Wheat stem rot regulatory gene Tatrx-m, encoding protein thereof, recombinant vector and application of wheat stem rot regulatory gene Tatrx-m

Abstract

The invention relates to a wheat stem rot regulatory gene Tatrx-m, and an encoding protein, a recombinant vector and an application of the wheat stem rot regulatory gene Tatrx-m. The genomic sequence of the gene is SEQ ID NO.1, the CDS sequence of the gene is SEQ ID NO.2, and thioredoxin shown as SEQ ID NO.3 is encoded. The invention further provides a specific primer pair used for gene identification, a silent vector (Tatrx-m-VIGS) and an overexpression vector (LGY-OE3-Tatrx-m) are constructed, and the function of the primer pair is verified through a virus-induced gene silencing (VIGS) technology and agrobacterium-mediated transformation of wheat. Experiments show that silence of Tatrx-m results in significant reduction of wheat stem rot resistance, and overexpression of the gene can improve resistance. Based on hypha quantification, DAB staining, H2O2 content and cell death analysis, Tatrx-m is revealed to enhance wheat resistance by regulating active oxygen removal and cell wall strengthening pathways. The gene TaTrx-m has the positive regulation effect in wheat stem rot for the first time, can be applied to disease-resistant molecular marker development, gene editing and transgenic breeding, provides core genetic resources for disease-resistant variety breeding, and has theoretical and application values.

Description

Technical Field

[0001] This application relates to the field of molecular assisted breeding technology, specifically to a wheat stem rot regulatory gene TaTrx- m , its encoding protein, recombinant vector and application. Background Art

[0002] wheat( Triticum aestivum As a staple crop for over 35% of the world's population, high and stable yields are crucial to food security. However, the recent explosive spread of wheat crown rot (FCR) has become a major threat to wheat production. FCR is caused by a complex infection with multiple Fusarium fungi. The toxins produced by the pathogens, such as deoxynivalenol (DON), not only reduce wheat quality but also pose a threat to human and livestock health. Currently, no wheat varieties have been developed, either domestically or internationally, that are highly resistant or immune to FCR. Resistance genes are scarce, and the molecular regulatory mechanisms remain unclear, resulting in slow progress in breeding for disease resistance.

[0003] Existing studies have shown that wheat FCR resistance is controlled by micro-effect polygenes, and related studies have mostly focused on the preliminary positioning of resistance QTLs (quantitative trait loci). For example, Li et al. (2024) found the Qfcr.cau.3D-3 locus at 609.12-614.69 Mb on chromosome 1D, which can increase resistance by 39.66%; Yang et al. (2021) cloned a negative regulator of resistance through GWAS. TaDIR Lv et al. (2023) identified a gene that is resistant to FCR and sheath blight. TaCWI-B1 gene, which plays a role by regulating the content of cell wall mannan; Zhang et al. (2025) and Yang et al. (2025) found TaP5CS1 (regulates proline synthesis) and TaCAT2 However, the above results still have significant limitations: 1. Few resistance genes are available: Currently, only a few genes have been cloned, and their functions have not been fully verified, making it difficult to support multi-gene breeding. 2. Single regulatory mechanism: Existing genes mostly focus on specific metabolic pathways (such as cell wall modification and anti-oxidation), lacking analysis of the global regulatory network; 3. Limited application potential: Some genes (e.g. TaDIR ) negatively regulates resistance, or the resistance effect is limited to a specific growth period (such as the seedling stage), which makes it difficult to directly use it for the breeding of disease-resistant varieties in the field.

[0004] In summary, existing technologies have yet to overcome the bottlenecks of a lack of FCR resistance gene resources, unclear functional mechanisms, and limited breeding applications. Therefore, there is an urgent need to discover new disease-resistance genes, clarify their molecular functions and regulatory pathways, and provide core gene resources for disease-resistance breeding.

[0005] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure and should not be regarded as an admission or any form of suggestion that the information constitutes the prior art known to those skilled in the art. Summary of the Invention

[0006] The present application provides a wheat stem rot regulating gene TaTrx-m , its encoding protein, recombinant vector and application are intended to solve the current technical problem of lack of regulatory genes for wheat stem rot, so as to provide more options for wheat disease-resistant breeding and stem rot prevention and control.

