR), TaqMan ®Real-time PCR, multiplex PCR, long-distance PCR, single-cell PCR, rapid cycle PCR, methylation-specific PCR (MSP), hot start PCR, high-fidelity PCR, rapid amplification of polymorphic DNA analysis (RAPD), rapid amplification of cDNA ends (RACE), in situ PCR, differential display PCR and bridge PCR (bPCR) amplification. The limiting examples of isothermal reaction include isothermal amplification, LOOP-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), thermophilic helicase-dependent amplification (tHDA), rolling circle amplification (RCA), multiple displacement amplification (MDA), recombinase polymerase amplification (RPA), nucleic acid sequence-based amplification (NASBA), self-sustained sequence reaction (3SR), strand displacement amplification (SDA), transcription-mediated amplification (TMA) and bridge amplification. Exemplary LAMP method is described in U.S. Patent Application 20130171643. In some embodiments, an internal control can be added during the DNA amplification reaction.

[0154] After amplification, the amplicons can be detected, for example, using a DNA gel, a lateral flow assay, or a vertical flow assay. Alternatively, the predictive region or a fragment thereof or its complement can be amplified and the resulting amplicons can be detected in real time. In one aspect, dsDNA binding dyes such as SYBR Green or EvaGreen can be used. ® Positive amplification of DNA was monitored in real time.

[0155] Real-time monitoring can also be achieved by adding specific oligonucleotide hybridization probes, such as molecular beacons or TaqMan® probes, to a mixture comprising primers and target nucleic acid molecules. The oligonucleotide probe itself can comprise two different oligonucleotide chains. The first oligonucleotide chain can comprise a quencher, and the second oligonucleotide chain can comprise a fluorophore. A fluorescent signal appears when the two chains replace each other during the amplification reaction. Alternatively, a single oligonucleotide chain can comprise both a detectable label and a quencher. In some embodiments, the quenching of the detectable label stops the subsequent hydrolysis of the covalent bond within the reporter nucleic acid molecule, wherein: the first hydrolysate comprises the detectable label, and the second hydrolysate comprises a quencher for the detectable label; the detectable label and the quencher become uncoupled; or hydrolysis prevents the quencher molecule from quenching the detectable signal. The amplification reaction can be detected by monitoring the emitted fluorescence. Multiple detection methods can also be used. Other probe configurations can be used, as known in the art.

[0156] In some embodiments, methods are provided for detecting a target nucleic acid molecule that is substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof.

[0157] In some embodiments, the methods described herein include detecting an analyte in a test sample. In some embodiments, the test sample comprises food, a food suspension, a food solution, or a beverage. In some embodiments, the test sample comprises raw fruit, cooked fruit, canned fruit, fruit juice, a fruit juice product, a mixed fruit juice, a carbonated fruit juice drink, a fruit-flavored tea, wine, or a fruit-flavored water. In some embodiments, the test sample comprises a suspension of Alicyclobacillus cells. In some embodiments, the test sample comprises a suspension of Alicyclobacillus cells in a container that can be centrifuged. In some embodiments, the test sample comprises Alicyclobacillus cells separated from a suspension of Alicyclobacillus cells. In some embodiments, the test sample comprises a precipitate of Alicyclobacillus cells separated from a suspension of Alicyclobacillus cells by centrifugation, wherein the supernatant is poured out from the precipitate. In some embodiments, the test sample comprises Alicyclobacillus cells and a lysis buffer. In some embodiments, the test sample comprises Alicyclobacillus cells, wherein the cell wall has been lysed. In some embodiments, the test sample comprises genomic DNA from a lysed Alicyclobacillus cell. In some embodiments, the test sample comprises genomic DNA from a lysed Alicyclobacillus cell. In some embodiments, the sample is derived from another sample. For example, a PCR reaction can be performed on a mixture of nucleic acids that has been extracted, separated, and / or purified from another sample (e.g., wine). In this example, the PCR reaction product is a sample derived from another sample.

[0158] In some embodiments, the detection of an analyte in a test sample is used to detect an organism comprising a nucleic acid molecule having a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or its complementary sequence, or its fragment. In some embodiments, the organism is a wild Alicyclobacillus. In some embodiments, the detection of an analyte in a test sample is used to detect a contaminant comprising a nucleic acid molecule having a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or its complementary sequence, or its fragment, or its variant. In some embodiments, the contaminant is an organism, wherein the organism is a species of Alicyclobacillus. In some embodiments, the contaminant is derived from a species of Alicyclobacillus. In some embodiments, the detection of an analyte in a test sample is used to determine the deterioration probability of the test sample. In some embodiments, a positive deterioration probability indicates the presence of a contaminant, wherein the contaminant is an organism, and the organism is a species of Alicyclobacillus. In some embodiments, a positive deterioration probability indicates the presence of a contaminant derived from a species of Alicyclobacillus that produces guaiacol.

[0159] In some embodiments, the species of the genus Alicyclobacillus is Alicyclobacillus acidoterrestris. In some embodiments, the species of the genus Alicyclobacillus is Alicyclobacillus herbalis. In some embodiments, the species of the genus Alicyclobacillus is Alicyclobacillus carota.

[0160] In some embodiments, the analyte is a nucleic acid molecule. In some embodiments, the analyte is an amplified nucleic acid molecule. In some embodiments, the analyte is a nucleic acid molecule amplified by an amplification method (such as PCR or RT-PCR) and then detected according to the method described herein. In some embodiments, the analyte is an amplification product. In some embodiments, the analyte is a PCR product. In some embodiments, the analyte is an amplicon. In some embodiments, the amplicon is produced by PCR. In some embodiments, the amplicon is produced by RT-PCR. In some embodiments, the amplicon is produced by linear amplification. In some embodiments, the amplicon is a single-stranded or double-stranded nucleic acid molecule. In some embodiments, the amplicon is directly detected. In some embodiments, the amplicon is indirectly detected.

