Anti-wrinkle heptapeptide as well as biosynthesis process and application thereof
The anti-wrinkle heptapeptide is prepared through biosynthesis technology, which solves the high cost and environmental pollution problems of chemical synthesis method and achieves low-cost and high-efficiency anti-wrinkle effect.
Patent Information
- Application Number
- CN202510927732.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-07
- Publication Date
- 2025-10-10
Smart Images

Figure CN120757610A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of active peptides and cosmetics, and in particular to an anti-wrinkle heptapeptide and its biosynthesis process and application. Background Art
[0002] Argireline was discovered by Lipotec and has been used in cosmetic raw materials. Its Chinese name is: Acetyl Hexapeptide-8, also known as Acetyl Hexapeptide-3 / Hexapeptide, with a molecular weight of 888.91 and a molecular formula of C 34 H 60 N 14 O 12 S. is an oligopeptide that mimics the six amino acids at the N-terminus of the SNAP-25 protein; its structure and amino acid sequence are Ac-EEMQRR-NH2, where Ac stands for acetyl-(acetyl group); it has similar functions to botulinum toxin, inhibiting the SNARE complex, the source of neurotransmitter signals, to inhibit the activity of nerve cells, thereby directly reducing muscle contraction and thus alleviating the formation of wrinkles. Currently, acetyl octapeptide-3, an extended analogue of arginine, is used in cosmetics. It is composed of eight amino acids and has a molecular formula of: C 41 H 70 N 16 O 16 S, with a molecular weight of 1075.16, has a structure and amino acid sequence of Ac-EEMQRRAD-NH2, with one more alanine and one aspartic acid than arginine.
[0003] The above acetyl hexapeptides and octapeptides are all produced by chemical synthesis, which is expensive and the process may cause environmental pollution or human harm. Classical chemical synthesis methods include liquid phase polypeptide synthesis (LPPS) and solid phase polypeptide synthesis (SPPS), such as using solid or liquid phase media to add peptide chains one by one in sequence to the synthetic intermediate product, that is, the construction of amide functional groups. In this preparation, the amino acid functional groups that do not want to participate in the reaction are protected, and then chemical coupling is carried out in sequence, and finally deprotected. The chemical synthesis method is suitable for the synthesis of short chains such as dipeptides and tripeptides, but for the synthesis of longer polypeptide chains, there will be many reaction steps, many by-products and intermediates, low overall yield, the presence of racemates, high purification costs and other problems. For example, in patent document No. 201910991436.4, entitled "A Large-Scale Synthesis Method for Argireline," 2-Chlorotrityl Chloride resin is used as a carrier for solid-phase synthesis of fully protected peptide acid fragments. The fully protected peptide acid fragments are used as raw materials, and the carboxyl end undergoes a liquid-phase amidation reaction to obtain fully protected amides, which are then deprotected to obtain the target peptide. Although some improvements have been made to classical chemical synthesis, the degree of substitution of the resin carrier is only 1.6 mmol / g, resulting in low reaction efficiency and overall low synthesis efficiency. Moreover, the introduction of highly corrosive and pungent ammonia during the amidation reaction inevitably harms the entire reaction equipment and operators, and also has a negative impact on the environment.
[0004] Based on this, scientists have tried to use biosynthesis processes to prepare acetyl hexapeptides, octapeptides, etc. For example, in the patent document with application number 202410629893.X and titled "A Pro.AH8 acetyl hexapeptide-8 with firming and anti-wrinkle effects and its preparation method and application", it discloses the construction of a plasmid expression vector of the hexapeptide-8, which is transformed into a host bacterium; the expression host bacterium is cultured to induce protein expression; the protein is purified, and the purified protein is cleaved by enterokinase to obtain hexapeptide-8; glutamate acetyltransferase, acetyladenosine, and amidase are added to the hexapeptide-8 to carry out acetylation and amidation reactions; and finally, acetyl hexapeptide-8 is purified by ion exchange resin.
[0005] While these studies have replaced chemical synthesis processes to some extent, they still face challenges with biosynthesis, such as inconvenient control and high costs. Therefore, developing a new biosynthesis process that is simpler, more controllable, and less expensive, resulting in a product of higher purity, better health and environmental friendliness, and with more pronounced anti-wrinkle benefits, remains a pressing challenge for researchers. Summary of the Invention
[0006] Based on the above-mentioned practical problems, the primary purpose of the present invention is to provide an anti-wrinkle heptapeptide. The amino acid sequence of the peptide is GEEMQRR, and the subsequent six-position sequence is completely consistent with the sequence of the six amino acids at the N-terminus of the SNAP-25 protein; it is completely consistent with the core structure of acetyl hexapeptide-8 (Argirelin) and acetyl octapeptide-3, and has fewer chemical modifications; the biosynthetic process path is lower in cost and more environmentally friendly. At the same time, the short peptide has good skin permeability and stability, has strong anti-wrinkle and wrinkle-removing activity, and does not cause any perceptible discomfort to the subject. The short peptide of the present invention enters the market with a purely biosynthetic production method and a suitable price, benefiting the majority of beauty seekers.
[0007] A second object of the present invention is to provide a biosynthetic process for the above-mentioned anti-wrinkle heptapeptide.