[0007] According to one aspect of the present disclosure, a wheat stem rot regulating gene was screened and obtained. TaTrx-m , with any of the following sequences: (1) The genomic nucleotide sequence shown in SEQ ID NO. 1; (2) the CDS nucleotide sequence shown in SEQ ID NO. 2; (3) Nucleotide sequences with equivalent functions derived from the nucleotide sequence defined by SEQ ID NO.2, including those with a sequence homology of more than 85% with SEQ ID NO.2 and encoding proteins that control and regulate wheat basal rot resistance.

[0008] According to another aspect of the present disclosure, a wheat stem rot regulating gene is provided. TaTrx-m The amino acid sequence of the encoded protein is: (1) the amino acid sequence shown in SEQ ID NO. 3; (2) A translatable fragment or conservative variant obtained by deleting, adding or replacing one or more amino acids based on the amino acid sequence defined in SEQ ID NO.3.

[0009] According to the third aspect of the present disclosure, a primer pair for amplifying the above-mentioned gene is provided, the full nucleotide sequence of which is shown below: TaTrx-m- 1F: 5'-ATGGCCTTGGAGACATGC-3'; TaTrx-m- 1R: 5'-TTAGCTGCCGATGTACTTG-3'.

[0010] According to the fourth aspect of the present disclosure, there is provided a wheat stem rot regulatory gene TaTrx-mSilencing recombination vector, linearized plasmid, single-stranded RNA transcribed in vitro, or Virus Induced Gene Silencing (VIGS) positive silencing plant, etc.

[0011] In some embodiments of the present disclosure, a specific DNA fragment from the 218th to the 381st nucleotide of the sequence shown in SEQ ID NO. 2 is inserted into the Pacl and Notl double enzyme cutting sites of the BSMV-g-PDS vector to obtain a VIGS silencing recombination vector.

[0012] In some embodiments of the present disclosure, a recombinant vector containing a wheat stem base rot resistance gene TaTrx-m is provided, for example, a wheat stem base rot regulatory gene TaTrx-m The complete CDS sequence is inserted into the LGY-OE3 plant overexpression vector by restriction enzymes BamHI and SacI to form a recombinant overexpression vector.

[0013] The expression vector carrying the above-mentioned TaTrx-m or a fragment thereof can be transformed into plant cells or tissues by using Ti plasmid, Ri plasmid, plant virus vector, microinjection, electroporation, Agrobacterium-mediated, etc. conventional biological methods, and the transformed plant tissue is cultivated into a plant; the transformed host can be a monocotyledonous plant or a dicotyledonous plant.

[0014] According to a fifth aspect of the present disclosure, the wheat stem base rot regulatory gene TaTrx-m , the primer or the recombinant vector is applied in at least one of the following (1) ~ (3): (1) breeding wheat stem base rot resistant varieties / strains or preparing formulations for breeding wheat stem base rot resistant varieties / strains; (2) identifying wheat stem base rot resistance or preparing formulations for identifying wheat stem base rot resistance; (3) constructing a transgenic plant strain antagonizing Fusarium pseudograminearum.

[0015] According to a sixth aspect of the present disclosure, the wheat stem base rot regulatory gene TaTrx-m , the protein or the recombinant vector is applied in at least one of the following (1) ~ (4): (1) adjusting the antioxidant capacity of the plant or preparing a preparation for adjusting the antioxidant capacity of the plant; (2) preventing and treating wheat stem base rot or preparing a preparation for preventing and treating wheat stem base rot; (3) adjusting the ability of the plant to antagonize Fusarium pseudograminearum or preparing a preparation for adjusting the ability of the plant to antagonize Fusarium pseudograminearum; (4) Improving the resistance of wheat to stem base rot or preparing a preparation that improves the resistance to wheat to stem base rot.

[0016] According to a seventh aspect of the present disclosure, a method for improving wheat resistance to stem base rot is provided, wherein the wheat stem base rot regulatory gene TaTrx-m Upregulated expression in wheat plants.

[0017] This application discloses for the first time a new regulatory gene for wheat stem rot resistance, targeting the current situation of scarcity, unclear functional mechanism and insufficient breeding application of wheat stem rot resistance genes. TaTrx-m , its nucleotide sequence, encoded protein and recombinant vector, and functional verification revealed its key role in FCR resistance. The specific technical solutions and effects are as follows: 1. Gene discovery and function confirmation: Through genome-wide association analysis and gene silencing (VIGS) technology, we identified and verified TaTrx-m The regulatory role of FCR resistance was revealed for the first time. TaTrx-m As a positive regulatory factor, it is directly involved in wheat's resistance response to FCR, providing key genetic resources for this field and new targets for the study of the molecular mechanism of disease resistance.