[0161] In some embodiments, the detection of analyte in the test sample is used to detect an organism comprising a nucleic acid molecule having a sequence or a fragment or variant thereof of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. In some embodiments, the organism is an alicyclic bacillus. For example, if one skilled in the art is determining whether a juice product sample is contaminated by the alicyclic bacillus that produces guaiacol, the nucleic acid sequence specific to the alicyclic bacillus that produces guaiacol can be amplified (e.g., by PCR) and then detected according to methods described herein, wherein the detection of the amplified product (i.e., amplicon) indicates that the juice product sample contains the alicyclic bacillus species-specific nucleic acid sequence that produces guaiacol. This example is non-restrictive and may be applicable to other nucleic acid sequences or other types of analytes in the test sample. The analyte may be the analyte in the initial sample, or the analyte obtained from the initial sample by, for example, using PCR.

[0162] In some embodiments, the amplicon is detected by hybridization methods as described herein, in whole or in part. In some embodiments, a detectable label is covalently bound to the amplicon, and the detectable label is detected. In some embodiments, the detectable label is not covalently bound to the amplicon, and the detectable label is detected. In some embodiments, the detectable label is a dye. In some embodiments, the amplicon is detected indirectly using a dye in the reaction mixture.

[0163] In some embodiments, the amplicon is detected after the amplification reaction. In some embodiments, one or more amplicons are detected in real time, for example, using real-time PCR. In some embodiments, the amplicon is detected during the amplification reaction, and in other embodiments, one or more amplicons are detected after the amplification reaction. In some embodiments, a DNA gel is used to detect the amplicon. In some embodiments, a lateral flow or vertical flow detection device is used to detect the amplicon. In some embodiments, a single signal is used to detect two or more amplicons. In some embodiments, amplification is detected in real time using a dye. In some embodiments, the dye is SYBR Green or EvaGreen. In some embodiments, amplification is detected in real time using one or more oligonucleotide probes. In some embodiments, one or more oligonucleotide probes include a quenching probe and a fluorescent probe. In some embodiments, a fluorescent signal appears when the oligonucleotide probe interacts with the amplicon. In some embodiments, the oligonucleotide probe is a molecular beacon. In some embodiments, the oligonucleotide probe is a TaqMan® probe.

[0164] In some embodiments, two or more amplicons can be generated and detected from the same sample. In some embodiments, three amplicons can be generated and detected from the same sample. In some embodiments, amplification is detected using a multiplex assay. In some embodiments, the multiplex assay targets all of the Alicyclobacillus genus. In some embodiments, the multiplex assay targets Alicyclobacillus acidoterrestris. 、 Alicyclobacillus herbalis or Alicyclobacillus carotovora. In some embodiments, the multiplex detection assay has an internal amplification control (IAC).

[0165] In some embodiments, a second or subsequent analyte is additionally detected. In some embodiments, the second or subsequent analyte comprises a marker for a species of the genus Alicyclobacillus. In some embodiments, the marker is an amplicon. In some embodiments, the marker is unlabeled. In some embodiments, the marker is labeled. In some embodiments, the second or subsequent analyte comprises a marker for a species of the genus Alicyclobacillus. In some embodiments, the second or subsequent analyte comprises a marker for a species of the genus Alicyclobacillus. 、 A marker for Alicyclobacillus herbalus or Alicyclobacillus carrotus.

[0166] Buffers may also be included in the present invention. Without wishing to be bound by theory, examples of buffers include, but are not limited to, PCR buffers. PCR buffers are suitable for nucleotide amplification and are known in the art. Without wishing to be bound by theory, examples of buffers include, but are not limited to, lysis buffers. Examples of lysis buffers include: 2% Tween (v / v) and 0 .1% Triton(v / v); 2% Tween(v / v) and 0 . 1% SDS(w / v); 2% Tween(v / v) and 0 . 1% BSA (w / v); 2% Tween (v / v) and 1% BSA (w / v), 0 . 1% SDS (w / v), 1% BSA (w / v), or any combination thereof. The lysis buffer may also be, for example, 5% Tween / PBS; 2% Tween / PBS + 0 . 1% SDS; 2% Tween / PBS + 1% BSA. Other examples of lysis buffer include, but are not limited to, 5% Tween-80 (v / v); 5% Triton X-100 (v / v); 5% NP40 (v / v); 2% Tween-80 (v / v); 2% Triton X-100 (v / v); 2% NP40 (v / v); 1% Tween-80 (v / v); 1% TritonX-100 (v / v); and 1% NP40 (v / v). The detergent and other components of the buffer can be prepared with any suitable buffer suitable for proteins, and include, but are not limited to, water and phosphate-buffered saline. Lysis buffer can be used to prepare samples before sequences, analytes, amplicons, or bioassays as described herein. In some embodiments, lysis buffer is not used.

[0167] In some embodiments, a method for detecting an organism comprising a target nucleic acid molecule substantially homologous to a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof in a test sample comprises reacting the test sample with a first primer and a second primer. In some embodiments, the first and second primers comprise sequences substantially homologous to a sequence of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8, or a complementary sequence thereof. The primer pair may comprise primers of SEQ ID NO: 4 and SEQ ID NO: 5, primers of SEQ ID NO: 6 and SEQ ID NO: 7, and primers of SEQ ID NO: 8 and SEQ ID NO: 5.

[0168] In some embodiments, the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule or the complementary strand bound by the first primer. In some embodiments, the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11, or a complementary sequence thereof. In some embodiments, the probe is labeled with a detectable tag.

[0169] In some embodiments, the method comprises reacting a mixture as described herein with a test sample. In some embodiments, the method comprises generating and detecting a detectable amplicon, wherein the detectable amplicon comprises a sequence substantially homologous to a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof. In some embodiments, the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0170] In some embodiments, the method includes the step of detecting the detectable amplicon using one or more techniques independently selected from: directly detecting a measure of a physical property of the amplicon, such as a measure of UV absorbance at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye and detecting the dye; complexing the amplicon with a detectable label and detecting the presence of the label; detecting a detectable signal from a labeled probe or primer, wherein the total detectable signal is proportional to the number of amplicon copies in the sample; or detecting a detectable signal from two or more labeled probes or primers, wherein the total detectable signal is proportional to the number of amplicon copies in the sample.

