Application of OsDr1 gene in regulation and control of ratooning rice axillary bud germination

Abstract

The invention discloses application of an OsDr1 gene in regulation and control of ratooning rice axillary bud germination, and belongs to the technical field of biology. According to the invention, a gene OsDr1 interacting with a ratooning rice related gene OsDrAp1 is obtained through yeast double-impurity screening; the nucleotide sequence of the OsDr1 gene is as shown in SEQ ID NO.3, and primers for amplifying the OsDr1 gene are as shown in SEQ ID NO.1 and SEQ ID NO.2. Through construction of an OsDr1 transgenic knockout material, analysis finds that the OsDr1 can influence the ratooning rice axillary bud germination rate, and the OsDr1 can be used for breeding research of ratooning rice.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of the OsDr1 gene in regulating the germination of axillary buds of regenerated rice. Background Art

[0002] Rice is one of the most important food crops in my country, and ensuring stable rice yields is of great significance to my country's agricultural production. Ratoon rice refers to rice that, after the first-season rice is harvested, germinates into ears from the surviving axillary buds of the rice stumps under suitable conditions of light, temperature, water, and fertilizer, and then matures into ears. Ratoon rice not only saves manpower and material resources, but also has better quality than first-season rice because it does not experience high temperatures like the first-season rice. Due to its special growth characteristics, as long as the light and temperature are appropriate after the rice is harvested, it is particularly suitable for areas where there is sufficient light and temperature for growing one season of rice but insufficient light and temperature for growing two seasons of rice. This allows for two harvests from one crop, increasing yields and increasing efficiency. Therefore, promoting ratoon rice in production is of great strategic significance.

[0003] In the early stages of regeneration rice development, the main focus was on improving the planting management methods through the planting experience of farmers in various places to increase the yield of regeneration rice. For example, by paying attention to the fertilization, tillage and management of regeneration rice, and retaining the seeds of regeneration rice for planting. Another example is providing experience in the appropriate time to harvest the first-season regeneration rice, the height of the rice piles left, and the management of field irrigation. It was also found that the regeneration rice of the next year has the characteristics of tillering, multiple panicles, large grains, etc. With the advancement of productivity, scientific researchers have gradually begun to conduct research at the genetic molecular level. At present, certain results have been achieved in the study of molecules that affect regeneration rice, but only two genes have been cloned, which cannot meet the needs of regeneration rice production, and there is an urgent need to speed up the progress.

[0004] Dr1 (down-regulator) belongs to the NF-Y transcription factor family and can form a complex with DrAp1. This complex is widely present in various organisms and usually inhibits the transcription of downstream target genes, thereby participating in physiological processes such as plant-microorganism interactions, root development, and adversity response. Summary of the Invention

[0005] The present invention provides an application of the OsDr1 gene in regulating the germination of axillary buds of regenerated rice. The nucleotide sequence of the OsDr1 gene is shown in SEQ ID NO.3.

[0006] In one embodiment of the present invention, the regulation is to knock out the OsDr1 gene in rice.

[0007] The present invention also provides the use of a protein encoded by the OsDr1 gene in regulating the germination of axillary buds of regenerated rice. The nucleotide sequence of the OsDr1 gene is shown in SEQ ID NO.3.

[0008] The present invention also provides a method for regulating the germination of axillary buds of regenerated rice. When it is necessary to reduce the germination rate of the axillary buds of rice, the OsDr1 gene in the rice is overexpressed; when it is necessary to increase the germination rate of the axillary buds of rice, the OsDr1 gene in the rice is silenced or knocked out. The nucleotide sequence of the OsDr1 gene is shown in SEQ ID NO.3.

[0009] The present invention also provides an application of the OsDr1 gene in rice breeding. Rice lines with a faster axillary bud germination rate are obtained by screening rice plants with low expression of the OsDr1 gene. The nucleotide sequence of the OsDr1 gene is shown in SEQ ID NO.3.