[0018] 2. Gene structure analysis: clear TaTrx-m The genome sequence (SEQ ID NO.1), CDS sequence (SEQ ID NO.2), and the thioredoxin family member (SEQ ID NO.3) it encodes are available. This provides complete gene sequence information, laying the foundation for molecular marker development, gene editing, and transgenic breeding.

[0019] 3. Gene silencing to verify resistance mechanism: using virus-induced gene silencing (VIGS) technology to downregulate TaTrx-m Expression was detected, and the disease index of silenced plants was significantly increased. TaTrx-m The positive regulatory effect on FCR resistance provides functional evidence for the study of disease resistance pathways and suggests that it can serve as a molecular switch for enhanced resistance.

[0020] 4. Overexpression to enhance resistance: Construction of an Agrobacterium-mediated immature embryo transformation system TaTrx-m Overexpression lines, pot inoculation experiments showed that the disease index of overexpression plants was significantly reduced without affecting agronomic traits. TaTrx-m Its application potential in breeding provides a reliable technical path for cultivating wheat varieties with both disease resistance and stable yield.

[0021] 5. Molecular mechanism and breeding value: Multi-omics analysis showed that TaTrx-mBy regulating the expression of genes related to reactive oxygen species (ROS) scavenging and cell wall strengthening, disease resistance is synergistically enhanced. Breaking through the limitations of existing single-pathway resistance genes, TaTrx-m The multi-effect regulatory network provides theoretical support for the design of multi-gene stacking disease resistance strategies.

[0022] This application achieved the following breakthroughs through a full-chain study of "gene mining-functional analysis-breeding verification": ① Resource innovation: Providing the first FCR resistance gene with both clear function and breeding value TaTrx-m ; ② Mechanism breakthrough: clarify the new function of the thioredoxin family in FCR resistance and expand the understanding of the association between redox regulation and disease resistance; ③ Application orientation: through dual verification of silencing and overexpression, clarify TaTrx-m The breeding suitability of this product provides an efficient genetic tool for the selection of disease-resistant varieties.

[0023] The implementation of the present invention will significantly improve the efficiency of wheat disease resistance molecular breeding, reduce dependence on chemical control, and is of great significance to ensuring food security and ecological sustainability. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The number of plants treated with different methods in the VIGS test in one embodiment of the present application is TaTrx-m Relative gene expression, wheat stem base disease resistance comparison and disease index statistics.

[0025] Figure 2 This is a diagram showing the hyphae quantification, DAB staining, hydrogen peroxide content determination, and cell necrosis staining of wheat stem base disease under different treatments in a VIGS test in one embodiment of the present application.

[0026] Figure 3 In one embodiment of this application TaTrx-m Relative expression levels, wheat stem base disease resistance comparison and disease index statistics in its overexpression lines (OE#16, OE#17, OE#18 and OE#19) and the control Fielder.

[0027] Figure 4 In one embodiment of this application TaTrx-m Mycelial quantification, DAB staining, hydrogen peroxide content determination and cell necrosis staining of wheat stem base disease in its overexpression lines (OE#16, OE#17, OE#18 and OE#19) and the control Fielder. DETAILED DESCRIPTION

[0028] In order to better understand the technical solution of the present application, the above technical solution will be described in detail below with reference to the accompanying drawings and specific implementation methods.

[0029] Unless otherwise specified, all instruments and equipment used in the following examples are conventional. All reagents, carriers, and other experimental materials are commercially available, unless otherwise specified. All experimental and detection methods, unless otherwise specified, are conventional. Quantitative experiments in the following examples were performed in at least three replicates, and the results were averaged. Primer synthesis and sequencing were performed by Sangon Biotech (Shanghai) Co., Ltd.