[0171] In some embodiments, the method comprises detecting a detectable label as described herein, wherein: the detectable label is covalently bound to the probe; the probe is covalently bound to a quencher molecule that quenches the detectable label; the detectable label is coupled to the quencher; and the coupling between the detectable label and the quencher results in quenching of the detectable label.

[0172] In some embodiments, the method comprises contacting the reaction mixture with a lateral flow or vertical flow detection device to detect amplicons.

[0173] In some embodiments, the method comprises detecting a target nucleic acid molecule comprising a sequence substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, and / or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof, wherein detection thereof indicates a positive spoilage likelihood. In some embodiments, a positive spoilage likelihood indicates the presence of a contaminating Alicyclobacillus strain comprising a nucleic acid molecule having a sequence substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, and / or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof.

[0174] In some embodiments, a method for detecting a contaminant in a test sample is provided, wherein the contaminant comprises a target nucleic acid molecule substantially homologous to a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof, or a variant thereof. In some embodiments, the method comprises detecting a target nucleic acid as described herein.

[0175] In some embodiments, a method of detecting a contaminant comprising a nucleic acid molecule having a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof, or a variant thereof in a test sample comprises generating and detecting a detectable amplicon, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0176] In some embodiments, the method of detecting a contaminant comprises generating and detecting a detectable amplicon, wherein detecting the detectable amplicon comprises one or more techniques selected from the group consisting of: directly detecting a measure of a physical property of the amplicon, such as a measure of UV absorbance at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye and detecting the dye; complexing the amplicon with a detectable label and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the number of amplicon copies in the sample; or detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the number of amplicon copies in the sample.

[0177] In some embodiments, a method for determining the likelihood of spoilage in a test sample is provided, wherein the test sample comprises a target nucleic acid molecule having a sequence substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof. In some embodiments, the method for determining the likelihood of spoilage in a test sample comprises detecting one or more target nucleic acid sequences as described herein.

[0178] In some embodiments, a positive spoilage potential indicates the presence of a contaminating guaiacol-producing Alicyclobacillus strain.

[0179] In one embodiment, the sample is assayed for both Alicyclobacillus species and guaiacol production. In one embodiment, the sample is assayed for at least two of the following: (1) the presence of a gene present in all strains of Alicyclobacillus, and (2) the presence of a vanillate decarboxylase ( v ) gene (e.g., comprising SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3) v In another embodiment, the presence of a gene) is detected in the assay, wherein the presence of both gene targets indicates a positive result for the presence of a contaminating bacterial strain of the genus Alicyclobacillus that is capable of causing the sample to deteriorate. v One, two, or three variant regions of a gene.

[0180] In one embodiment, a method is performed that includes determining (e.g., by amplification and detection) at least two of: (1) the presence of a gene present in all strains of the genus Alicyclobacillus, and (2) the presence of a vanillate decarboxylase ( v ) genes, wherein detecting the presence of both gene targets indicates a positive result for the presence of a contaminating bacterial strain of the genus Alicyclobacillus that can cause the sample to deteriorate. In one embodiment, a method is performed wherein one or more (e.g., one, two, three, or more) v In one embodiment, a method is performed using a primer set for the 16S ribosomal RNA gene of Alicyclobacillus and one or more (e.g., one, two, three, or more) v Amplification reactions are performed using primer sets specific to the gene variants, and amplification products are detected using, for example, probes specific to each target.

[0181] Reagent test kit In some embodiments, kits for use with the methods described herein are provided. The kits may include a detection device, a sample collector, a buffer container, an instruction manual, a positive control, a negative control, or any combination thereof. With respect to the kit, a positive control is a sample known to contain an analyte that can be detected by the device present in the kit. In contrast, a negative control does not contain an analyte that can be detected by the kit.

[0182] In one embodiment, the kit may include DNA oligonucleotide primers and probes for use in a PCR assay for detecting spoilage bacteria in beverages as described herein. In a specific embodiment, the kit may include primers and probes targeting one or more (e.g., one, two, three, or more) v In a specific embodiment, the kit may include reagents for two or more PCR reactions, the PCR reactions: (1) targeting the 16s ribosomal RNA gene of the Alicyclobacillus sp., which detects all Alicyclobacillus sp.; and (2) targeting one or more (e.g., one, two, three, or more) v Variant regions of the gene involved in guaiacol production. In one embodiment, the kit comprises reagents for amplifying and detecting one, two, or three variants of vdcC and detecting Alicyclobacillus species in species that produce guaiacol and cause beverage / juice spoilage. In a specific embodiment, the kit may comprise reagents for targeting one or more strains involved in guaiacol production. v In a specific embodiment, the kit may include reagents for performing multiplex PCR reactions targeting: (1) the 16s ribosomal RNA gene of the Alicyclobacillus sp., which detects all Alicyclobacillus sp., and (2) one or more genes involved in guaiacol production. v Gene variants, thus detecting multiple strains of the genus Alicyclobacillus among species that produce guaiacol and cause beverage / juice spoilage. The kit may include one or more (e.g., one, two, three or more) v The kit may include primers for a gene variant. The kit may include a 16s ribosomal RNA gene and one or more (e.g., one, two, three, or more) v Primers and probes for both gene variants. Example

[0183] Various aspects of the disclosure are illustrated with reference to the following non-limiting examples.

[0184] Example 1: Detection of Alicyclobacillus Species and Identification of Guaiacol Production Using GENE-UP® PRO ACB, IFU Method No. 12, and the Cosmo Bioassay GENE-UP® PRO ACB Method Add YSG broth (99 mL) to a 7 oz enrichment bag with a mesh divider. 5An inoculum of 10 CFU (1 ml) of the target organism was added to all samples, except the negative control. The sample bags were incubated at 45°C for 24 hours, after which 50 mL of the enriched sample was transferred to a 50 mL falcon tube and centrifuged at 500 rcf for 10 minutes. The supernatant (25 mL) was then transferred to a new 50 mL falcon tube and centrifuged at 4,000 rcf for 10 minutes. The supernatant was decanted, retaining the pellet. The samples were then analyzed using the GENE-UP® ACB PRO PCR System (which includes detection capabilities for the novel vdcC target as described herein) using the following steps.

