Application of OsCOMT gene in brown planthopper resistance of rice

Abstract

The invention relates to the technical field of agricultural biology, particularly discloses application of an OsCOMT gene in resisting brown planthopper of rice, and particularly discloses application of the OsCOMT gene or encoded protein of the OsCOMT gene in regulating and controlling the resistance of the rice to the brown planthopper, and the nucleotide sequence of the OsCOMT gene is shown as SEQ ID NO.1. The invention further discloses application of the OsCOMT gene or the encoded protein of the OsCOMT gene in resisting the brown planthopper of the rice. The OsCOMT gene is subjected to overexpression and knockout, after resistance identification, it is found that the overexpression of the OsCOMT gene can increase the resistance of rice to brown planthopper, the knockout of the OsCOMT gene can reduce the resistance of rice to brown planthopper, and the discovery provides a new thought and direction for breeding rice varieties with higher brown planthopper resistance.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biotechnology, in particular to OsCOMT Application of genes in rice resistance to brown planthopper. Background Art

[0002] Rice ( Rice Rice is one of the world's most important food crops, and its stable yield is crucial to safeguarding the national economy and people's livelihoods. As a model research crop in the Poaceae family, rice has a relatively small genome, highly mature transgenic technology, and increasingly in-depth functional genomic research. Therefore, rice demonstrates unparalleled superiority and importance in socioeconomic development, national security, and scientific research.

[0003] Brown planthopper (BPH, Nilaparvata lugens ) is the most important pest in rice-growing areas. Brown planthoppers are highly explosive and migratory, causing widespread and severe damage.

[0004] Currently, chemical pesticides are the primary method of controlling brown planthoppers. However, the overuse of pesticides not only increases farmers' production and labor costs but also causes irreversible environmental damage. Furthermore, pesticides can kill natural enemies of brown planthoppers, fostering their resistance and potentially triggering a resurgence of the insecticide. Utilizing rice resistance genes to develop insect-resistant varieties is currently the most cost-effective control strategy. The International Rice Research Institute (IRRI) has demonstrated in its experience in brown planthopper control that planting rice varieties with varying resistance levels can effectively control the rapid growth of brown planthopper populations and, to a certain extent, slow the rate of biotype and virulence variation, thereby achieving long-lasting resistance. Therefore, the continuous discovery and cloning of new resistance genes and their application in breeding are key research topics for comprehensive brown planthopper control. Furthermore, the cloning of resistance genes and the elucidation of their insect resistance mechanisms will enrich research on rice functional genomics, ensuring my country's global leadership in this field. Summary of the Invention

[0005] The main purpose of the present invention is to provide a OsCOMT Application of a gene or its encoded protein in regulating rice resistance to brown planthoppers to solve the problems raised in the background technology, OsCOMT The nucleotide sequence of the gene is shown in SEQ ID NO. 1. Furthermore, the amino acid sequence of the encoded protein is shown in SEQ ID NO. 2.

[0006] Those skilled in the art will appreciate that a protein sequence can be modified without altering its function by replacing, substituting, adding, or deleting one or more amino acids in the sequence. Therefore, the present invention should be understood to include such modifications to the amino acid sequence shown in SEQ ID NO: 2.

[0007] OsCOMT The base sequence of the gene is not limited to that shown in SEQ ID NO: 1 in the sequence list, but also includes OsCOMT Genes and those with the above modifications OsCOMT A DNA sequence in which any codon corresponding to each amino acid residue in a protein is selected and combined. The codon selection can be performed according to conventional methods or with reference to the codon preference of the host.

[0008] In one embodiment, the present invention further provides a use of a recombinant vector in regulating rice resistance to brown planthoppers, wherein the recombinant vector comprises OsCOMT Gene sequence, the OsCOMT The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0009] In one embodiment, the present invention further provides a use of an engineered bacterium in regulating rice resistance to brown planthoppers, wherein the engineered bacterium contains the recombinant vector described above.

[0010] In one embodiment, the present invention further provides a kit for use in regulating rice resistance to brown planthoppers, wherein the kit contains the recombinant vector or the engineered bacteria.

[0011] In some embodiments, the regulation comprises overexpression OsCOMT Genes that make rice more resistant to brown planthoppers, or by knocking them out OsCOMT Genes make rice less resistant to brown planthoppers.

