Sphingomonas paucimobilis and application thereof in fermentation production of colorless gellan gum

By screening and genetically mutating Sphingomonas paucimobilis QLD24B-15 to produce colorless gellan gum through fermentation, the low yield and color problems of the existing technology are solved, and efficient and low-cost industrial production is achieved.

CN120758402APending Publication Date: 2025-10-10SHANDONG FOOD & FERMENT IND RES & DESIGN INST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510937860.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-08
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

The current production of gellan gum suffers from low fermentation yield and yellow product color, resulting in high production costs and complex processing technology, which limits its industrial application.

Method used

The screened Sphingomonas paucimobilis QLD24B-15 was used for fermentation production. Pigment production was avoided by gene mutation, and the culture conditions were optimized to increase the yield.

Benefits of technology

The company has achieved efficient production of colorless gellan gum with a yield of 27.3 g/L, which has simplified the production process, reduced costs, and enhanced market competitiveness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758402A_ABST
    Figure CN120758402A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of microorganisms, and relates to sphingomonas paucimobilis and application thereof in fermentation production of colorless gellan gum. The sphingomonas paucimobilisQLD24B-15 is named as sphingomonas paucimobilisQLD24B-15, and the preservation number of the sphingomonas paucimobilisQLD24B-15 is CCTCC (China Center for Type Culture Collection) NO: M2025288. The sphingomonas paucimobilis provided by the invention does not generate pigments in the fermentation process, a fermentation product is prevented from being colored, the yield of gellan gum obtained by fermentation is relatively high, and industrialization of fermentation production of colorless gellan gum is facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to a strain of Sphingomonas paucimobilis and application thereof in the fermentation production of colorless gellan gum. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Gellan gum is produced by Sphingomonas paucimobilis ( Sphingomonas paucimobilis ) is produced by fermentation under aerobic conditions. Gellan gum is widely used in many industries such as food, cosmetics, medicine and detergents. Gellan gum is another new type of microbial extracellular polysaccharide after xanthan gum, and its gelling properties are superior to xanthan gum. Gellan gum is an off-white powder, odorless and tasteless, with no special taste or smell. The gel has good heat and acid resistance and is highly stable to enzymes. Gellan gum is insoluble in non-polar organic solvents and cold water, but it disperses in water with slight stirring, dissolves into a transparent solution when heated, and forms a transparent and solid gel after cooling. The gellan gum production process is that after the bacteria are aerobic fermented with glucose as the carbon source under neutral conditions, the fermentation broth is subjected to pretreatment, dehydration, alcohol dissolution, flocculation, dehydration and pressing, drying, and crushing to obtain the gellan gum product.

[0004] Currently, the industrial production of gellan gum still faces the following challenges: First, the fermentation yield is low, generally not exceeding 20g / L. Second, the fermentation product is yellow in color, requiring post-extraction treatment with organic solvents or decolorizing agents to ensure product whiteness. This directly leads to high production costs and complicates subsequent processing. Furthermore, if the product is yellow, it affects the color of the applied material during addition and use. These shortcomings of existing processes have, to a certain extent, limited the development of the gellan gum industry. Summary of the Invention

[0005] In order to address the deficiencies of the prior art, the present invention aims to provide a strain of Sphingomonas paucimobilis and its use in the fermentation production of colorless gellan gum. The Sphingomonas paucimobilis provided by the present invention not only does not produce pigments during the fermentation process, thus avoiding coloration of the fermentation product, but also has a high yield of gellan gum obtained by fermentation, which is conducive to the industrialization of the fermentation production of colorless gellan gum.

[0006] In order to achieve the above object, the technical solution of the present invention is: In the first aspect, a strain of Sphingomonas paucimobilis, named Sphingomonas paucimobilis Sphingomonas paucimobileQLD24B-15, its deposit number is CCTCC NO: M2025288.

[0007] The Sphingomonas paucimobilis of the present invention Sphingomonas paucimobilis QLD24B-15 was selected from the gellan gum industrial production strain Sphingomonas paucimobilis ( Sphingomonas paucimobile ) 203 was obtained through multiple rounds of plasma and microwave combined mutagenesis screening. Sphingomonas paucimobilis The advantages of QLD24B-15 are fast growth on LB medium, white colonies, slightly sticky, and Gram-stained bacterial morphology with no significant difference from the starting strain.