[0030] Example 1: Wheat stem rot regulatory genes TaTrx-m Acquisition and functionality The discovery of wheat stem rot regulatory genes was carried out through acetylated proteome sequencing, as follows: 1. Pathogen propagation The strain used in this experiment was Pseudomonas graminearum FP-Ta5, a predominant pathogen currently prevalent in the Huanghuai wheat region, characterized by its wide infection range and strong pathogenicity. Preserved Pseudomonas graminearum was removed and activated on PDA culture medium. For propagation, healthy, vigorous, hyphae-bearing fungi were selected from the edge of the newly activated Pseudomonas graminearum PDA culture plate and inoculated into sterile millet culture medium at 25°C for 7 days.

[0031] 2. Material inoculation, cultivation and sampling The wheat cultivar Yunong 268, which is moderately resistant to stem rot, was selected and the method of Yang (2019) was followed. 150 g of sterile soil was weighed into a 7 cm × 7 cm square box. Twelve wheat seeds were evenly placed on the surface, and covered with 20 g of soil. Each treatment was replicated three times. The seeds were placed on trays, the bottoms were watered thoroughly, and the seeds were incubated in an incubator with a 16 / 8 hour cycle, 25°C / 15°C, and a humidity of 60–80%. Three days after seedling emergence, weak seedlings were removed, and 0.4 g of infected millet was inoculated into the box, evenly filling the box to ensure that each wheat seedling had a millet fungus at its base. Incubation conditions were the same as before, with watering every two days. Rapid samples were taken from the stem base at 0, 24, 48, 72, and 96 hours after inoculation and quickly frozen in liquid nitrogen for protein extraction.

[0032] 3. Discovery of genes regulating wheat stem rot TMT sequencing was used to analyze the acetylated proteome of wheat stem bases at different inoculation time points. A total of 4,439 acetylated proteins were identified at the protein level. P <0.05 standard, with 0 h as the control, the differentially acetylated proteins that responded to stem base rot at two or more time points were counted, and a total of 135 differentially acetylated proteins were identified, corresponding to 135 differentially acetylated genes.

[0033] GWAS analysis of the above 135 genes combined with the wheat stem rot 660K chip (Yang et al, 2019) showed that 5 candidate genes were significantly associated with wheat stem rot. Further tissue-specific expression analysis showed that a gene encoding m-type thioredoxin ( TaTrx-m , China Spring Registration No.: TraesCS5B03G0294300) is highly expressed in the base of the stem, a common site of wheat stem rot. Trx-m Genes play a vital role in photosynthetic metabolism, meristem development, and oxidative stress. TaTrx-m There are few reports on its disease resistance function in plants. Therefore, it was cloned as a target gene.

[0034] Based on the published Chinese Spring reference sequence, the wheat Yunong 268 TaTrx-m Cloning was performed to finally obtain a complete open reading frame.

[0035] ① DNA extraction: DNA of Yunong 268 seedlings was extracted using the SLS method.

[0036] ② Total RNA extraction and reverse transcription: Total RNA was extracted from Yunong 268 seedlings using TRIZOL reagent. Reverse transcription was performed using ReScript II RT All-in-One Mix (with dsDNase) (Nobelab) according to the instructions to obtain cDNA.

[0037] ③ TaTrx-m Gene cloning and sequence analysis: Design of PCR specific primers, TaTrx-m -1F and TaTrx-m -1R was designed at both ends of the start codon ATG and the stop codon TAA, respectively, as follows: TaTrx-m- 1F: 5'-ATGGCCTTGGAGACATGC-3'; TaTrx-m- 1R: 5'-TTAGCTGCCGATGTACTTG-3'.

[0038] Using the DNA of Yunong 268 as a template, TaTrx-m -1F and TaTrx-m -1R primer pair for PCR amplification. PCR reaction solution (50 μL system): 10× PCR Buffer (25 μL), ddH2O (9 μL), dNTP (10 μL), TaTrx-m -1F (1.5 μL), TaTrx-m-1R (1.5 μL), DNA (2 μL), Taq enzyme (1 μL); PCR parameters: 94°C for 5 min, 94°C for 30 s, 60°C for 30 s, 72°C for 30 s, for a total of 35 cycles, and 72°C for 10 min. PCR products were electrophoresed on a 1% agarose gel, recovered, ligated into the pMD18-T vector (TAKARA), and sent to Biotechnology for sequencing.

[0039] A similar method was used to use the cDNA of Yunong 268 as a template. TaTrx-m -1F and TaTrx-m PCR amplification was performed using the -1R primer pair; the PCR reaction system and parameters were the same as described above. After recovery, the fragment was ligated into the pMD18-T vector (TAKARA) and sent to Bioengineering for sequencing.