[0008] A third object of the present invention is to provide an application of the anti-wrinkle heptapeptide or its biosynthesis process.
[0009] In order to achieve the above object, the technical solution adopted by the present invention is:
[0010] An anti-wrinkle heptapeptide, whose amino acid sequence is: Gly-Glu-Glu-Met-Gln-Arg-Arg (GEEMQRR) and whose theoretical molecular weight is 900 Da.
[0011] The above-mentioned anti-wrinkle heptapeptide-related biomaterial is any one of the following biomaterials:
[0012] 1) a nucleic acid molecule encoding the anti-wrinkle heptapeptide;
[0013] 2) an expression cassette containing the nucleic acid molecule described in 1);
[0014] 3) a recombinant vector containing the expression cassette described in 2);
[0015] 4) A genetically engineered bacterium containing the recombinant vector described in 3).
[0016] Furthermore, the nucleotide sequence of the nucleic acid molecule described in 1) is shown as SEQ ID No. 2.
[0017] Furthermore, the nucleotide sequence of the expression cassette described in 2) is shown as SEQ ID No. 3 or SEQ ID No. 4 or SEQ ID No. 5.
[0018] Furthermore, the recombinant vector described in 3) is a recombinant vector constructed based on plasmid pET26, plasmid pET32a or plasmid pGEX-6p.
[0019] Furthermore, the genetically engineered bacteria described in 4) are genetically engineered bacteria constructed based on the Escherichia coli expression strain BL21 (DE3).
[0020] The biosynthesis process of the anti-wrinkle heptapeptide comprises the following steps:
[0021] (1) Construction of a genetically engineered bacterium containing a nucleic acid molecule encoding the anti-wrinkle heptapeptide;
[0022] (2) Fermentation culture and induced expression of genetically engineered bacteria;
[0023] (3) Peptide purification and enzymatic cleavage.
[0024] Furthermore, the specific operation of step (1) is as follows: the sequence shown in SEQ ID No. 5 is transferred into an Escherichia coli expression strain, and genetically engineered Escherichia coli is obtained by screening.
[0025] Furthermore, the specific operation of step (2) is as follows: the genetically engineered Escherichia coli bacteria are inoculated into LB culture medium and cultured to obtain seed liquid; the seed liquid is inoculated into LB culture medium for amplification culture, and the OD value of the bacterial liquid is 600 When the pH value was 0.6, IPTG was added to a final concentration of 0.5 mM for induction, the culture was continued, and the bacteria were collected by centrifugation.
[0026] Furthermore, the specific operation of step (3) is as follows: resuspending the bacteria in Tris buffer, ultrasonically disrupting, and collecting the supernatant by centrifugation; purifying the supernatant using a nickel ion affinity column to obtain the anti-wrinkle heptapeptide fusion protein; adding TEV enzyme for enzymatic cleavage, removing the fusion tag through a nickel column, and purifying by dialysis to obtain an anti-wrinkle heptapeptide solution. The concentration of the anti-wrinkle heptapeptide solution is 1000-2000 ppm, preferably 1500 ppm.
[0027] An anti-wrinkle composition, comprising the anti-wrinkle heptapeptide as an active ingredient.
[0028] Furthermore, the composition comprises the following components in terms of concentration: 4% v / v to 6% v / v of glycerol, 0.4% w / v to 0.6% w / v of sodium chloride, 0.002% w / v to 0.004% w / v of EDTA, 0.2% v / v to 0.3% v / v of the above-mentioned anti-wrinkle heptapeptide solution, and the balance being water.
[0029] Furthermore, the composition comprises the following components by mass percentage: 5% v / v glycerol, 0.5% w / v sodium chloride, 0.003% w / v EDTA, 0.25% v / v anti-wrinkle heptapeptide solution, and the balance is water.
[0030] The anti-wrinkle composition is prepared by sequentially adding glycerol, sodium chloride, EDTA, and the anti-wrinkle heptapeptide solution into pure water, then adjusting the volume with pure water, and stirring thoroughly to mix the mixture.
[0031] Application of the above anti-wrinkle heptapeptide, biomaterial or anti-wrinkle composition in the field of cosmetics.
[0032] The present invention has the following advantages and effects compared to the prior art:
[0033] 1. This application uses a pure biosynthesis process to synthesize the L7 short peptide.
[0034] 2. The process of this application is simple and the cost is low.
[0035] 3. The application process is simple and controllable.
[0036] 4. The L7 short peptide of this application has significant anti-wrinkle effect. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 This is the pET-32a-L7 plasmid map.
[0038] Figure 2 The electrophoresis diagrams are before and after fusion protein cleavage.
[0039] Figure 3 This is a statistical chart of product skin feel evaluation results.
[0040] Figure 4 Statistical chart of product anti-wrinkle evaluation results (n=34).
[0041] Figure 5 This is the product satisfaction evaluation result chart (n=34).
[0042] Figure 6 The figure shows the change in wrinkle volume after using the product.
[0043] Figure 7 The figure shows the change in average wrinkle length after using the product.