[0008] In a second aspect, a method for culturing Sphingomonas paucimobilis is provided, comprising culturing the Sphingomonas paucimobilis described in the first aspect of the present invention.

[0009] In a third aspect, a microbial agent comprises the Sphingomonas paucimobilis or its fermentation broth as described in the first aspect of the present invention.

[0010] In a fourth aspect, a use of the Sphingomonas paucimobilis described in the first aspect of the present invention or the microbial agent described in the third aspect in the fermentation production of colorless gellan gum.

[0011] In a fifth aspect, a method for producing colorless gellan gum is provided, which comprises sequentially subjecting the Sphingomonas paucimobilis described in the first aspect of the present invention to seed culture and gellan gum fermentation.

[0012] In a sixth aspect, a colorless gellan gum is obtained by the production method described in the fifth aspect of the present invention.

[0013] The Sphingomonas paucimobilis of the present invention is named Sphingomonas paucimobilis Sphingomonas paucimobile QLD24B-15, the strain was deposited in the China Center for Type Culture Collection (CCTCC, address: Wuhan University, Wuhan, China) on February 24, 2025, and its deposit number is CCTCC NO: M2025288.

[0014] The beneficial effects of the present invention are: (1) The present invention discloses a strain of Sphingomonas paucimobilis capable of fermenting and producing non-pigmented gellan gum, namely, Sphingomonas paucimobilis Sphingomonas paucimobilis QLD24B-15 CCTCC NO: M2025288.

[0015] (2) The Sphingomonas paucimobilis described in the present invention can be used to efficiently ferment and produce pigment-free gellan gum, with a gellan gum yield of up to 27.3 g / L, significantly improving the quality of gellan gum products and enhancing the market competitiveness of domestic gellan gum products.

[0016] (3) The Sphingomonas paucimobilis provided by the present invention is a stable mutant strain obtained by mutagenesis of an industrial production strain and can be directly used in industrial production without any stability or safety issues.

[0017] (4) The method for producing colorless gellan gum by fermentation of the present invention is simple to operate, low in cost, universal, and easy to scale up. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0019] Figure 1 For the present invention, Sphingomonas paucimobilis ( Sphingomonas paucimobilis ) Comparison of gellan gum fermentation broth produced by QLD24B-15 (A) and the starting strain (B); Figure 2 The strain Sphingomonas paucimobilis of the present invention ( Sphingomonas paucimobilis ) Comparison of gellan gum products produced by QLD24B-15 (A) and the starting strain (B). DETAILED DESCRIPTION

[0020] It should be noted that the following detailed descriptions are exemplary and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs.

[0021] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0022] In view of the fact that the current Sphingomonas paucimobilis, which has no stability and safety issues and can be directly used in industrial production, has problems such as low yield and colored products in the fermentation production of gellan gum, the present invention proposes a Sphingomonas paucimobilis strain and its application in the fermentation production of colorless gellan gum.

[0023] A typical embodiment of the present invention provides a strain of Sphingomonas paucimobilis, named Sphingomonas paucimobilis Sphingomonas paucimobilis QLD24B-15, its deposit number is CCTCC NO: M2025288.

[0024] The Sphingomonas paucimobilis of the present invention Sphingomonas paucimobilis The whole genome of QLD24B-15 strain was sequenced, and the genes related to yellow pigment synthesis in this strain were identified through sequence comparison. crt I (phytoene dehydrogenase) has undergone a sequence mutation, the specific nucleotide sequence of which is shown in SEQ ID NO. 1. This means that Sphingomonas paucimobilis harboring this mutated nucleotide sequence can avoid the production of pigments (especially yellow pigment) during the fermentation process for producing cold-setting gum.

[0025] Another embodiment of the present invention provides a method for culturing Sphingomonas paucimobilis, comprising culturing the above-mentioned Sphingomonas paucimobilis.

[0026] In some embodiments, the culture medium used is LB medium.

[0027] In some embodiments, the culture temperature is 26-30° C., and the culture time is 16-18 h.