[0185] The ACB buffer (500 μL) of the PCR kit was added to the pellet and vortexed. Lysis was performed by transferring 20 μL of the pellet / buffer mixture to a lysis tube (Biomerieux, Marcy-l'Etoile, France). The lysis tube was vortexed at 2,500 rpm for 5 min on an OHAUS digital mixer. Then, 5 μL of the lysate was transferred to the ACB master mix tube. These tubes were moved to the GENE-UP® loading platform and the ACB protocol was performed. The output from the GENE-UP® software is binary (presence / absence), but provides additional quantitative data to the user. The results from the Cy5 channel are used to determine the presence / absence of guaiacol producers. Each culture was also plated for use in the Cosmo Bio guaiacol detection kit to determine guaiacol production according to the IFU protocol, as shown below: Cosmo Bioassay: Guaiacol production was determined using the Cosmo Bio Guaiacol Detection Kit according to the manufacturer's instructions (Cosmo Bio Co., Ltd., Tokyo, Japan). Briefly, a loopful of plated colonies was added to each YSG-vanillin tube and incubated at 45°C for 3 hours. The three reagents included in the kit were added to each tube and compared to a negative control to assess whether a color change occurred. Alicyclobacillus cultures were grown on BAT plates derived from the IFU confirmation plates. If a sample did not grow on the confirmation plate, a culture grown on the YSG plate was used.

[0186] result Table 1: Spoilage capacity assay study testing various Alicyclobacillus strains representing 10 different species, the strains being tested at 10 5CFU / ml levels (each in triplicate) were inoculated and evaluated using the GENE-UP® PRO ACB assay and the Cosmo bioassay.

[0187] Example 2: Primer pairs were designed to amplify SEQ ID NO: 1 from Alicyclobacillus acidoterrestris, SEQ ID NO: 2 from Alicyclobacillus herbalis, and SEQ ID NO: 3 from Alicyclobacillus carota. The primer pair for SEQ ID NO: 1 from Alicyclobacillus acidoterrestris included a first primer having a sequence of SEQ ID NO: 4 and a second primer having a sequence of SEQ ID NO: 5. The primer pair for SEQ ID NO: 2 from Alicyclobacillus herbalis included a first primer having a sequence of SEQ ID NO: 6 and a second primer having a sequence of SEQ ID NO: 7. The primer pair for SEQ ID NO: 3 from Alicyclobacillus carota included a first primer having a sequence of SEQ ID NO: 8 and a second primer having a sequence of SEQ ID NO: 5.

[0188] Probes were designed to detect SEQ ID NO: 1 from Alicyclobacillus acidoterrestris, SEQ ID NO: 2 from Alicyclobacillus herbalis, and SEQ ID NO: 3 from Alicyclobacillus carota. The probe for SEQ ID NO: 1 from Alicyclobacillus acidoterrestris comprised a nucleic acid molecule having the sequence of SEQ ID NO: 9. The probe for SEQ ID NO: 2 from Alicyclobacillus herbalis comprised a nucleic acid molecule having the sequence of SEQ ID NO: 10. The probe for SEQ ID NO: 3 from Alicyclobacillus carota comprised a nucleic acid molecule having the sequence of SEQ ID NO: 11.

[0189] Sample preparation methods vary depending on the sample type.

[0190] The sample can be an Alicyclobacillus colony or Alicyclobacillus culture. The sample can be a food, a food suspension, a food solution, or a beverage. The sample can be raw fruit, cooked fruit, canned fruit, fruit juice, a fruit juice product, a mixed fruit juice, a carbonated fruit drink, a fruit-flavored tea, wine, or a fruit-flavored water. The sample can be an enriched sample.

[0191] For example, the sample is transferred to a container for cracking, such as a tube or a 96-well plate, and then lysis buffer is added to the sample, and the sample is mixed into the buffer by pipetting. The sample can be further mixed for 5 minutes at 2500 rpm with a vortex mixer. The sample of cracking is then allowed to settle. The supernatant containing the target DNA exists as a solution above the tube or hole. The target nucleic acid molecule can then be amplified, such as by PCR. The target DNA is then transferred to a container containing PCR reagents. After adding the sample, a single tube or well can contain, for example: 10 ng of template DNA (200 pg / μL); 0.1-0.5 μM primer having the sequence of SEQ ID NO: 4; 0.1-0.5 μM primer having the sequence of SEQ ID NO: 5; deoxynucleoside triphosphates (200 μM each of dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); 0.1-0.5 μM probe having the sequence of SEQ ID NO: 9; and PCR buffer. Alternatively, for detection of multiple analytes, the tube or well may contain, for example: 10 ng template DNA (200 pg / μL); 0.1-0.5 μM primer having the sequence of SEQ ID NO: 4; 0.2-1.0 μM primer having the sequence of SEQ ID NO: 5; 0.1-0.5 μM primer having the sequence of SEQ ID NO: 6; 0.1-0.5 μM primer having the sequence of SEQ ID NO: 7; 0.1-0.5 μM primer having the sequence of SEQ ID NO: 8; deoxynucleoside triphosphates (200 μM each of dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); 0.1-0.5 μM probe having the sequence of SEQ ID NO: 9; 0.1-0.5 μM probe having the sequence of SEQ ID NO: 10; 0.1-0.5 μM probe having the sequence of SEQ ID NO: 11; and PCR buffer. Alternatively, for multiplex reactions, the tubes may additionally contain primers and probes designed for another bacterial genus, such as E. coli. Auxiliary oligonucleotides or a secondary probe may also be added. Alternatively, a dye such as SYBR Green may be used in place of the probe.