[0012] In one embodiment, the present invention provides a method for regulating rice resistance to brown planthoppers. When it is necessary to reduce the resistance of rice to brown planthoppers, the rice OsCOMT Gene knockout; when it is necessary to improve the resistance of rice to brown planthoppers, OsCOMT Gene overexpression; OsCOMT The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0013] In one embodiment, the present invention provides a OsCOMT Application of genes in rice breeding, including overexpression of OsCOMT Genetic acquisition of rice lines resistant to brown planthoppers, and knockout of OsCOMT A rice line genetically acquired to be susceptible to brown planthopper; OsCOMT The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0014] In one embodiment, the present invention provides a method for cultivating brown planthopper-resistant rice, comprising: OsCOMT The gene overexpression vector is transferred into rice to cultivate rice; OsCOMT The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0015] In one embodiment, the present invention provides a method for screening rice resistant to brown planthopper, comprising detecting OsCOMT The expression level of the gene OsCOMT The expression level of the gene is positively correlated with the resistance to rice brown planthopper. OsCOMT The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0016] The significant advantages of the present invention are: (1) The present invention OsCOMT The gene is an insect-resistant gene and can be well used in the insect-resistant breeding of hybrid rice.

[0017] (2) The experiments of the present invention have shown that OsCOMT Overexpression of resistance to brown planthopper feeding, insensitivity to brown planthopper feeding, knockout by CRISPR / Cas9 OsCOMT Rice with a modified gene is sensitive to feeding by brown planthoppers.

[0018] Based on experimental results, in the process of rice breeding, overexpression OsCOMT It has strong resistance to brown planthoppers. Highly resistant plants can be quickly identified in the seedling stage, and susceptible plants can be eliminated in time. This not only saves production costs, but also improves the selection efficiency of resistant materials and shortens the breeding cycle of rice varieties. This is of great significance for insect-resistant rice breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 : OsCOMT Diagram of overexpression (A) and knockout mutant (B) material identification.

[0020] Figure 2 :Nanoplantia lugens feeding OsCOMT Honeydew detection diagram after genetic material; A is the color development diagram of honeydew secreted by brown planthopper, and B is the statistical diagram of honeydew area.

[0021] Figure 3 :Nanoplantia lugens feeding OsCOMT Statistics of insect weight after genetic material.

[0022] Figure 4 Brown planthopper OsCOMT A statistical plot of the avoidance of genetic material.

[0023] ZH11 refers to wild-type rice Zhonghua 11, COMT OE refers to OsCOMT Rice lines with gene overexpression, comt refers to OsCOMT Knockout rice lines. DETAILED DESCRIPTION

[0024] In order to make the content of the present invention easier to understand, the technical solution of the present invention is further described below in conjunction with specific embodiments, but the present invention is not limited thereto. Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial sources.

[0025] Example 1. Preparation of OsCOMT gene overexpression recombinant vector and knockout recombinant vector 1. Obtaining OsCOMT protein and its encoding gene The rice OsCOMT gene (nucleotide sequence shown in SEQ ID NO.1, amino acid sequence shown in SEQ ID NO.2) is publicly available in the Rice Genome Annotation Database (http: / / rice.plantbiology.msu.edu / ) and can be retrieved using LOC_Os08g06100. OsCOMT Design PCR primers based on the DNA sequence starting with the ATG initiation codon of the CDS sequence: OsCOMT CDS-F: 5'-ATGGGTTCTACAGCCGCCG-3', OsCOMT CDS-R: 5'-CTACTTGGTGAACTCGATGGCCCA-3'.

[0026] two, OsCOMT Cloning of the full-length sequence and obtaining of an overexpression recombinant vector containing the fragment Primers were designed based on the OsCOMT gene, and the required restriction enzyme sites were added at both ends of the primers. The primer sequence was: OsCOMT-5' Sfi I: 5'-GGCCATTACGGCCATGGGTTCTACAGCCGCCG-3', OsCOMT-3' Sfi I: 5'-GGCCGAGGCGGCCCTACTTGGTGAACTCGATGGCCCA-3'.

[0027] According to the instructions, TRIzol Reagent from Invitrogen was used to extract the medium-flowered rice 11 ( Rice sativa L.japonica Total RNA from cv. Zhonghua 11 was reverse transcribed using the company's SuperScript II reverse transcriptase to generate cDNA. The reverse transcription primer used was a 16-nucleotide Oligod (T) primer.

[0028] The cDNA obtained by reverse transcription was used as a template to perform PCR (Polymerase Chain Reaction) reaction with the above primers OsCOMT-5' Sfi I and OsCOMT-3' Sfi I to obtain a PCR product having the OsCOMT gene sequence.