[0044] Figure 8 The figure shows the change in average wrinkle depth after using the product. DETAILED DESCRIPTION
[0045] The following will clearly and completely describe the technical solutions of the specific embodiments of the present invention in combination with various specific embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. The experimental methods described in the following embodiments are all conventional methods unless otherwise specified; the reagents and materials, unless otherwise specified, can be obtained through ordinary commercial channels.
[0046] The peptide of the present invention is named L7 and consists of 7 amino acids. The amino acid sequence is: GEEMQRR, also represented herein as SEQ ID No. 1. The theoretical molecular weight of L7 is 900 Da. It can be prepared by traditional chemical synthesis processes, or by recombinant expression through fermentation processes, such as fermentation using Escherichia coli. The peptide of the present invention can be encoded by a nucleotide sequence, for example, by a nucleotide sequence of 5'-GGTGAAGAAATGCAGAGACGT-3' (SEQ ID No. 2). Due to the degeneracy of codons, the nucleotide sequence can be changed while retaining the original amino acid sequence. The nucleotide sequence can be cloned into an expression vector by conventional techniques, and then the expression vector can be transformed into a host cell. Transformation methods include but are not limited to electroporation, CaCl2 transformation, and the like. In the present invention, the expression vector can be a commonly used vector such as pET26, pET32, or pGEX-6p.
[0047] The peptides of the present invention can be expressed by different organisms, including but not limited to animal cells, plant cells, microbial cells, such as prokaryotes and eukaryotes. The microbial cells can be Enterobacteriaceae cells, such as Escherichia coli BL21.
[0048] The peptides of the present invention can be prepared and produced by conventional methods. For example, a host cell, such as Escherichia coli, transformed with the polynucleotide of the present invention can be cultured in a culture medium under appropriate conditions; and the peptides of the present invention can then be isolated by conventional separation and purification techniques.
[0049] The short peptide production process of this application includes the following steps:
[0050] (1) Construction of genetically engineered bacteria, such as the construction of genetically engineered Escherichia coli;
[0051] (2) Fermentation culture and induced expression of genetically engineered bacteria;
[0052] (3) Peptide purification and enzymatic cleavage.
[0053] Taking the E. coli genetically engineered bacteria as an example, the construction step in step (1) is as follows: the gene fragment corresponding to L7 is selected and optimized, codon optimization and splicing recombination are performed, and a complete recombinant gene is obtained; the recombinant DNA sequence is transferred into an E. coli expression strain, and the E. coli genetically engineered bacteria are screened.
[0054] The fermentation culture and induction expression of the genetically engineered bacteria in step (2) are as follows: (1) the single colony of the selected E. coli genetically engineered bacteria is picked from an LB plate and placed in 10 ml of LB medium, and cultured at 220 rpm and 37 DEG C for 12-16 h; (2) the bacterial solution is inoculated into LB medium at a ratio of 1:100 for scale-up culture, and cultured at 220 rpm and 37 DEG C for 3 hours; when the OD600 of the bacterial solution is about 0.6, 0.5 mM of IPTG is added for induction, and the culture is continued at 16 DEG C for 20 hours, and the bacterial cells are collected by centrifugation.
[0055] In step (3), the purification step of the peptide is as follows: (1) the bacteria are resuspended with Tris buffer, ultrasonically broken, and the supernatant is collected by centrifugation; (2) the fusion protein of recombinant L7 is purified from the supernatant by using an affinity column; and (3) the L7 peptide in the solution is purified by dialysis, ion exchange and the like.
[0056] In the present application, %v / v is volume percentage, which refers to the volume (mL) of the substance contained in 100 mL of the final solution.
[0057] In the present application, %w / v is weight volume percentage, which refers to the mass (g) of the substance contained in 100 mL of the final solution.
[0058] Example 1: Biosynthesis of L7 polypeptide
[0059] 1. According to the amino acid sequence of L7, the codon gene preferred by E. coli is selected and optimized, that is: 5'-GGTGAAGAAATGCAGAGACGT-3'(SEQ ID No. 2)
[0060] 2. In order to realize the extraction of L7, the histidine (affinity adsorption tag) gene sequence is added to the 5' end of the gene, and the following gene sequence is formed: 5'-CACCATCATCATCATCATGGTGAAGAAATGCAGAGACGT-3'(SEQ ID No. 3)
[0061] 3. In order to realize the correct expression of L7 and avoid the appearance of inclusion bodies, the solubility-promoting tag (Trx) gene is added before the above gene sequence, and the following gene sequence is further formed:
[0062] 5'-AGCGATAAAATTATTCACCTGACTGACGACAGTTTTGACACGGATGTACTCAAAG CGGACGGGGCGATCCTCGTCGATTTCTGGGCAGAGTGGTGCGGTCCGTGCAAAATGATCGCCCCGATTCTGGATGAAATCGCTGACGAATATCAGGGCAAACTGACCGTTGCAAAACTGAACATCGATCAAAACCCTGGCACTGCGCCGAAATATGG CATCCGTGGTATCCCGACTCTGCTGCTGTTCAAAAACGGTGAAGTGGCGGCAACCAAAGTGGGTGCACTGTCTAAAGGTCAGTTGAAAGAGTTCCTCGACGCTAACCTGGCCCACCATCATCATCATCATGGTGAAGAAATGCAGAGACGT-3'(SEQ ID No.4)
[0063] 4. To remove the solubility-promoting tag and affinity adsorption tag of L7, a TEV cleavage site gene was inserted into the above gene sequence, and a start codon and a stop codon were added to the head and tail of the above gene sequence to further form the following gene sequence, which was then commissioned to be synthesized by GENEWIZ:
[0064] 5'-ATGAGCGATAAAATTATTCACCTGACTGACGACAGTTTTGACACGGATGTACTCA AAGCGGACGGGGCGATCCTCGTCGATTTCTGGGCAGAGTGGTGCGGTCCGTGCAAAATGATCGCCCCGATTCTGGATGAAATCGCTGACGAATATCAGGGCAAACTGACCGTTGCAAAACTGAACATCGATCAAAACCCTGGCACTGCGCCGAAATATGGCATCCGTGG TATCCCGACTCTGCTGCTGTTCAAAAACGGTGAAGTGGCGGCAACCAAAGTGGGTGCACTGTCTAAAGGTCAGTTGAAAGAGTTCCTCGACGCTAACCTGGCCCACCATCATCATCATCATGAAAACCTGTATTTCCAGGGTGAAGAAATGCAGAGACGTTAA-3'(SEQ ID No.5)
[0065] 5. The codon-optimized gene sequence was cloned into the expression plasmid vector pET-32a to construct the recombinant expression vector pET-32a-L7. Figure 1 .