[0040] The sequencing results showed that the DNA fragment obtained by PCR amplification using the DNA of wheat Yunong 268 as a template was TaTrx- m The genomic sequence of the gene is shown in SEQ ID NO.1, which is 616 bp long and contains 2 exons and 1 intron. The DNA fragment obtained by PCR amplification using the cDNA of wheat Yunong 268 as a template is TaTrx-m The CDS (sequence of coding regions) horizontal sequence of the gene has a CDS nucleotide sequence as shown in SEQ ID NO.2, which is 528 bp in length and encodes an amino acid sequence as shown in SEQ ID NO.3 in the sequence listing, with 175 amino acids.

[0041] Example 2: TaTrx-m VIGS silencing and identification 1. TaTrx-m Construction of recombinant silencing vector Select the specific DNA fragment of SEQ ID NO.2 from the 5' end 218 to 381, with a length of 180 bp, according to TaTrx-m Design appropriate primers based on the cDNA sequence, add restriction enzyme sites and protection bases of Pacl and Notl before the 5' end of the primers. The primer sequences are as follows: TaTrx-m -2F: 5'-GCTTAATTAATGACGAGAAGAATTGGGA-3', TaTrx-m -2R:5'- GCGCGGCCGCGTCCGTGTTCACCTTGCA-3'.

[0042] The cDNA of the wheat and barley stripe mosaic virus (BSMV)-susceptible variety Yunong 268 was used as a template to amplify the product by PCR and the product was recovered for later use. TaTrx-m The silencing fragment was inserted into the double enzyme digestion method between the Pacl and Notl double enzyme digestion sites of the BSMV phytoene desaturase (PDS) fusion vector (BSMV-γ-PDS) to construct a recombinant silencing vector named γ- TaTrx-m .

[0043] 2. Vector Linearization and In Vitro Transcription The viral vectors (α, β, γ) and γ- TaTrx-m The recombinant vector was linearized by enzyme digestion. TM Large Scale RNA Production Systems-T7 Kit was used to perform in vitro transcription on the linearized plasmid to obtain in vitro transcribed single-stranded RNA. TaTrx-m 2.5 μL of in vitro transcription products of each were mixed at a ratio of 1:1:1, diluted with DEPC-treated water to an equal volume, and the mixture was added to FES buffer to prepare the inoculated virus mixture. The experiment set up three different treatments: wild-type control (WT), VIGS empty vector control (BSMV0: α+β+γ) and gene silencing group (BSMV TaTrx-m :α+β+γ- TaTrx-m ).

[0044] 3. Virus Inoculation and VIGS Silencing Efficiency Assessment Virus inoculation was performed on wheat seedlings at the 2-leaf, 1-heart stage, following the method of Zhang et al. (2016). 8-10 μL of the virus mixture was applied to the index finger, wearing a latex glove, and rubbed three times against the second leaf of the seedling. After inoculation, the seedlings were sprayed lightly with DEPC-treated water and maintained at 23 ± 2°C, protected from light for 24 hours. The seedlings were then incubated under a normal 16 / 8 hour light / dark cycle. Two weeks after inoculation, gene silencing efficiency was assessed using fluorescence quantitative analysis. Total RNA extraction and cDNA reverse transcription were performed as in Example 1.

[0045] against TaTrx-m The specific primers for fluorescence quantitative analysis were designed based on the gene sequence as follows: TaTrx-m -3F:5'- TACAAGTACGCTCTGGTGGC -3'; TaTrx-m -3R:5'- CCACGTAGTCCTTTGCCAGT-3'.

[0046] Selection of internal reference genes β -actin (GenBank accession no. AB181991), the specific primer sequences are as follows: β -actin-F:5'-GTGTCGCACCAGAGGATCAT-3'; β -actin-R: 5'-CGCTGGCATACAAGGACAGA-3'.