[0028] A third embodiment of the present invention provides a microbial agent comprising the above-mentioned Sphingomonas paucimobilis or its fermentation broth.

[0029] A fourth embodiment of the present invention provides a use of the above-mentioned Sphingomonas paucimobilis or microbial agent in the fermentation production of colorless gellan gum.

[0030] A fifth embodiment of the present invention provides a method for producing colorless gellan gum, which comprises sequentially subjecting the above-mentioned Sphingomonas paucimobilis to seed culture and gellan gum fermentation to produce the product.

[0031] In some embodiments, the culture medium for seed culture is composed of: 9.0-11.0 g / L glucose, 3.5-4.5 g / L peptone, 0.8-1.2 g / L yeast extract, 0.8-1.2 g / L phosphate, 0.45-0.55 g / L magnesium sulfate, and the balance is distilled water; pH 7.0-7.2.

[0032] In some embodiments, the seed culture temperature is 26-30° C. and the time is 14-20 h.

[0033] In some embodiments, the culture medium for fermentation production is composed of: 35-50 g / L glucose, 5.0-8.0 g / L soybean meal, 3.0-5.0 g / L phosphate, 0.5-1.0 g / L magnesium sulfate, and the balance is distilled water; pH 7.0-7.2.

[0034] In some embodiments, the fermentation production temperature is 26-30° C. and the fermentation time is 60-72 hours.

[0035] In some embodiments, the seed liquid after seed culture is inoculated into the fermentation medium at a volume percentage of 9-11%, and then fermentation production is carried out.

[0036] In some embodiments, after fermentation, the viscosity of the fermentation broth is 7640-9350 mPa.s.

[0037] A sixth embodiment of the present invention provides a colorless gellan gum obtained by the above production method.

[0038] In some embodiments, the molecular weight is (4.12-4.75)×10 5 Da.

[0039] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments and comparative examples.

[0040] Example 1: Sphingomonas paucimobilis Sphingomonas paucimobilis Breeding of QLD24B-15 The industrial production strain of gellan gum is Sphingomonas paucimobilis ( Sphingomonas paucimobilis ) 203 was used as the starting strain. Five rounds of room temperature plasma (ARTP) and microwave combined mutagenesis were carried out. The induced bacteria were aseptically spread on LB plate culture medium and cultured at 26-30℃ for 2-3 days. All white single colonies were picked and inoculated on LB slant culture medium and cultured at 26-30℃ for 1-2 days until the strain growth was completed.

[0041] All well-grown white single colonies were inoculated into LB liquid culture, cultured at 26-30°C and 220-280 r / min with a shake flask for 14-20 h, inoculated into fermentation medium at 10% (v / v) of the inoculum size, and fermented at 26-30°C and 260-300 r / min with a shake flask for 60-72 h.

[0042] The fermentation broth is composed of the following components by mass fraction: (unit: g / L) Fermentation medium (unit: g / L): glucose 35~50, soybean meal 5.0~8.0, phosphate 3.0~5.0, magnesium sulfate 0.5~1.0, the rest is distilled water, pH 7.0~7.2.

[0043] The strains with high viscosity of fermentation broth and high polysaccharide yield were selected for repeated screening, and finally a strain of Sphingomonas paucimobilis with stable genetic properties, no yellow pigment production and high gellan gum polysaccharide yield was obtained. The strain was named Sphingomonas paucimobilis ( Sphingomonas paucimobilis )QLD24B-15.

[0044] The above strains of Sphingomonas sp. Sphingomonas paucimobilis ) QLD24B-15, was deposited in the China Center for Type Culture Collection (CCTCC, address: Wuhan University, Wuhan, China) on February 24, 2025, and its deposit number is CCTCC NO: M2025288.

[0045] Example 2: Sphingomonas paucimobilis ( Sphingomonas paucimobilis Comparative analysis of the genome of QLD24B-15 strain and the starting strain The Sphingomonas paucimobilis obtained by selection in Example 1 ( Sphingomonas paucimobilis ) QLD24B-15 strain, CCTCC NO: M2025288 strain and starting strain Sphingomonas paucimobilis ( Sphingomonas paucimobile )203 commissioned BGI to sequence the whole genome of the strain and obtained the genome map of the strain.