[0066] 6. Transform the recombinant expression vector pET-32a-L7 into the E. coli expression strain BL21 (DE3) and screen to obtain genetically engineered E. coli. The specific process is as follows:
[0067] 1) Add 1 μl of pET-32a-L7 plasmid to 100 μl of E. coli competent cells BL21 (DE3) and place on ice for 30 minutes;
[0068] 2) Heat shock the mixture in a 42°C water bath for 90 seconds, then quickly place on ice for 2 minutes;
[0069] 3) Add 600 μl of resistance-free LB medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride) to the mixture and incubate at 37°C and 220 rpm for 1 h;
[0070] 4) Take 200 μl of the bacterial solution and evenly spread it on a LAB plate containing ampicillin resistance (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar, 100 μg / ml ampicillin antibiotic);
[0071] 5) Incubate the plate upside down in a 37°C incubator for about 20 hours until clearly visible colonies appear.
[0072] 7. Fermentation culture and induced expression of genetically engineered Escherichia coli
[0073] 1) Pick a single colony of the selected genetically engineered Escherichia coli L7 from the LB plate and place it in 10 ml of LB medium at 220 rpm and 37°C for 12-16 hours;
[0074] 2) Inoculate the bacterial solution into LB medium at a ratio of 1:100 and culture at 220 rpm and 37°C for 3 hours. 600 When the p-value was about 0.6, IPTG was added to a final concentration of 0.5 mM for induction, and the culture was continued at 16°C for 20 hours. The bacteria were collected by centrifugation.
[0075] 8. Purification and enzyme digestion of recombinant peptides
[0076] 1) Resuspend the bacteria (5 g dry bacteria / 100 ml) in Tris buffer (25 mM Tris, 150 mM NaCl, pH 7.5), and sonicate (sonicate for 4 seconds, rest for 8 seconds, power 100 W, sonicate for 10 minutes, rest for 10 minutes, and repeat 1-2 times until the bacterial solution is clear and not viscous). Centrifuge (4°C, 14500 g for 30 minutes) and collect the supernatant. The protein expressed at this point is a tagged fusion protein.
[0077] 2) Extraction of the L7 peptide using a nickel affinity column: The tagged fusion protein was rapidly isolated and purified from the supernatant after pre-equilibration with 25 mM Tris, 150 mM NaCl, pH 7.5. Contaminants were washed with 20 mM imidazole in Tris buffer (20 mM imidazole, 25 mM Tris, 150 mM NaCl, pH 7.5) for approximately 10-20 column volumes. The target protein was then washed with 250 mM imidazole in Tris buffer (250 mM imidazole, 25 mM Tris, 150 mM NaCl, pH 7.5). The fusion protein was completely eluted after approximately 5 column volumes.
[0078] 3) Enzymatic removal of the fusion tag: Add an appropriate amount of TEV enzyme and digest overnight at 4°C. The fusion tag is then removed by passing the protein through a nickel column. The progress of the enzymatic cleavage reaction is monitored by SDS-PAGE electrophoresis. The specific procedure is as follows: 40 μl of the protein solution is added to 10 μl of 5× protein loading buffer (250 mM Tris-HCl (pH 6.8), 10% SDS, 0.5% bromophenol blue, 50% glycerol, and 5% β-mercaptoethanol). The sample is then boiled in 100°C water for 10 min. Then, 10 μl per well is added to an SDS-PAGE gel and run at 80 V for 2 h. The protein is then stained with Coomassie Brilliant Blue (0.1% Coomassie Brilliant Blue R-250, 25% isopropanol, and 10% glacial acetic acid) for 20 min. The protein is then destained with a protein destaining solution (10% acetic acid and 5% ethanol).
[0079] Figure 2 The electrophoresis diagrams are shown before and after cleavage of the fusion protein. The left lane shows the tagged fusion protein; the right lane shows the TEV enzyme on top and the fusion tag with the L7 peptide removed on the bottom.