[0047] Fluorescence quantification was performed using the Bio-Rad IQ5 Real-Time PCR Detection System (USA). A 20 μL reaction system contained 0.4 μL of each upstream and downstream primers, 10 μL of Go Taq® qPCR Master Mix (Perfect Real Time; Promega), and 7.2 μL of nuclease-free water. The PCR program was as follows: 95°C for 3 min, 95°C for 5 s, 60°C for 30 s, and 72°C for 30 s, for 40 cycles. TaTrx-m -3F and TaTrx-m -3R primers, with WT plants as controls, using 2 -△△CT Gene detection TaTrx-m In BSMV0 plants, BSMV TaTrx-m The relative expression levels in plants were as follows. Figure 1 As shown in Figure A, compared with WT and BSMV0, TaTrx-m It was significantly down-regulated by 7.9-fold in silenced plants, indicating that the gene was effectively silenced.

[0048] Example 3: TaTrx-m VIGS phenotypic identification Continuing with Example 2, the plant phenotype was investigated 2 weeks after inoculation, and the disease severity of the plant was calculated using the disease classification method of Yang et al. (2019). The results are as follows: Figure 1 B and Figure 1 As shown in C. Figure 1 B shows that compared with the wild type (WT), TaTrx-m The browning of the stem base of the silent plants increased, and the resistance to stem base rot decreased; Figure 1 C shows that compared with the wild type (DI=57.5), TaTrx-m The disease index of silent plants (DI=43.5) increased significantly, and the disease resistance of wheat plants decreased significantly.

[0049] From the wild type infected with Fusarium graminearum FP-Ta5, TaTrx-m Samples were collected from the stem base of the silenced plants and the empty control wheat to measure the biomass of F. graminearum on the wheat plants.

[0050] Selection of internal reference genes in wheat Tubulin (GenBank accession no. MG852130.1), and the specific primers are as follows: Tubulin -1F:5'- TACTACAACGAGGCGAGCG -3'; Tubulin -1R:5'-TGAGCCCAGATCTAAACGCT-3'.

[0051] The internal reference gene in Pseudomonas graminearum was also selected Tubulin (GenBank accession no. CP102997.1), the specific primer sequences are as follows: Tubulin -2F: 5'-GCCTTCACAACTCGCCATG-3'; Tubulin -2R: 5'-TTACGCATCGGTCTGAGTGG-3'.

[0052] Extract the total DNA of the above different treatments using two pairs of Tubulin PCR amplification was performed with internal reference gene primers, and relative grayscale analysis and calculation were performed on the gel image using wheat as the control. The results are as follows Figure 2 As shown in A. Figure 2 A shows that compared with WT and BSMV0, the amount of mycelium is TaTrx-m It increased significantly in silenced plants, and the wheat plants' ability to resist bacterial infection was weakened.

[0053] Example 4: TaTrx-m VIGS physiological index determination and functional verification Studies have shown that cellular redox status, including the generation and clearance of ROS, plays an important role in plant defense responses to pathogens, and Trxs play a key role in regulating redox balance through sulfur-disulfide exchange reactions. TaTrx-mThe disease resistance function of VIGS silenced plants may be related to the ROS pathway, so the DAB (3,3′-diaminobenzidine) method was used to detect the activity of peroxidase in VIGS silenced plants and the control group. When peroxidase is present, DAB will be converted by hydrogen peroxide (H2O2) into dark brown particles that are insoluble in water. The DAB staining method is as follows: DAB powder is prepared into a 0.5 mg / mL solution. Take plant leaves and place them in a centrifuge tube or culture dish, and add DAB solution. Vacuum at 0.08 MPa for 30 minutes and stain overnight at room temperature in the dark. The next day, 95% ethanol was added and heated in a water bath at 80°C to decolorize the leaves. After the green color of the leaves fades, they can be observed and photographed. Each treatment was repeated 6 times, and the results were as follows. Figure 2 As shown in Figure B, compared with WT and BSMV0, TaTrx-m The browning of leaves in silenced plants increased, indicating that the antioxidant capacity of plants was significantly reduced. Since H2O2 is an important component of ROS, the H2O2 content of different treatments was measured using a hydrogen peroxide detection kit (Beyotime, Product No. S0038). Figure 2 As shown in C. Figure 2 C shows that compared with WT and BSMV0, the H2O2 content is TaTrx-m It increased significantly in silenced plants, and the antioxidant capacity of wheat plants was weakened.