[0010] The present invention also provides an application of the protein encoded by the OsDr1 gene in rice breeding. By screening rice plants with high expression of the protein encoded by the rice OsDr1 gene, a rice line with a faster axillary bud germination rate is obtained. The nucleotide sequence of the OsDr1 gene is shown in SEQ ID NO.3.

[0011] The present invention also provides a method for obtaining improved rice with a faster axillary bud germination rate, comprising knocking out the OsDr1 gene according to claim 1 in the rice.

[0012] In one embodiment of the present invention, the method comprises the following steps: knocking out the OsDr1 gene in rice using the CRISPR / Cas9 genome editing system.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The present invention identified the gene OsDr1, which interacts with the regenerated rice gene OsDrAp1, through yeast two-hybrid screening. By constructing OsDr1 transgenic knockout material, analysis revealed that OsDr1 also affects the germination rate of axillary buds in regenerated rice. Its effect on the growth and development of axillary buds in regenerated rice was determined, which can be used in regenerated rice breeding research. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the verification of the interaction between OsDrAp1 and OsDr1 in Example 1, wherein A, yeast two-hybrid, SD-THLA, tetra-deficient medium (SD / -Trp-His-Leu-Ade); B, pull down; C, BiFC; D, Co-IP.

[0016] Figure 2 These are the statistical results of the observation of axillary bud germination and sheathing rate of regenerated buds in the OsDr1 transgenic rice material in Example 1. DETAILED DESCRIPTION

[0017] Example 1

[0018] 1. OsDr1 gene cloning

[0019] Research has shown that OsDrAp1 can affect axillary bud germination in rice regeneration, and others have reported that OsDrAp1 can form a complex with OsDr1. Therefore, primers were designed based on the reference sequence provided by NCBI, and OsDr1 was amplified and cloned using the cDNA of the japonica rice variety Nipponbare as a template. The amplification primers are as follows:

[0020] OsDr1CDS-1F (SEQ ID NO.1): ATGGATCCGATGGATATCGTGG;

[0021] OsDr1CDS-1R (SEQ ID NO. 2): TCATGAACTGTCCAAGCCATGT.

[0022] Amplification was performed using KOD FX DNA Polymerase (provided by TOYOBO). The PCR amplification system consisted of 10 μL of Primer Star, 7 μL of ddH2O, 1.5 μL of Primer-F, 1.5 μL of Primer-R, and 1 μL of template DNA. After sample addition, the mixture was mixed and centrifuged. The PCR amplification program was as follows: 98°C pre-denaturation for 5 minutes; 35 cycles of denaturation at 98°C for 10 seconds, annealing at 65°C for 30 seconds, and extension at 72°C for 60 seconds; extension at 72°C for 5 minutes; and constant temperature at 4°C. The OsDr1 CDS was obtained from Nipponbare. After amplification, the PCR product was analyzed by agarose gel electrophoresis. The amplified product was recovered from the gel and sent to the company for sequencing, resulting in the OsDr1 CDS sequence.

[0023] >OsDr1 CDS (SEQ ID NO. 3)