[0080] 9. The L7 peptide cleaved by enzyme can be further purified by dialysis and then subjected to mass spectrometry detection or freeze-dried for future use.
[0081] The specific process is as follows: L7 peptide is transferred to a 500Da molecular weight cutoff dialysis tape and placed in 100 volumes of dialysate (PBS buffer (NaCl 137mM, KCl 2.7mM, Na2HPO4 10mM, NaH2PO4 1.8mM)). Dialysis is performed at 4°C for 24 hours with continuous stirring. The dialysate can be changed every 4 hours. The solution in the dialysis bag is then collected, which is the purified L7 peptide.
[0082] Example 2: Preparation of Essence Containing L7 Polypeptide
[0083] 1. Take a clean container.
[0084] 2. Add an appropriate amount (about 70-80% of the final volume) of pure water to the container.
[0085] 3. Glycerol (final concentration of 5% v / v), sodium chloride (final concentration of 0.5% w / v), EDTA (final concentration of 0.003% w / v), and the dialyzed L7 polypeptide solution of Example 1 (the L7 polypeptide content in the polypeptide solution is 1500 ppm) (final concentration of 0.25% v / v) were added to the container in sequence.
[0086] 4. Add pure water to make the solution volume 100% of the final volume.
[0087] 5. Stir thoroughly and mix evenly to obtain the essence containing L7 polypeptide.
[0088] 6. Save:
[0089] Refrigerate (2-8°C): Transfer directly to a suitable container and store at 2-8°C.
[0090] Storage at room temperature: Add 3.5% v / v 1,2-pentanediol to the final volume, stir thoroughly again, and transfer to a suitable container and store at room temperature.
[0091] Example 3: Human efficacy test
[0092] 1. Test substance: the essence containing L7 polypeptide prepared in Example 2.
[0093] 2. Comparison: Compare yourself before and after.
[0094] 3. Subjects: A total of 34 subjects (34 subjects were enrolled and 0 subjects dropped out), all female, aged 42 to 59 years, with an average age of 50.47±5.06 years, met the subject inclusion criteria. Before the project began, the Ethics Committee reviewed and approved the trial protocol and informed consent form. All subjects were required to sign an informed consent form before participating in the trial, and all subjects participating in the trial were identified by number. In the trial report, only the subject's gender and age information were provided to the submitting unit.
[0095] 4. Instrument measurement parameters and related equipment: Instrument name: Skin rapid three-dimensional imaging system PRIMOS-CR and analysis software Primos5.8; Test parameters: Canthus and under-eye wrinkle volume, average length, and average depth; Test time points: D0 / D28; Test sites: Periorbital; Parameter description: The smaller the measurement value, the smaller the canthus and under-eye wrinkle volume / average length / average depth, and the periorbital wrinkles are improved.
[0096] 5. Test environment: Temperature: 20-22°C, humidity: 40-60%, and real-time dynamic monitoring is performed.
[0097] 6. Test method:
[0098] 6.1 Preparation before the test
[0099] The test site cannot use any products on the test day. Before the test, the subjects need to clean the face uniformly, absorb with a lint-free tissue paper, and sit in the human efficacy evaluation room (temperature: 20-22°C, humidity: 40-60%) for 30 min, during which time they cannot drink water and beverages. The subjects remain relaxed, the face is exposed, and touching is avoided. The subjects are given a test explanation before the test, and sign the informed consent form. The test area is the periorbital area.
[0100] 6.2 Product use method
[0101] After cleansing in the morning and evening every day, take an appropriate amount of product and evenly apply it to the periorbital area, gently massage until completely absorbed. Use it 2 times a day, once in the morning and once in the evening, for 28 consecutive days. Note: The sample is stored in a 4°C refrigerator. During the test period, the subjects are prohibited from using anti-wrinkle preparations; the subjects are prohibited from dripping, injecting, orally taking, or other forms of ingesting preparations that affect anti-wrinkle testing; the subjects mainly engage in indoor activities, avoiding long-term exposure to outdoor light.
[0102] 6.3 Subjective evaluation of subjects
[0103] The subjects evaluate the periorbital skin condition under natural light conditions in the human efficacy laboratory through a mirror when they return for a visit 28 days after using the product (D28), and record the scores. A 7-level scoring method is used to score the product from 4 aspects of product skin feel, mildness, use effect, and satisfaction, and then make a judgment. Record it once for each visit.
[0104] 6.4 Objective quantitative evaluation
[0105] 30 minutes after facial cleansing, PRIMOS-CR was used to capture wrinkle images of the subject's periorbital measurement area. Target wrinkle analysis locations were determined, and analysis software was used to determine the volume, average length, and average depth of wrinkles at the canthus and under the eyes. These measurements served as baseline values (D0). The product was then distributed and instructions for use were provided. Twenty-eight days after using the product (D28), the subject was revisited and the same indicators were measured. Testing of the same subject was performed using the same instrument and by the same tester. The test site should remain consistent between the two test time points.