[0046] Experimental methods: (1) Pick the strain cultured on the slant and inoculate it into liquid LB medium. Culture it in a flask at 30℃ and 260r / min for 18h and collect the bacterial liquid.

[0047] (2) After the collected bacterial liquid is labeled, it is stored on dry ice and sent to a sequencing company for whole genome sequencing.

[0048] The whole genome sequences of the two strains were compared using the BLAST program of the National Center for Biotechnology Information (NCBI), and the yellow pigment synthesis-related genes of the related Sphingomonas paucimobilis were analyzed to obtain the strain Sphingomonas paucimobilis ( Sphingomonas paucimobile ) QLD24B-15 is compared with the starting strain, and its yellow pigment synthesis related genes crtI A sequence mutation occurred, and the specific nucleotide sequence and mutation point are shown below, indicating that the strain of the present invention is unable to synthesize yellow pigment due to the mutation of the above gene.

[0049] crtI(SEQ ID NO.1): ATGCGCCGCGCAGTCGTGATCGGCGCCGGTTTCGGCGGTCTCGCTCTC GCCATCCGCCTGCAGTCCGCGGGGGTCGACACCACCGTGATCGAGGCC CGGGACAAGCCCGGCGGCCGCGCCTATTATTGGGAGCGCGACGGCTTC ACCTTCGACGGCGGCCCGACGGTGATCACCGATCCGGACGCGCTGAAG GAGCTGTGGCGCCTCTCGGGCCACGACATCTCGGAAGATGTGACGCTG AAGCCGGTCACGCCCTTCTACCGCCTGTCCTGGCCCGATGGAACGACC TTCGACTACACCAACGACGACGCCGTTCTGGCAGGCGAGATCGCCAAG CTCGATGCCAGC GGC ATCGCCGGCTATCGCCGCTTCCTCGACTATTCG (灰色底纹处的碱基由A突变为G,其对应的氨基酸由Asp突变为Gly) GCGAGCGTCTATGAGGAAGGCTATGTGAAGCTGGGCGCCAAGGCGTTT CTGGACTTCAAGTCGATGCTCAAGGCCGCCCCTGCGCTGATGCAGCAC CAGGCCTGGCGCTCGGTCTATTCGATCGTCTCGGGCTTCGTGAAGAAC GAGAAGCTGCGGGAGGCGCTGTCCTTCCACACGCTGCTCGTCGGCGGC AATCCGATGGCGACCAGCAGCATCTACGCGCTGATCCACAAGCTGGAA CGCGACGGCGGCGTCTGGTGGGCCGAAGGCGGCACCAACCGGCTGATC GCCGGCATGATCACGCATTTCGAGCGGCTGGGCGGCAAGGTTCGCATC GGTGATCCGGTCGACGAGATCCTGACGCTTGGCGATCGGGTGGTCGGC GTGCGCACCAAGAGCGGCGTCGAGGTCGAGGTGGATGCGGTGGCGAGC AACGCCGACATCGTCCACAGCTACCGCGACCTGCTGCGCAACTCGCGC AGCGCCCGGCGCACGGCGAACCGGCTGGTCAACAAGCGCTTCTCGCCC TCGCTGTTCGTGGTGCATTTCGGGCTGCGGGGCACCTTCCCCGACATT CCGCACCACATGATCCTGTTCGGCCCGCGCTATAAGGGGCTGCTGGAC GACATCTACACCAACGGCGTGGGTGAGCGAGGATTTCTCGCTCTATCTC CACCACCCCAGCGCGTCCGACCCGAGCATGGCGCCGGAGGGTCATTCG ACGTTCTACGTGCTGGCGCCGGTGCCGCATCTCGGC ACG TTCCCGGCG (The base in the gray shading mutates from A to C, and the corresponding amino acid mutates from Lys to Thr) GACTGGAGC CTG GTGGGGCCCGTGCTCGAATCGCGAATCCTGGCGGAG (The base in the gray shading mutates from A to T, and the corresponding amino acid mutates from Gln to Leu) GTGCAGCGCCGGCTGATCCCCGACCTGGCCGAGCGGATCGTCACCAAG TTCCACTATGCGCCCACCGACTTCCGCGACGACCTCGCGGCGCACCAC GGCTCGGGCTTCAGCCTCGAGCCGATCCTGACCCAGAGCGCCTGGTTC CGGGTACACAACCGCGACGACGCGATCTCGAACCTGTATTTCGTCGGC GCGGGCACGCATCCGGGCGCGGGCATCCCCGGCGTCGTCGGCAGCGCC AAGGCGACCGCCGAGCTGATGCTGGGCGAGTTGGCGTGA Example 3: Sphingomonas sp. Sphingomonas paucimobilis )QLD24B-15 Fermentation to produce gellan gum The Sphingomonas paucimobilis obtained by breeding in Example 1 ( Sphingomonas paucimobilis ) QLD24B-15 strain, CCTCC NO. M2025288, was used as the experimental strain.