[0192] DNA amplification is achieved using PCR. A multiplex protocol can be used. An exemplary protocol is: 94°C x 1 minute, 58.1°C x 2 minutes, and 72°C x 3 minutes, repeated 35-40 times; then hold at 4°C. Once the run is complete, analyze the results. Apply color compensation to eliminate signal crosstalk. Calculate Ct / Cp values ​​using methods known in the art.

[0193] An amplification curve has a characteristic shape with an initial lag phase, an exponential expansion phase, and a final plateau phase. The final plateau phase, which represents the decrease in reaction efficiency as the reagents are consumed, is not achieved in reactions containing low levels of the target organism. Amplification curves that deviate from this characteristic shape should be interpreted with caution. For each amplification reaction, the cycle at which the fluorescence signal rises above background fluorescence is determined and referred to as the "threshold cycle" (Ct) or "crossing point" (Cp), depending on the instrument. For samples containing high levels of the target organism, the Ct / Cp ratio will occur at an earlier cycle, and for reactions containing low levels of the target organism, it will be delayed. Real-time PCR can be used to detect a single amplicon; for example, an amplicon having the sequence of SEQ ID NO: 1 can be detected in the FAM channel. Multiple amplicons can be detected in different channels in a multiplexed manner. For example, an amplicon having the sequence of SEQ ID NO: 1 can be detected in the FAM channel, an amplicon having the sequence of SEQ ID NO: 2 can be detected in the ROX channel, and an amplicon having the sequence of SEQ ID NO: 3 can be detected in the Cy5 channel. The HEX channel can be used as an internal amplification control (IAC) to indicate a successful PCR reaction and should be detected at a Ct / Cp value of approximately 26-30 cycles.

[0194] The presence of the amplification curve indicates that there is an amplicon in the sample. The presence of the amplicon with the sequence of SEQ ID NO: 1 indicates a sample that is positive for Alicyclobacillus acidoterrestrial. The presence of the amplicon with the sequence of SEQ ID NO: 2 indicates a sample that is positive for Alicyclobacillus herbaceus. The presence of the amplicon with the sequence of SEQ ID NO: 3 indicates a sample that is positive for Alicyclobacillus carrotus. However, it is important to note that no matter the species of the Alicyclobacillus species present in the sample, the presence of the amplicon with the sequence of SEQ ID NO: 1, 2 or 3 indicates an organism that can cause deterioration by producing guaiacol. High Ct / Cp values ​​(such as ≥38) can indicate false positives. Negative and positive controls can be used to verify the functionality of the assay. The sample can also be run again with the starting template DNA of higher concentration. The hypothetical positive sample can be confirmed by microbial plating and colony PCR.

[0195] result The juice sample was enriched, the enriched sample was lysed, and a portion of the lysate was added to a PCR tube. PCR reagents were added and multiplex PCR was performed using the following primers: Forward: GAGACGGACTACATGGTCGG (SEQ ID NO: 4), Reverse: GCAAAGCCGCCGTACCG (SEQ ID NO: 5), Forward: GAGACTGACTACATGGTGGG (SEQ ID NO: 8), Forward: GAGGTCGACTACATGATTGG (SEQ ID NO: 6), and Reverse: GCAAGCCCCCATAACG (SEQ ID NO: 7).

[0196] Amplification products were detected using the following fluorophore-labeled probes: Probe 1: ATGCGTATACATCGCGTTCACCGCGACGATT (SEQ ID NO: 9), Probe 2: GTGCGTGTACATTGCATTCACAGCCACGATC (SEQ ID NO: 10), and Probe 3: ATGCGTGTACATGGCATTGACGGCCACGATT (SEQ ID NO: 11).

[0197] Example 3: Detection method using a gene target for predicting spoilage and a vertical flow detection device It is possible to detect the predictive region (SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3), or fragments thereof, using a variety of detection methods.

[0198] Sample preparation methods vary depending on the sample type.

[0199] The sample can be an alicyclic acid bacillus colony or an alicyclic acid bacillus culture. The sample can be a food, a food suspension, a food solution or a beverage. The sample can be raw fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, mixed fruit juice, carbonated fruit juice drink, fruit flavored tea, wine or fruit flavored water. The sample is transferred to a container for cracking, such as a tube or a 96-well plate, and then lysis buffer is added to the sample and the sample is mixed into the buffer by pipetting. The sample can be further mixed for 5 minutes at 2500 rpm with a vortex mixer. The cracked sample is then allowed to settle. The supernatant containing the target DNA exists as a solution above the tube or hole. The target nucleic acid molecule can then be amplified, such as by PCR. The target DNA is then transferred to a container containing PCR reagents. After adding the sample, a single tube or well can contain, for example: 10 ng of template DNA (200 pg / μL); 0.1-0.5 μM primer having the sequence of SEQ ID NO: 4; 0.1-0.5 μM primer having the sequence of SEQ ID NO: 5; deoxynucleoside triphosphates (200 μM each of dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); 0.1-0.5 μM probe having the sequence of SEQ ID NO: 9; and PCR buffer. Alternatively, for detection of multiple analytes, the tube or well may contain, for example: 10 ng template DNA (200 pg / μL); 0.1-0.5 μM primer having the sequence of SEQ ID NO: 4; 0.2-1.0 μM primer having the sequence of SEQ ID NO: 5; 0.1-0.5 μM primer having the sequence of SEQ ID NO: 6; 0.1-0.5 μM primer having the sequence of SEQ ID NO: 7; 0.1-0.5 μM primer having the sequence of SEQ ID NO: 8; deoxynucleoside triphosphate nucleotides (200 μM each of dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); 0.1-0.5 μM probe having the sequence of SEQ ID NO: 9; 0.1-0.5 μM probe having the sequence of SEQ ID NO: 10; 0.1-0.5 μM probe having the sequence of SEQ ID NO: 11; and PCR buffer. Auxiliary oligonucleotides or a second probe may also be added.