[0054] Trypan blue staining was further used to detect cell necrosis at the site of pathogen infection (necrotic cells can be stained blue). The method is as follows: Take a sample of the base of the wheat stem infected with the pathogen and place it in a 10 mL centrifuge tube. Add an appropriate amount of 0.4% trypan blue staining solution (Solarbo Company) to submerge the sample. Boil in a water bath for 2 minutes and cool naturally. Stain at room temperature overnight. Use chloral hydrate (250 g / 200 mL) for decolorization (change the decolorization solution every 1 hour). After decolorization, take a photo and record it. Each treatment was repeated 4 times. The results Figure 2 As shown in Figure D, compared with WT and BSMV0, TaTrx-m The silenced plants showed increased cell necrosis, indicating that the plants' disease resistance was significantly reduced.

[0055] Embodiment 5: TaTrx-m Acquisition and identification of transgenic wheat 1. TaTrx-m Construction of plant overexpression vectors According to the cloned TaTrx-m Primers were designed based on the full-length cDNA sequence, and restriction endonuclease BamHI and SacI recognition sites and protective bases were introduced at both ends of the primers. The primer sequences are as follows: TaTrx-m-4F:5'- CGGGATCCATGGCCTTGGAGACATGC -3'; TaTrx-m -4F:5'- CGGAGCTCTTAGCTGCCGATGTACTT -3'.

[0056] The 537 bp DNA fragment was cloned into the plant expression vector LGY-OE3 between the restriction sites BamHI and SacI to obtain TaTrx-m The recombinant expression vector of the gene was named LGY-OE3- TaTrx-m .

[0057] 2. TaTrx-m Obtaining genetically modified wheat LGY-OE3- TaTrx-m The immature embryo callus of wheat Fielder was transformed by Agrobacterium infection, and transgenic wheat plants were obtained through screening, pre-differentiation and differentiation.

[0058] 3. Positive identification of transgenic wheat The T1 generation transgenic plants were positively identified using the hygromycin tag (Hyg) primers Hyg-F and Hyg-R. The primer sequences are as follows: Hyg-F: 5'-TCTGCACCATCGTCAACCAC-3'; Hyg-R: 5'-AAACCCACGTCATGCCAGTT-3'.

[0059] A total of 21 positive transgenic plants were obtained, and the T2 generation was obtained by adding generations. TaTrx-m Homozygous transgenic lines OE#16, OE#17, OE#18 and OE#19.

[0060] 4. Genetically modified wheat TaTrx-m Expression identification For T2 generation TaTrx-m Transgenic lines OE#16, OE#17, OE#18, and OE#19 were subjected to fluorescence quantitative analysis with Fielder. Total RNA extraction and cDNA inversion were the same as in Example 1. The fluorescence quantitative PCR reaction system and method were the same as in Example 2. TaTrx-m -3F and TaTrx-m -3R primers, with Fielder as the control, using 2 -△△CT Gene detection TaTrx-m The expression levels in the T2 generation homozygous transgenic lines were as follows. Figure 3 As shown in A. Figure 3 A knows that TaTrx-mThe expression levels in the leaves of homozygous transgenic lines (OE#16, OE#17, OE#18 and OE#19) were significantly higher than those of the control, which were 49, 19, 21 and 23 times that of the control, respectively.

[0061] Example 6: TaTrx-m Phenotypic identification of transgenic wheat The T2 generation after 2 weeks of inoculation TaTrx-m Overexpression transgenic wheat lines (OE#16, OE#17, OE#18 and OE#19) and wild type control Fielder were subjected to stem base rot resistance and hyphae quantitative identification, as in Example 3. The results are shown in Figure 2. Figure 3 B. Figure 3 C and Figure 4 As shown in A.

[0062] Depend on Figure 3 B shows that compared with the wild type, the T2 generation TaTrx-m The browning of the stem base of the overexpressing transgenic plants was significantly reduced, and the resistance was enhanced. Figure 3 C shows that compared with the wild type (DI=70.2), the T2 generation TaTrx-m The disease index of the transgenic wheat lines (OE#16, OE#17, OE#18 and OE#19; DI=41.2, 44.4, 43.4 and 43.4) overexpressing the gene was significantly reduced, and the disease resistance of the plants was significantly enhanced. Figure 4 A shows that compared with the wild type, the T2 generation TaTrx-m The mycelial content of overexpressing transgenic wheat lines (OE#16, OE#17, OE#18 and OE#19) was significantly reduced, and their resistance to pathogen infection was enhanced.