[0050] (1) Pick two rings of the strain cultured on the slant and inoculate them into the liquid seed culture medium. Shake the flask at 28°C and 260 rpm for 18 hours to obtain mature fermentation seeds.

[0051] (2) The mature seeds were transferred into the shake flask fermentation medium at a concentration of 10% (v / v) and fermented in a shaker at 300 r / min for 66 h.

[0052] (3) The yield of gellan gum in this example is 24.4 g / L, the viscosity of the fermentation liquid is 8520 mPa.s, and the fermentation liquid is white (see Figure 1 A), the extracted gellan gum product is white (see Figure 2 A), the molecular weight of the polysaccharide is 4.36×10 5 Da.

[0053] The composition of the seed culture medium in this embodiment is (unit: g / L): glucose 10.0, peptone 4.0, yeast extract 1.0, phosphate 1.0, magnesium sulfate 0.5, and the rest is distilled water, pH 7.0.

[0054] The fermentation medium composition of this example is (unit: g / L): glucose 40, soybean meal 6.0, phosphate 4.0, magnesium sulfate 0.5, and the rest is distilled water, pH 7.0.

[0055] Example 4: Sphingomonas paucimobilis ( Sphingomonas paucimobilis )QLD24B-15 Fermentation to produce gellan gum The Sphingomonas paucimobilis obtained by breeding in Example 1 ( Sphingomonas paucimobilis ) QLD24B-15 strain, CCTCC NO. M2025288, was used as the experimental strain.

[0056] (1) Pick two rings of the strain cultured on the slant and inoculate them into the liquid seed culture medium. Shake the flask at 30℃ and 240r / min for 16h to obtain mature fermentation seeds.

[0057] (2) The mature seeds were transferred into the shake flask fermentation medium at a concentration of 10% (v / v) and fermented in a shaker at 300 r / min for 60 h.

[0058] (3) In this example, the yield of gellan gum was 27.3 g / L, the viscosity of the fermentation broth was 9136 mPa.s, the fermentation broth was white, the extracted gellan gum product was white, and the molecular weight of the polysaccharide was 4.67×10 5 Da.

[0059] The composition of the seed culture medium in this embodiment is (unit: g / L): glucose 10.0, peptone 4.0, yeast extract 1.0, phosphate 1.0, magnesium sulfate 0.5, and the rest is distilled water, pH 7.0.

[0060] The fermentation medium composition of this example is (unit: g / L): glucose 50, soybean meal 8.0, phosphate 5.0, magnesium sulfate 1.0, and the rest is distilled water, pH 7.0.

[0061] Comparative Example 1: Sphingomonas paucimobilis ( Sphingomonas paucimobilis ) 203 Fermentation to produce gellan gum The starting strain Sphingomonas paucimobilis ( Sphingomonas paucimobilis ) 203 is the experimental strain.

[0062] (1) Pick two rings of the strain cultured on the slant and inoculate them into the liquid seed culture medium. Shake the flask at 28°C and 260 rpm for 18 hours to obtain mature fermentation seeds.

[0063] (2) The mature seeds were transferred into the shake flask fermentation medium at a concentration of 10% (v / v) and fermented in a shaker at 200 r / min for 66 h.

[0064] (3) The yield of gellan gum in this example is 24.2 g / L, the viscosity of the fermentation liquid is 8750 mPa.s, and the fermentation liquid is yellow (attached Figure 1 -B), the extracted gellan gum product is light yellow (with Figure 2 -B), the molecular weight of the polysaccharide is 4.41×10 5 Da.