[0200] In this example, DNA amplification was achieved using PCR. A multiplex protocol can be used. An exemplary protocol is: 94°C x 1 minute, 58.1°C x 2 minutes, and 72°C x 3 minutes, repeated 35-40 times; then held at 4°C.

[0201] Targets can be detected, for example, using a vertical flow device. Use a pipette to transfer the sample (e.g., 200 μL) directly to the window of the vertical flow device. Use a separate vertical flow device for each PCR tube sample. Allow the vertical flow device to develop color for 2 minutes ± 15 seconds.

[0202] system In some embodiments, a system for use with the methods described herein is provided. The system may include a kit or mixture as described above, and an instrument for performing the assay. In at least one embodiment, Figure 2 The illustrated system can include at least one PCR reaction mixture disposed in a sample container 714. In certain embodiments, the sample container 714 can include a PCR reaction mixture configured to allow and / or achieve amplification of a template nucleic acid. Certain illustrative embodiments can also include at least one sample block or chamber 716 configured to receive the at least one sample container 714. The sample container 714 can include any number of sample containers in a single, strip, plate, or other form, and can, for example, be provided as or received by a sample block or chamber 716.

[0203] One or more embodiments may also include at least one sample temperature control device 718 and / or 720 configured to manipulate and / or adjust the temperature of the sample. Such sample temperature control devices can be configured to increase, decrease, and / or maintain the temperature of the sample. In one example, sample control device 718 is a heating system, and sample control device 720 is a cooling system. Illustrative sample temperature control devices include, but are not limited to, heating and / or cooling blocks, elements, exchangers, coils, radiators, freezers, wires, Peltier devices, forced air blowers, processors, vents, distributors, compressors, condensers, water baths, ice baths, flames and / or other combustible or flammable forms of heat, heat packs, cold packs, dry ice, dry ice baths, liquid nitrogen, microwaves and / or other wave emitting devices, cooling tools, heating tools, tools for otherwise manipulating the sample temperature, and / or any other suitable device configured to increase, decrease, and / or maintain the sample temperature.

[0204] The illustrative PCR system 700 also includes an optical system 710 configured to detect the amount of fluorescence emitted by a sample 714 (or a portion or reagent thereof). Such an optical system 710 may include one or more fluorescence channels as known in the art and may detect fluorescence from multiple samples simultaneously or separately.

[0205] At least one embodiment of the PCR system may further include a CPU 706 that is programmed or configured to operate, control, execute, or otherwise drive the heating system 718 and the cooling system 720 to thermally cycle the PCR reaction mixture, for example, while the optical system 710 collects fluorescent signals. The CPU 706 may then generate an amplification curve, a melting curve, or any combination thereof, which may or may not be printed, displayed on a screen of the user terminal 704, or otherwise output. Optionally, a positive, negative, or other determination based on the amplification and / or melting curves may be output, for example, on a screen of the user terminal 704. Optionally, only a determination is output, for example, one determination for each target tested.

[0206] CPU 706 may include program memory, microcontroller or microprocessor (MP), random access memory (RAM) and input / output (I / O) circuits, all of which are interconnected by address / data bus. Program memory may include operating systems, such as Microsoft Windows®, OS X®, Linux®, Unix®, etc. In some embodiments, CPU 706 may also include database or other data storage mechanisms (such as, one or more hard disk drives, optical storage drives, solid-state storage devices, etc.), or otherwise be connected to their communications. The database may include data, such as melting curve, annealing temperature, denaturation temperature and generation and analysis of other data necessary for melting curve. CPU 706 may include multiple microprocessors, multiple RAMs and multiple program memories and many different types of I / O circuits. CPU 706 may perform as RAM and the program memory of, for example, semiconductor memory, magnetically readable memory and / or optically readable memory.

[0207] The microprocessor can be adapted and configured to execute, in addition to other software applications, any one or more of a plurality of software applications and / or any one or more of a plurality of software programs present in the program memory. One of the plurality of programs can include a thermal cycling program that can include providing control signals to the heating system 718 and the cooling system 720 to heat and cool the sample 714, respectively, according to a two-step PCR protocol. Another of the plurality of programs can include a fluorescence program that can include providing control signals to the optical system 710 to emit a fluorescence signal and detect the amount of fluorescence scattered by the sample 714. Yet another of the plurality of programs can include a sample determination program that can include obtaining fluorescence data (temperature, fluorescence pairs) from the optical system 710 during an intra-cycle temperature adjustment segment for each of N cycles, generating a composite melting curve by combining the fluorescence data from each of the N cycles during the respective intra-cycle temperature adjustment segments, analyzing the composite melting curve to make a positive or negative determination, and displaying the composite melting curve, the individual melting curves, and / or a determination indication on the user terminal 704.

[0208] In some embodiments, the CPU 706 can communicate with the user terminal 704, the heating system 718, the cooling system 720, the optical system 710, and the sample block 716 via a communication network 722-732 via wired or wireless signals, and in some instances, can communicate via the communication network via intervening wireless or wired devices, such as wireless routers, wireless repeaters, base transceiver stations of mobile phone operators, and the like. The communication network can be a wireless communication network, such as a fourth-generation or third-generation cellular network (4G or 3G, respectively), a Wi-Fi network (802.11 standard), a WiMAX network, a wide area network (WAN), a local area network (LAN), the Internet, and the like. Furthermore, the communication network can be a private network, a secure public Internet, a virtual private network, and / or some other type of network, such as a dedicated access line, an ordinary telephone line, a satellite communication link, a combination of these, and the like. When the communication network comprises the Internet, data communication can occur via the communication network via Internet communication protocols. Still further, the communication network can be a wired network, wherein data communication can occur via an Ethernet or Universal Serial Bus (USB) connection.