[0029] After recovering the PCR product, restriction endonuclease Sfi I was used to perform enzyme digestion, and the enzyme digestion product was recovered; the vector pCambia2300 was digested with restriction endonuclease Sfi I, and the vector skeleton was recovered; the enzyme digestion product and the vector skeleton were connected with T4 ligase, and E. coli strain DH5α was transformed to obtain transformants. The plasmid of the transformants was extracted and sent for sequencing, and the plasmid with correct sequencing was the vector pCambia2300 into which the OsCOMT gene shown in SEQ ID NO. 1 in the sequence listing was inserted between the Sfi I enzyme digestion sites, and the plasmid was named pCambia2300-OsCOMT ， , which is the overexpression recombinant vector.

[0030] III. CRISPR / Cas9 OsCOMT Gene knockout recombinant vector preparation According to the website http: / / skl.scau.edu.cn / home / . According to the PAM site with a terminal sequence of NGG, the specific target sequence targeting the N-terminal of the coding region of OsCOMT is as follows: CTCGAGCAGGCCCAGCTCGA; primers are designed according to the DNA sequence of the target, and Bsa I enzyme digestion sites are added at both ends of the primers, and the primer sequences are U-F: CTCCTTTTACCTGTGGAATCG, OsCOMT-5' Bsa I-gRT1: 5'-CTCGAGCAGGCCCAGCTCGAgttttagagctagaaat-3', gRNA-R: CGGAGGAAAATTCCATCCAC, OsCOMT-3' Bsa I-OsU3T1: 5'-TCGAGCTGGGCCTGCTCGAGTgccacggatcatctgc-3'; B1': TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG, B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC; the middle vector was used as a template to perform PCR with U-F / OsCOMT-3' Bsa I-OsU3T1, OsCOMT-5' BsaI-gRT1 / gRNA-R, B1' / B2 three pairs of primers for three rounds of PCR amplification, to obtain the expression cassette with adapter [2]. After amplification, the final product was recovered by gel purification, and the final vector pYLCRISPR / Cas9 and restriction endonuclease and T4 ligase were added, and the cutting and ligation were carried out according to a certain system. The above ligation product was transformed into E. coli strain DH5α, and the colonies were coated on kanamycin-resistant medium, and the positive transformants were screened by colony PCR. The plasmids of the positive transformants and the final vector pH-Ubi-cas9-7 were extracted, and the LR enzyme in the Gateway system was used to recombine them at a ratio of 1:1, and the E. coli strain DH5α was transformed, and the transformants were coated on spectinomycin-resistant medium to obtain the transformants, and the plasmid of the transformants was sent for sequencing, and the positive transformant was the final knockout recombinant vector, named pH-Ubi-cas9-comt:sgRNA.

[0031] Example 2 OsCOMT Obtaining of gene overexpression and knockout rice materials 1) Induction culture of callus Zhonghua 11 (referred to as "ZH11") rice seeds were shelled, soaked in 70% ethanol for 10 min, and then soaked in 0.1% mercury for 30 min; the surface was sterilized. A large amount of sterile water was used to wash the solution on the surface of the seeds, and sterile filter paper was used to absorb the water on the surface of the seeds. The seeds were placed on the mature embryo callus induction medium plate, the plate edge was sealed with Parafilm film, and the culture was carried out in a 26°C incubator in the dark. After about 15 days, the callus that grew out was carefully taken out and transferred to the mature embryo subculture medium, and the culture was continued under the same conditions. Subculture was needed every two weeks. For transformation, granular callus with light yellow color that had been subcultured for about 5 days was selected.

[0032] 2) Agrobacterium culture pCambia2300-OsCOMT and pH-Ubi-cas9-comt:sgRNA were respectively electroporated into Agrobacterium EHA105 to obtain recombinant bacteria EHA105 / pCambia2300-OsCOMT and recombinant bacteria EHA105 / pH-Ubi-cas9-comt:sgRNA.

[0033] EHA105 / pCambia2300-OsCOMT and EHA105 / pH-Ubi-cas9-comt:sgRNA were respectively streaked on LB plates containing antibiotics (50 mg / L Kanamycin, 50 mg / L Rifampicin) and cultured at 28°C for 2 days. Single colonies were inoculated into liquid LB medium and cultured at 28°C with shaking until OD 600The concentration of acetosyringone was about 0.5, and acetosyringone was added to a final concentration of 100 mM to obtain an Agrobacterium suspension for transforming rice callus tissue.