[0024] ATGGATCCGATGGATATCGTGGGGAAGTCCAAGGAGGACGTCTCCCTCCCCAAATCAACAATGTTTAAGATTATAAAGGAGATGTTGCCCCCTGATGTTCGAGTGGCAAGAGATGCACAAGATCTTCTTGTGGAATGCTGTGTAGAGTTCATCAACCTCCTATCTTCTGAATCCAATGAAGTTTGCAGCCGAGAGGACAAGAAAACTATTGCTCCTGAGCATGTTCTTAGAGCTCTGCAGGATCTTGGCTTTAGGGAGTACATTGAAGAGGTTCAAGCGGCCTACGAACACCATAAGCATGATACCCTGGATTCTCCAAAAGCAAGCAAATTCACTGGTGTGGAGATGACAGAGGAACAAGCTGTAGCTGAGCAACAGAGGATGTTTGCTGAGGCCCGAGCAAGGATGAACAATGGTGCCGCCAAACCGAAGGAGCCAGAACCTGAAGCGCAGCAACAAACACAACAGCCACCACAGCCTCAGCTGCACCCTCAACCACAGCAACCCCTGCAGCCTCAACTTCAGCTCCATCCTCAACCACAACAACAGCCCTCACAGCTACATCCTCAACAGCTGCTGCATCCTCAATCGCAGCAAACTCCGCAGCCTCAACCTCAGGTCCACCCTCAACCACAGCAGCCTCCACAGCTGCAACCGCAACCTCAGCTTCTCCAGCAACCGCAGCTGCCCCAACAGCTGCAGCCGCAATCTCAGCTCCCCCCACAACCGCAGCAGCCCCCACAGCTGCAGCTGCAATCTCAGCTCCACCCACAACCGCAGCAGCCCCCACAGCTGCAGCCGCAACCTCAGCTCCATCAGCAACCGCAGCCGCAGGCAGAGCTGCAATCACAGTCACAACCACAAACAGAACATGGCTTGGACAGTTCATGA

[0025] 2. OsDr1 interacts with OsDrAp1

[0026] The pGADT7-Dr1, pGADT7-DrAp1, pGBKT7-Dr1, and pGBKT7-DrAp1 vectors were constructed for yeast two-hybrid experiments. After confirming that the protein had no self-activation activity, the experimental and control groups were transferred into yeast AH109 and grown on a two-deficient (SD / -Leu / -Trp) medium for 3-4 days. Yeast colonies grown on the two-deficient medium were picked and continued to grow on a four-deficient medium (SD / -Leu / -Trp / -His / -Ade) to verify the interaction. The p2YN-DrAp1 and p2YC-Dr1 vectors were constructed for BiFC experiments. After chopping rice stems that had grown for about 2 weeks, the cell walls were decomposed using cellulase, pectinase, and hemicellulase. After filtration, the protoplasts were obtained by resuspending and centrifuging in W5 solution-20% sucrose solution-W5 solution. After microscopic examination, the experimental and control plasmids were transformed into rice protoplasts and expressed for 12-24 hours. Fluorescence signals were observed and photographed using a laser confocal microscope. DrAp1-His and Dr1-MBP vectors were constructed for prokaryotic expression for pulldown experiments. After ultrasonic disruption, the supernatant was incubated with correspondingly labeled beads to aggregate the target protein onto the beads and purify the DrAp1-His protein. After protein quantification, 5%-10% of the protein was used as input. Appropriate amounts of Dr1-MBP and MBP proteins bound to the anti-MBP beads were aspirated, and equal amounts of DrAp1-His protein were added. After incubation, SDS-PAGE and western blot analysis were performed. MBP antibodies were used to detect the presence of Dr1-MBP and MBP proteins in the samples, as well as the relationship between the protein amounts. His antibodies were used to detect the presence of DrAp1-His protein in the samples. The pCAMBIA1305-DrAp1-GFP and pCAMBIA1300-Dr1-Flag vectors were constructed for Co-IP experiments. Each vector was transformed into rice protoplasts and expressed for 48-72 hours before Co-IP. Fluorescence microscopy was used to observe normal expression of DrAp1-GFP, and protein extraction was performed on leaf regions with high expression. A portion of the sample was retained as input, and the remainder was incubated with GFP beads. Western blotting was performed using SDS loading buffer. The input and beads samples were detected for the presence of the corresponding proteins using GFP and Flag antibodies, respectively.