[0209] In some embodiments, the CPU 706 may be included in the user terminal 704. In other embodiments, the CPU 706 may communicate with the user terminal 704 via a wired or wireless connection (e.g., as a remote server) to display individual melting curves, composite melting curves, determinations, etc. on the user terminal 704. In addition to the CPU 706 or another CPU similar to the CPU 706, the user terminal 704 may also include a user interface, a communication unit, and a user input device, such as a "soft" keyboard displayed on the user interface of the user terminal 704, an external hardware keyboard (e.g., a Bluetooth keyboard) communicating via a wired or wireless connection, an external mouse, or any other suitable user input device.

[0210] Although the present disclosure has been described in considerable detail with reference to certain preferred embodiments thereof, other forms are possible. Therefore, the spirit and scope of the appended claims should not be limited to the preferred forms contained in this specification and this specification. Embodiments are now described with reference to the examples that follow. These examples are provided for illustrative purposes only, and the embodiments should in no way be construed as being limited to these examples, but rather should be construed as including any and all variations that become apparent due to the teachings provided herein. Those skilled in the art will readily recognize various non-critical parameters that can be varied or modified to obtain substantially similar results.

Claims

1. A mixture comprising: a first primer that specifically binds to a target nucleic acid molecule, wherein the target nucleic acid molecule comprises a sequence of any one of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof; a second primer that specifically binds to a complementary sequence of the target nucleic acid molecule; deoxynucleotide triphosphates; DNA polymerase; buffer; and A test sample is suspected of having a nucleic acid that is substantially homologous to the target nucleic acid molecule.

2. The mixture according to claim 1, wherein The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 4; and The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:

5.

3. The mixture according to claim 1, wherein The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 6; and The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:

7.

4. The mixture according to claim 1, wherein The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8; and The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:

5.

5. The mixture according to any one of claims 1 to 4, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to the target nucleic acid molecule or a fragment thereof or a complementary sequence thereof. The mixture of claim 5 , further comprising a detectable label, wherein the probe is covalently bound to the detectable label.

7. The mixture of claim 5, wherein the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 9 or its complementary sequence, and the target nucleic acid molecule sequence comprises SEQ ID NO: 1, its complementary sequence, or a fragment thereof.

8. The mixture of claim 5, wherein the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 10 or its complementary sequence, and the target nucleic acid molecule sequence comprises SEQ ID NO: 2, its complementary sequence, or a fragment thereof.

9. The mixture of claim 5, wherein the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 11 or its complementary sequence, and the target nucleic acid molecule sequence comprises SEQ ID NO: 3, its complementary sequence, or a fragment thereof.

10. The mixture of claim 1, wherein the test sample comprises a food, a food suspension, a food solution, or a beverage.

11. The mixture according to claim 10, wherein the test sample comprises one or more of the following: raw fruit, cooked fruit, canned fruit, juice, juice product, mixed juice, carbonated juice drink, fruit-flavored tea, wine, and fruit-flavored water.

12. A method for detecting an organism comprising a target nucleic acid molecule in a test sample, wherein the target nucleic acid molecule comprises a sequence substantially homologous to one of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof, the method comprising: reacting the test sample with a first primer comprising a sequence that specifically binds to the target nucleic acid molecule under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; and reacting the test sample with a second primer comprising a sequence that specifically binds to a complementary sequence of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; as well as The presence or absence of the detectable amplicon is detected.

13. The method according to claim 12, wherein the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule to which the first primer binds.

14. The method according to any one of claims 12 or 13, wherein The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 4, and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5; The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 6, and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7; or The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8, and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:

5.

15. The method according to claim 13, wherein The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 4, the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5, and the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 9; The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 6, the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7, and the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 10; or The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8, the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5, and the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO:

11.

16. The method of claim 12, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

17. A method for detecting an amylolytic strain of Alicyclobacillus acidoterrestris, the method comprising: reacting a test sample with a first primer comprising a sequence that specifically binds to a target nucleic acid comprising a sequence of SEQ ID NO: 1, a fragment thereof, or a complement thereof, and a second primer under conditions sufficient to produce a detectable amplicon comprising a sequence of SEQ ID NO: 1, a fragment thereof, or a complement thereof, and a second primer that specifically binds to a complementary sequence of the target nucleic acid molecule to which the first primer binds; as well as The presence or absence of the amplicon is detected.

18. The method of claim 17, wherein the first primer is substantially homologous to the sequence of SEQ ID NO: 4 or its complementary sequence, and the second primer is substantially homologous to the sequence of SEQ ID NO: 5 or its complementary sequence.

19. The method according to any one of claims 17-18, wherein the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule or a complementary sequence thereof.

20. The method of claim 19, wherein the probe is labeled with a detectable tag.

21. The method of claim 19, wherein the probe is substantially homologous to the sequence of SEQ ID NO: 9 or its complement.

22. A method for detecting an amylolytic strain of herbal Alicyclobacillus sp., the method comprising: reacting the test sample with a first primer comprising a sequence that specifically binds to a target nucleic acid comprising a sequence of SEQ ID NO: 2, a fragment thereof, or a complement thereof, and a second primer under conditions sufficient to produce a detectable amplicon comprising a sequence of SEQ ID NO: 2, a fragment thereof, or a complement thereof, and a second primer that specifically binds to a complementary sequence of the target nucleic acid molecule to which the first primer binds; as well as The presence or absence of the amplicon is detected.

23. The method of claim 22, wherein the first primer is substantially homologous to the sequence of SEQ ID NO: 6 or its complementary sequence, and the second primer is substantially homologous to the sequence of SEQ ID NO: 7 or its complementary sequence.

24. The method according to any one of claims 22-23, wherein the method further comprises reacting the test sample with a probe that specifically binds to a target nucleic acid molecule or a complementary sequence thereof.

25. The method of claim 24, wherein the probe is labeled with a detectable tag.

26. The method of claim 24, wherein the probe is substantially homologous to the sequence of SEQ ID NO: 10 or its complementary sequence.

27. A method for detecting an amylolytic strain of Alicyclobacillus carotovora, the method comprising: reacting the test sample with a first primer comprising a sequence that specifically binds to a target nucleic acid comprising a sequence of SEQ ID NO: 3, a fragment thereof, or a complement thereof, and a second primer under conditions sufficient to produce a detectable amplicon comprising a sequence of SEQ ID NO: 3, a fragment thereof, or a complement thereof, and a second primer that specifically binds to a complementary sequence of the target nucleic acid molecule to which the first primer binds; as well as The presence or absence of the amplicon is detected.