[0065] The composition of the seed culture medium of this comparative example is (unit: g / L): glucose 10.0, peptone 4.0, yeast extract 1.0, phosphate 1.0, magnesium sulfate 0.5, and the rest is distilled water, pH 7.0.

[0066] The fermentation medium composition of this comparative example is (unit: g / L): glucose 40, soybean meal 6.0, phosphate 4.0, magnesium sulfate 0.5, and the rest is distilled water, pH 7.0.

[0067] Comparative Example 2: Sphingomonas paucimobilis ( Sphingomonas paucimobilis ) 203 Fermentation to produce gellan gum The starting strain Sphingomonas paucimobilis ( Sphingomonas paucimobilis ) 203 is the experimental strain, (1) Pick two rings of the strain cultured on the slant and inoculate them into the liquid seed culture medium. Shake the flask at 30℃ and 240r / min for 16h to obtain mature fermentation seeds.

[0068] (2) The mature seeds were transferred into the shake flask fermentation medium at a concentration of 10% (v / v) and fermented in a shaker at 300 r / min for 60 h.

[0069] (3) The yield of gellan gum in this example is 25.6 g / L, the viscosity of the fermentation broth is 9458 mPa.s, the fermentation broth is yellow, the extracted gellan gum product is light yellow, and the molecular weight of the polysaccharide is 4.70×10 5 Da.

[0070] The composition of the seed culture medium of this comparative example is (unit: g / L): glucose 10.0, peptone 4.0, yeast extract 1.0, phosphate 1.0, magnesium sulfate 0.5, and the rest is distilled water, pH 7.0.

[0071] The fermentation medium composition of this comparative example is (unit: g / L): glucose 50, soybean meal 8.0, phosphate 5.0, magnesium sulfate 1.0, and the rest is distilled water, pH 7.0.

[0072] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. A strain of Sphingomonas paucimobilis characterized by being named Sphingomonas paucimobilis Sphingomonas paucimobilis QLD24B-15, its deposit number is CCTCC NO: M2025288.

2. A method for culturing Sphingomonas paucimobilis, characterized in that: The Sphingomonas paucimobilis according to claim 1 is cultured.

3. The culture method according to claim 2, wherein The culture medium used was LB medium; Alternatively, the culture temperature is 26-30°C and the culture time is 16-18 hours.

4. A microbial agent, characterized in that: The method comprises the Sphingomonas paucimobilis or a fermentation broth thereof according to claim 1.

5. Use of the Sphingomonas paucimobilis according to claim 1 or the microbial agent according to claim 4 in the fermentation production of colorless gellan gum.

6. A method for producing colorless gellan gum, characterized in that: The Sphingomonas paucimobilis according to claim 1 is subjected to seed culture and gellan gum fermentation production in sequence to obtain the product.

7. The production method according to claim 6, wherein The medium composition for seed culture is as follows: glucose 9.0-11.0 g / L, peptone 3.5-4.5 g / L, yeast extract 0.8-1.2 g / L, phosphate 0.8-1.2 g / L, magnesium sulfate 0.45-0.55 g / L, and the balance is distilled water; pH 7.0-7.2; Alternatively, the seed culture temperature is 26-30°C and the time is 14-20 hours.

8. The production method according to claim 6, wherein: The culture medium used for fermentation production is composed of: glucose 35-50 g / L, soybean meal 5.0-8.0 g / L, phosphate 3.0-5.0 g / L, magnesium sulfate 0.5-1.0 g / L, and the balance is distilled water; pH 7.0-7.2; Alternatively, the fermentation temperature is 26-30°C and the fermentation time is 60-72 hours; Alternatively, the seed liquid after seed culture is inoculated into a fermentation medium at a volume percentage of 9-11%, and then fermentation production is carried out; Or, after fermentation production, the viscosity of the fermentation liquid is 7640~9350 mPa.s.

9. A colorless gellan gum, characterized in that: Obtained by the production method according to any one of claims 6 to 8.

10. The colorless gellan gum according to claim 9, wherein The molecular weight is (4.12~4.75)×10 5 Da.