[0106] 6.5 Statistical analysis
[0107] The measured values for each test area were statistically analyzed, including the number, mean, standard deviation, standard error, minimum, median, and maximum values. If the test data showed a normal distribution, a paired t-test was used for statistical analysis; if the test data showed a non-normal distribution, a rank-sum test was used for statistical analysis. A two-tailed test was used for all statistical analysis, with an α level of 0.05. Statistical software was used for data analysis. Significant differences were indicated with *p<0.05 and **p<0.01, respectively. *p<0.05 indicates a significant difference, and **p<0.01 indicates a highly significant difference. Significant differences in the values of the various indicators in the test area indicate that the product has an anti-wrinkle effect.
[0108] 7. Test results
[0109] During the trial, 34 subjects were enrolled, with 0 dropouts. Ultimately, 34 subjects met the protocol and were considered valid cases. All subjects were female, with a mean age of 50.47 ± 5.06 years. This population was used for statistical analysis.
[0110] 7.1 Safety and Adverse Reactions Evaluation
[0111] During the trial, professional dermatologists asked participants whether they experienced symptoms such as dryness, oiliness, scaling, redness, or stinging while using the test product. They also observed and recorded any rash, redness, swelling, or scaling at the test site. Scoring was then performed according to the criteria in Table 1. The scores were recorded on the event report form and evaluated for relevance using the criteria listed in Table 2. No subjects experienced adverse reactions during the trial.
[0112] Table 1 Scoring criteria for adverse reactions
[0113]
[0114] Table 2 Evaluation of the tested products
[0115]
[0116] 7.2 Subjective Evaluation
[0117] A 7-point scale (Table 3) was used to rate the product's skin feel, mildness, effectiveness, and satisfaction with the product. Participants completed the questionnaire 28 days after trialing the product (D28). This scale was used to analyze participants' evaluations of the product's user experience, effectiveness, and satisfaction with the product.
[0118] Table 3 Self-assessment scoring criteria (7-level scoring method)
[0119]
[0120] 7.2.1 Product Skin Feel Evaluation
[0121] In terms of skin feel, after 28 days of use (D28), all average ratings were above 6.3, with over 50% of participants giving the product a positive rating. Among them, "skin feels less tight after use," "the product is gentle and non-irritating," and "suitable for sensitive skin" all received 100% approval at D28 (Table 4).
[0122] Table 4 Product skin feel evaluation results (n=34)
[0123]
[0124] 7.2.2 Product Use Effect Evaluation
[0125] On day 28 (D28), the subjects evaluated the anti-wrinkle effect of the product.
[0126] In terms of wrinkle reduction, after 28 days of use (D28), all mean scores were above 6.1, with statistically over 50% of participants giving the product positive ratings for its anti-wrinkle effects. Among these, 100% agreed with the following statements: "I feel wrinkles around my eyes have become lighter," "I feel the number of wrinkles around my eyes has decreased," "I feel crow's feet have been reduced," "I feel wrinkles under my eyes and at the corners of my eyes have been reduced," and "I feel fine and dry lines on my face have been reduced" (Table 5).
[0127] Table 5 Product skin feel evaluation results (n=34)
[0128]
[0129] 7.2.3 Product Satisfaction Evaluation
[0130] From the perspective of overall product satisfaction, after 28 days of use (D28), more than 50% of the subjects gave positive comments on the product satisfaction survey results. At D28, 100.00% of the subjects expressed satisfaction with the product (Table 6, Figure 3 ).
[0131] Table 6 Product satisfaction evaluation results (n=34)
[0132]
[0133] 7.3 Objective quantitative evaluation
[0134] 7.3.1 Wrinkle Volume Analysis
[0135] The Wrinkle Volume value indicates the size of wrinkles within the analysis area. Lower values indicate smaller wrinkle volumes and fewer wrinkles. Comparing the changes in total wrinkle volume before and after use can reflect the product's anti-wrinkle effectiveness.
[0136] The more the volume of wrinkles at the corners of the eyes and under the eyes decreases at different follow-up time points compared with the baseline value before use (D0), the better the anti-wrinkle effect of the product.
[0137] Wrinkle volume change rate = (wrinkle volume after using the product - wrinkle volume before using the product) / wrinkle volume before using the product × 100%
[0138] Table 7 Descriptive statistics of wrinkle volume (mm 3 ,n=34)
[0139]
[0140] Table 8 Wrinkle volume difference analysis (mm 3 ,x±s,n=34)
[0141]
[0142] Canthus wrinkles: Compared with the baseline value before use (D0), the volume of canthus wrinkles showed a downward trend after using the product. After 28 days of use (D28), it decreased by 8.55%, which was a very significant difference compared with the baseline value (p < 0.01). After 28 days of use, the volume of canthus wrinkles was lower than the baseline value (Table 8, Figure 4 ).
[0143] Under-eye wrinkles: Compared with the baseline value before use (D0), the volume of under-eye wrinkles showed a downward trend after using the product. After 28 days of use (D28), it decreased by 15.65%, which was a very significant difference compared with the baseline value (p < 0.01). After 28 days of use, the volume of under-eye wrinkles was lower than the baseline value (Table 8, Figure 4 ).
[0144] 7.3.2 Analysis of average wrinkle length
[0145] The average wrinkle length value indicates the average length of wrinkles within the analysis area. Lower values indicate shorter wrinkles. Comparing the average wrinkle length value before and after use can provide insights into the product's anti-wrinkle effectiveness.