28. The method of claim 27, wherein the first primer is substantially homologous to the sequence of SEQ ID NO: 8 or its complement, and the second primer is substantially homologous to the sequence of SEQ ID NO: 5 or its complement.

29. The method according to any one of claims 27-28, wherein the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule or its complementary sequence.

30. The method of claim 29, wherein the probe is labeled with a detectable tag.

31. The method of claim 29, wherein the probe is substantially homologous to the sequence of SEQ ID NO: 11 or its complement.

32. A method for detecting a contaminant in a test sample, the contaminant comprising a target nucleic acid molecule having a sequence substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof, or a variant thereof, the method comprising: reacting the test sample with a first primer comprising a sequence that specifically binds to the target nucleic acid molecule under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; and reacting the test sample with a second primer comprising a sequence that specifically binds to a complementary sequence of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, a fragment thereof, or a complementary sequence thereof; as well as The presence or absence of the amplicon is detected, wherein the presence of the detectable amplicon indicates the presence of a contaminant in the test sample.

33. The method of claim 32, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

34. The method of claim 32, wherein the method for detecting the detectable amplicon comprises one or more steps selected from the group consisting of: Directly detecting a measure of a physical property of the amplicon, detecting UV absorbance at 260 nm; separating the amplicons; sequencing the amplicons; staining the amplicons with a dye and detecting the dye; complexing the amplicons with a detectable label and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the number of amplicon copies in the sample; and detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the number of amplicon copies in the sample.

35. A method for detecting the possibility of spoilage in a test sample, comprising: Providing a test sample, wherein the test sample comprises a food, a food suspension, a food solution or a beverage, the method comprising: reacting the test sample with a first primer comprising a sequence that specifically binds to the target nucleic acid molecule, wherein the target nucleic acid molecule comprises the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or a complement thereof; and reacting the test sample with a second primer comprising a sequence that specifically binds to a complementary sequence of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or its complement; and The presence or absence of the detectable amplicon is detected, wherein the presence of the detectable amplicon indicates a positive spoilage likelihood for the test sample.

36. The method of claim 35, wherein the test sample comprises raw fruit, cooked fruit, canned fruit, juice, juice product, juice blend, carbonated juice drink, fruit-flavored tea, wine, or fruit-flavored water.

37. The method of claim 35, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

38. The method of claim 35, wherein the method for detecting the detectable amplicon comprises one or more steps selected from the group consisting of: Directly detecting a measure of a physical property of the amplicon, detecting UV absorbance at 260 nm; separating the amplicons; sequencing the amplicons; staining the amplicons with a dye and detecting the dye; complexing the amplicons with a detectable label and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the number of amplicon copies in the sample; and detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the number of amplicon copies in the sample.

39. A method for detecting at least one contaminant in a test sample, each contaminant comprising one of three target nucleic acid molecules, each of the three target nucleic acid molecules having a sequence substantially homologous to one of the sequences of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complementary sequence thereof, or a variant thereof, the method comprising: The test sample is reacted with a first primer, a second primer, a third primer, a fourth primer, and a fifth primer under conditions sufficient to produce three detectable amplicons, wherein The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 4; The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5; The third primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 6; The fourth primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7; The fifth primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8; The three detectable amplicons comprise the three target nucleic acid molecules or fragments thereof or complementary sequences thereof; and The presence or absence of each of the three amplicons is detected, wherein the presence of any one of the three amplicons indicates the presence of a contaminant in the test sample.

40. The method of claim 39, further comprising reacting the test sample with: a first probe comprising a sequence substantially homologous to the sequence of SEQ ID NO: 9; a second probe comprising a sequence substantially homologous to the sequence of SEQ ID NO: 10; and A third probe comprising a sequence substantially homologous to the sequence of SEQ ID NO:

11.

41. A system comprising: The mixture according to any one of claims 1 to 4; and An instrument configured to perform an amplification assay on the mixture.

42. The system of claim 41, further comprising at least one sample container.

43. The system of claim 42, further comprising at least one PCR reaction mixture, wherein each of the PCR reaction mixtures is contained in one of the at least one sample container.

44. The system of claim 41, further comprising at least one sample temperature control device.

45. The system of claim 41, wherein the mixture further comprises a probe comprising a sequence substantially homologous to the target nucleic acid molecule, or a fragment thereof, or a complementary sequence thereof.

46. ​​A kit comprising: a first primer comprising a sequence substantially homologous to a target nucleic acid molecule comprising the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3; a second primer comprising a sequence substantially complementary to the target nucleic acid molecule to which the first primer is substantially homologous; deoxynucleotide triphosphates; and Buffer.

47. The kit according to claim 46, further comprising a DNA polymerase.

48. The kit of claim 46, wherein the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 4; and The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:

5.

49. The kit of claim 48, further comprising a probe, wherein the probe comprises a sequence substantially homologous or substantially complementary to the sequence of SEQ ID NO:

9.

50. The kit of claim 46, wherein the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 6; and The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:

7.

51. The kit of claim 50, further comprising a probe, wherein the probe comprises a sequence substantially homologous or substantially complementary to the sequence of SEQ ID NO:

10.

52. The kit of claim 46, wherein the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8; and The second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:

5.

53. The kit of claim 52, further comprising a probe, wherein the probe comprises a sequence substantially homologous or substantially complementary to the sequence of SEQ ID NO:

11.

54. The kit of any one of claims 49, 51 or 53, wherein the probe is covalently bound to a detectable label.

55. The kit of claim 54, wherein the probe further comprises a quencher positioned to quench the signal from the detectable label.

Citation Information

Patent Citations

  • Sequence Specific Real-Time Monitoring of Loop-Mediated Isothermal Amplification (LAMP)

    US20130171643A1