[0027] A series of molecular experiments were used to verify whether OsDr1 and OsDrAp1 from Nipponbare can interact. Yeast two-hybrid analysis showed that yeast cells could only grow in the presence of both OsDrAp1 and OsDr1 in the presence of four-deficient culture medium. Figure 1A). The OsDrAp1 coding region was conjugated to an MBP tag, and the OsDr1 coding region was conjugated to a GST tag. The corresponding proteins were induced in vitro. MBP was used as input, and the proteins eluted from the GST beads were subjected to western blot. The results showed that the OsDrAp1-MBP protein could bind to the OsDr1-GST protein, but the OsDrAp1-MBP protein could not bind to the GST protein, demonstrating that there is an interaction between the two proteins ( Figure 1 B). BiFC experiments found that yellow fluorescence could only be observed when OsDrAp1 and OsDr1 were present simultaneously. Figure 1 C). GFP-OsDr1 and Myc-OsDrAp1 were expressed in rice protoplasts, and Co-IP experiments were performed after total protein extraction. The results showed that GFP-OsDr1 protein could bind to Myc-OsDrAp1 protein, while GFP protein could not bind to Myc-OsDrAp1 protein ( Figure 1 D) The above experiments demonstrate that OsDrAp1 interacts with OsDr1.

[0028] 3. Functional Verification of OsDr1 Transgene

[0029] Using the CRISPR-P 2.0 website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), a knockout target (SEQ ID NO. 4: GTTCAGCTCACATTTGGGGA) was designed and annealed within the key functional domain of OsDr1. Primers were designed and ligated into the CRISPR-Cas9 vector. The target was then transformed into Escherichia coli, and the plasmid was extracted and transferred into Agrobacterium tumefaciens. The plasmid was then infected with rice (Zhonghua 11) callus to construct OsDr1 knockout transgenic material. Primers were designed to amplify the OsDr1 CDS and promoter sequences. Each material was planted in plots of 7 plants × 5 rows under normal field irrigation and fertilization management. Rice was harvested manually at maturity, with stakes left at a height of 15 cm. Fourteen days after harvest, the sheathing rate of regenerated buds from the 15 plants remaining in each plot, excluding the edge rows, was counted. The germination of regenerated buds of OsDrAp1 knockout materials was observed, and it was found that the germination rate of knockout plants was significantly increased, proving that OsDr1 negatively regulates the germination of axillary buds of regenerated rice ( Figure 2 ).

[0030] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of the OsDr1 gene in regulating axillary bud germination in regenerated rice, characterized in that: The nucleotide sequence of the OsDr1 gene is shown in SEQ ID NO.

3.

2. The use according to claim 1, characterized in that The regulation is to knock out the OsDr1 gene described in claim 1 in rice.

3. Application of the protein encoded by the OsDr1 gene in regulating axillary bud germination of regenerated rice, characterized in that: The nucleotide sequence of the OsDr1 gene is shown in SEQ ID NO.

3.

4. A method for regulating the germination of axillary buds of regenerated rice, characterized in that: When the rice axillary bud germination rate needs to be reduced, the OsDr1 gene in rice is overexpressed; when the rice axillary bud germination rate needs to be increased, the OsDr1 gene in rice is silenced or knocked out; the nucleotide sequence of the OsDr1 gene is shown in SEQ ID NO.

3.

5. Application of OsDr1 gene in rice breeding, characterized in that: Rice lines with a faster axillary bud germination rate were obtained by screening rice plants with low expression of the OsDr1 gene, the nucleotide sequence of which is shown in SEQ ID NO.

3.

6. Application of the protein encoded by the OsDr1 gene in rice breeding, characterized in that: Rice lines with a faster axillary bud germination rate were obtained by screening rice plants with high expression of the protein encoded by the rice OsDr1 gene, the nucleotide sequence of which is shown in SEQ ID NO.

3.

7. A method for obtaining improved rice with a faster axillary bud germination rate, characterized in that: The method comprises knocking out the OsDr1 gene according to claim 1 in rice.

8. The method according to claim 7, characterized in that The method comprises the following steps: using the CRISPR / Cas9 genome editing system to knock out the OsDr1 gene in rice.

Images