[0146] The more the average length of wrinkles at the corners of the eyes and under the eyes decreases at different follow-up time points compared with the baseline value before use (D0), the better the anti-wrinkle effect of the product.
[0147] Average wrinkle length change rate = (average wrinkle length after using the product - average wrinkle length before using the product) / average wrinkle length before using the product × 100%
[0148] Table 9 Descriptive statistics of average wrinkle length (mm 3 ,n=34)
[0149]
[0150]
[0151] Table 10 Analysis of differences in average wrinkle length (mm 3 ,x±s,n=34)
[0152]
[0153] Canthus wrinkles: Compared with the baseline value before use (D0), the average length of canthus wrinkles showed a downward trend after using the product. After 28 days of use (D28), it decreased by 11.47%, which was significantly different from the baseline value (p<0.01). The average length of canthus wrinkles was lower than the baseline value after 28 days of use (Table 10, Figure 5 ).
[0154] Under-eye wrinkles: Compared with the baseline value before use (D0), the average length of under-eye wrinkles showed a downward trend after using the product. After 28 days of use (D28), it decreased by 13.31%, which was a very significant difference compared with the baseline value (p < 0.01). After 28 days of use, the average length of under-eye wrinkles was lower than the baseline value (Table 10, Figure 5 ).
[0155] 7.3.3 Average wrinkle depth analysis
[0156] The average wrinkle depth value indicates the average depth of wrinkles within the analyzed area. Lower values indicate smaller average wrinkle depth and shallower wrinkles. Comparing the changes in average wrinkle depth before and after use can reflect the anti-wrinkle efficacy of the product. The greater the decrease in average wrinkle depth at the corners of the eyes and under the eyes compared to the pre-use baseline (D0) at different time points, the greater the anti-wrinkle effectiveness of the product.
[0157] Average wrinkle depth change rate = (average wrinkle depth after using the product - average wrinkle depth before using the product) / average wrinkle depth before using the product × 100%
[0158] Table 11 Descriptive statistics of average wrinkle depth (mm 3 ,n=34)
[0159]
[0160]
[0161] Table 12 Analysis of differences in average wrinkle depth (mm 3 ,x±s,n=34)
[0162]
[0163] Wrinkles at the corners of the eyes: Compared with the baseline value before use (D0), the average depth of wrinkles at the corners of the eyes decreased by 3.48% after using the product for 28 days (D28), which was not significantly different from the baseline value (p>0.05) (Table 12, Figure 6 ).
[0164] Under-eye wrinkles: Compared with the baseline value before use (D0), the average depth of under-eye wrinkles showed a downward trend after using the product. After 28 days of use (D28), it decreased by 6.08%, which was a highly significant difference compared with the baseline value (p<0.01). The average depth of under-eye wrinkles after using the product was lower than the baseline value (Table 12, Figure 6 ).
[0165] 8. Test conclusion
[0166] The anti-wrinkle efficacy of the cosmetic was evaluated by using the essence containing L7 polypeptide prepared in Example 2 multiple times on 34 subjects. The results showed that:
[0167] 1) No adverse reactions occurred in this trial, and the trial product has a high safety profile.
[0168] 2) Subjective evaluations showed that after 28 days of use (D28), the average score was above 6 points. Statistically, over 50% of subjects gave positive comments on the product's skin feel, mildness, anti-wrinkle effect, and satisfaction. On D28, 100% of subjects agreed with the following statements: "Skin does not feel tight after use," "The product is mild and non-irritating," "Suitable for sensitive skin," "Wrinkles around the eyes feel lighter," "The number of wrinkles around the eyes feels reduced," "Crow's feet are reduced," "Under-eye wrinkles and wrinkles are reduced," and "Fine lines and dry lines on the face feel lessened." All subjects also gave positive feedback on product satisfaction.
[0169] 3) Wrinkle volume analysis showed that after the subjects used the product, the wrinkle volume at the corners of the eyes and under the eyes had a downward trend at the D28 follow-up time point, and had a very significant difference compared with the baseline value (Table 13).
[0170] 4) Wrinkle average length analysis showed that after the subjects used the product, the average length of the wrinkles at the corners of the eyes and under the eyes had a downward trend at the D28 follow-up time point, and had a very significant difference compared with the baseline value (Table 13).
[0171] 5) Wrinkle average depth analysis showed that after the subjects used the product, the average depth of the wrinkles at the corners of the eyes had a downward trend at the D28 follow-up time point, and had no significant difference compared with the baseline value; the average depth of the wrinkles under the eyes had a downward trend at the D28 follow-up time point, and had a very significant difference compared with the baseline value (Table 13).
[0172] Table 13 Analysis results of wrinkle volume, average length and average depth
[0173]
[0174] In summary, after using the serum containing the L7 polypeptide for 28 days, the volume of the wrinkles at the corners of the eyes and under the eyes was improved, the average length of the wrinkles at the corners of the eyes and under the eyes was improved, and the average depth of the wrinkles under the eyes was improved, achieving the effect of anti-wrinkles. And in the subjective evaluation, 100% of the subjects gave positive evaluation on the skin feeling, mildness, anti-wrinkle effect and satisfaction of the product. It is proved that the product has the effect of anti-wrinkles, is mild and non-irritating, and is suitable for sensitive skin.