[0063] Embodiment seven: TaTrx-m Determination of Physiological Indexes of Transgenic Wheat The T2 generation after 2 weeks of inoculation TaTrx-m Overexpressing transgenic wheat lines (OE#16, OE#17, OE#18 and OE#19) and wild-type control Fielder were subjected to DAB staining, H2O2 content determination and cell necrosis identification to detect the antioxidant capacity and cell survival level of the plants. Figure 4 B. Figure 4 C and Figure 4 As shown in D.

[0064] Depend on Figure 4 B shows that compared with the wild type, after DAB staining, the T2 generation TaTrx-m The leaf browning of overexpressing transgenic plants was significantly reduced, and the antioxidant capacity of the plants was significantly enhanced. Figure 4 C shows that T2 generation TaTrx-mThe H2O2 content in the overexpressing transgenic wheat lines was significantly lower than that in the wild type, and the disease resistance of the plants was significantly enhanced. Figure 4 D shows that compared with the wild type, the T2 generation TaTrx-m Overexpressing transgenic wheat lines (OE#16, OE#17, OE#18, and OE#19) showed reduced cell death and enhanced plant resistance.

[0065] Overall, TaTrx-m After gene silencing, the mycelial content of the plants increased and the disease resistance was significantly reduced; while overexpression TaTrx-m The mycelium content of the plant is reduced and the disease resistance is significantly enhanced. TaTrx-m It is a key gene that positively regulates wheat stem rot resistance, and it mainly enhances wheat stem rot resistance by regulating the plant's antioxidant capacity.

[0066] Although some preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of this application.

[0067] Obviously, those skilled in the art may make various changes and modifications to the present disclosure without departing from the spirit and scope of the inventive concept. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present application is intended to include such changes and modifications.

Claims

1. A wheat stem rot regulatory gene TaTrx-m , with any of the following sequences: (1) The genomic nucleotide sequence shown in SEQ ID NO. 1; (2) the CDS nucleotide sequence shown in SEQ ID NO. 2; (3) Nucleotide sequences with equivalent functions derived from the nucleotide sequence defined by SEQ ID NO.2, including those with a homology of more than 85% with the sequence defined by SEQ ID NO.2 and encoding proteins that control and regulate wheat resistance to basal rot.

2. The wheat stem rot regulating gene according to claim 1 TaTrx-m The encoded protein has the amino acid sequence shown in SEQ ID NO. 3 or its equivalent modified sequence.

3. An amplification kit comprising the following primers: TaTrx-m- 1F:5’- ATGGCCTTGGAGACATGC-3’; TaTrx-m- 1R:5’- TTAGCTGCCGATGTACTTG-3’。 4. A recombinant vector containing the wheat stem rot regulatory gene according to claim 1 TaTrx-m or its specific DNA fragment.

5. The recombinant vector according to claim 4, characterized in that The invention is a recombinant silencing vector containing a specific DNA fragment at positions 218 to 381 from the 5' end of the sequence shown in SEQ ID NO.

2.

6. The recombinant vector according to claim 4, characterized in that It is an overexpression vector containing the DNA fragment shown in SEQ ID NO.

2.

7. The wheat stem rot regulating gene according to claim 1 TaTrx-m , Use of the primer according to claim 3 or the recombinant vector according to claim 4 in at least one of the following (1) to (3): (1) Breeding wheat varieties / lines resistant to stem rot or preparing preparations for breeding wheat varieties / lines resistant to stem rot; (2) Identifying wheat resistance to stem rot or preparing a preparation for identifying wheat resistance to stem rot; (3) Construct transgenic plant lines that are antagonistic to Fusarium graminearum.

8. The wheat stem rot regulating gene according to claim 1 TaTrx-m , Use of the protein according to claim 2 or the recombinant vector according to claim 4 in at least one of the following (1) to (4): (1) Regulating the antioxidant capacity of plants or preparing preparations for regulating the antioxidant capacity of plants; (2) Preventing and controlling wheat stem rot or preparing preparations for preventing and controlling wheat stem rot; (3) regulating the ability of plants to antagonize Fusarium graminearum or preparing a preparation for regulating the ability of plants to antagonize Fusarium graminearum; (4) Improving the resistance of wheat to stem base rot or preparing a preparation that improves the resistance to wheat to stem base rot.

9. A method for improving wheat resistance to stem rot, characterized in that: Up-regulating the expression of the wheat stem rot regulatory gene according to claim 1 TaTrx-m .

Images