[0175] Example 4:
[0176] The L7 polypeptide solution after dialysis treatment in Example 1 was placed at high temperature (40℃), low temperature (4℃) and light conditions for 3 months for stability test. Whether abnormal phenomena such as delamination, precipitation of particles, discoloration, taste change and the like occurred was observed. The results are shown in Table 14.
[0177] Table 14 Stability test results
[0178] Storage environment Whether to layer Whether particles or sediment are precipitated Whether it changes color or smell High temperature (40°C) no no no Low temperature (4°C) no no no illumination no no no
[0179] Through the above observation results analysis, it can be preliminarily judged that the L7 polypeptide sample prepared by the present application has good stability.
[0180] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application shall be equivalent replacement modes, and all shall be included in the protection scope of the present application.
Claims
1. An anti-wrinkle heptapeptide, characterized by: Its amino acid sequence is: Gly-Glu-Glu-Met-Gln-Arg-Arg.
2. The anti-wrinkle heptapeptide-related biomaterial according to claim 1, characterized in that: Any of the following biological materials: 1) a nucleic acid molecule encoding the anti-wrinkle heptapeptide; 2) an expression cassette containing the nucleic acid molecule described in 1); 3) a recombinant vector containing the expression cassette described in 2); 4) A genetically engineered bacterium containing the recombinant vector described in 3).
3. The anti-wrinkle heptapeptide-related biomaterial according to claim 2, characterized in that: The nucleotide sequence of the nucleic acid molecule described in 1) is shown in SEQ ID No. 2; 2) The nucleotide sequence of the expression cassette is shown in SEQ ID No. 3 or SEQ ID No. 4 or SEQ ID No. 5; 3) The recombinant vector described above is a recombinant vector constructed based on plasmid pET26, plasmid pET32a or plasmid pGEX-6p; The genetically engineered bacteria described in 4) are genetically engineered bacteria constructed based on the Escherichia coli expression strain BL21 (DE3).
4. The biosynthesis process of the anti-wrinkle heptapeptide according to claim 1, characterized in that: The steps include: (1) Construction of a genetically engineered bacterium containing a nucleic acid molecule encoding the anti-wrinkle heptapeptide; (2) Fermentation culture and induced expression of genetically engineered bacteria; (3) Peptide purification and enzymatic cleavage.
5. The biosynthesis process of the anti-wrinkle heptapeptide according to claim 4, characterized in that: The specific operation of step (1) is as follows: the sequence shown in SEQ ID No. 5 is transferred into an Escherichia coli expression strain, and a genetically engineered Escherichia coli strain is obtained by screening; The specific operation of step (2) is as follows: inoculating the genetically engineered Escherichia coli into LB culture medium and culturing to obtain seed liquid; Inoculate the seed solution into LB medium for amplification and wait for the OD value of the bacterial solution to reach 600 When the pH value was 0.6, IPTG was added to a final concentration of 0.5 mM for induction, the culture was continued, and the cells were collected by centrifugation; The specific operation of step (3) is as follows: resuspend the bacteria with Tris buffer, ultrasonically disrupt, and collect the supernatant by centrifugation; purify the anti-wrinkle heptapeptide fusion protein from the supernatant using a nickel ion affinity column; add TEV enzyme for enzymatic cleavage, remove the fusion tag through a nickel column, and purify by dialysis to obtain an anti-wrinkle heptapeptide solution.
6. An anti-wrinkle composition, characterized in that: The composition uses the anti-wrinkle heptapeptide described in claim 1 or the anti-wrinkle heptapeptide obtained by the biosynthesis process described in claim 4 or 5 as an active ingredient.
7. The anti-wrinkle composition according to claim 6, wherein: The composition comprises the following components in terms of concentration: 4% v / v to 6% v / v of glycerol, 0.4% w / v to 0.6% w / v of sodium chloride, 0.002% w / v to 0.004% w / v of EDTA, 0.2% v / v to 0.3% v / v of an anti-wrinkle heptapeptide solution with a concentration of 1000 to 2000 ppm, and the balance being water.
8. The anti-wrinkle composition according to claim 7, wherein: The composition comprises the following components by mass percentage: 5% v / v glycerol, 0.5% w / v sodium chloride, 0.003% w / v EDTA, 0.25% v / v anti-wrinkle heptapeptide solution with a concentration of 1500 ppm, and the balance is water.
9. The method for preparing the anti-wrinkle composition according to any one of claims 6 to 8, characterized in that: Add glycerol, sodium chloride, EDTA and anti-wrinkle heptapeptide solution to pure water in sequence, then dilute to volume with pure water, and stir thoroughly to mix evenly.
10. Use of the anti-wrinkle heptapeptide according to claim 1, the biomaterial according to any one of claims 2 to 3, or the anti-wrinkle composition according to any one of claims 6 to 8 in the field of cosmetics.
Citation Information
Patent Citations
Large-scale synthesis method of argireline
CN110684077A
Pro.AH8 Acetyl Hexapeptide-8 with the Function of Tightening and Anti-Wrinkle, Its Preparation Method and Application
CN118580307B