[0034] 3) Co-culture of rice callus and Agrobacterium Place the subcultured callus into a sterile Erlenmeyer flask and pour the Agrobacterium suspension into the flask until it is submerged. Incubate at room temperature for 20 minutes, gently shaking the flask occasionally to ensure full contact between the callus and the bacterial suspension. Gently remove the callus with sterile tweezers, place it on sterile filter paper to absorb excess bacterial suspension, and transfer it to a co-cultivation medium plate lined with sterile filter paper. Incubate in the dark at 28°C for 3 days to obtain the co-cultivated callus.

[0035] 4) Screening and differentiation of resistant callus The co-cultivated callus tissue was washed with an appropriate amount of sterile water to remove residual Agrobacterium on the surface, placed on a screening medium, and cultured in the dark at 26°C for screening. After two weeks, it was transferred to a new screening medium and continued to be screened for two weeks. Select the callus tissue that is in better condition after two rounds of screening, transfer it to a differentiation medium plate, culture it in the dark for 3 days, and then transfer it to a light incubator (15hr / day) for light culture. Differentiated seedlings can be seen after one month. When the differentiated seedlings grow to about 2 cm, transfer them to the rooting medium in a conical flask and continue to culture for about two weeks. Select seedlings with good growth and developed root systems, wash the culture medium on the roots with tap water, and transplant them into the soil. Collect the seeds and obtain the T1 generation respectively. OsCOMT Gene overexpression rice seeds and T1 generation Axis COMT gene knockout rice seeds were sown to obtain T1 generation OsCOMT Gene overexpression in rice and Axis COMT gene knockout rice.

[0036] T1 rice seeds were initially screened with hygromycin or G418 (the pCambia2300 vector carries a G418 resistance selection gene, while the pH-Ubi-cas9-7 vector carries a hygromycin resistance selection gene). Germinated seeds indicated that the vector had been transferred into the rice plants. Germinated seeds were planted in soil and allowed to grow for two weeks. 0.1 g of leaves were then collected and ground into a powder using liquid nitrogen.

[0037] OsCOMTAdd 200 μl of protein extraction buffer (0.25 M Tris-HCl, pH 6.8, 8% SDS, 8% β-mercaptoethanol, 20% glycerol) to leaf powder of the overexpressing rice strain, incubate on ice for 10 minutes, boil at 100°C for 10 minutes, centrifuge at 12,000 rpm at 4°C for 10 minutes, collect the supernatant, perform SDS-PAGE, transfer to a membrane, and then perform Western blotting. SDS-PAGE and Western blotting were performed according to known methods and product instructions. Figure 1 As shown, two strains were selected COMT OE #1 and COMT OE #2 was used for subsequent insect resistance analysis experiments.

[0038] OsCOMT Leaf powder from the knockout rice strain was used to extract genomic DNA using the High-Efficiency Plant Genomic DNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd., Cat. No. DP350). 0.5 g of genomic DNA was then used as a template for PCR with primers COMT-F': 5'-TCTCCATCGCCGGCGAGAGAGAGAGAG-3' and COMT-R': 5'-CGCCGTCCTCGTTGGGCGTCAGCCACTTGC-3'. The PCR products were directly sequenced and then sequenced. Figure 1 As shown, two positive strains were selected and named com #1. com #2 was used for subsequent insect resistance analysis experiments.

[0039] Example 3 OsCOMT Overexpression can improve rice resistance to brown planthoppers The wild-type rice ZH11, OsCOMT Gene overexpression in rice and OsCOMTKnockout rice materials were sown simultaneously. Twenty plump seeds were sown for each material in a separate black plastic seedling box (7.2 cm diameter, 5 cm bottom diameter, 8 cm height). When the plants reached the three-leaf stage, 12 uniformly growing seedlings were retained from each row and the seedling trays were placed inside a 200-mesh screen. Second-instar brown planthopper nymphs were inoculated at a rate of 8-10 per seedling. When more than 90% of the susceptible control plants died, resistance levels were assessed based on the degree of damage to each seedling. The resistance score for each material was calculated as a weighted average. Honeydew area test: Uniformly growing four-leaf rice plants were selected and transplanted into plastic cups (9 cm diameter, 500 ml), with one seedling placed per cup. The nutrient solution was then used to cultivate the plants. The mouth of the cup is sealed with a round filter paper, and then a small hole is drilled in the center of the filter paper. The rice stem is inserted into the filter paper with a hole in the center. The cup containing the brown planthopper nymphs covers the stem, and then a similar plastic cup is turned upside down on it. Five nymphs are placed in each cup. After feeding for 48 hours, the filter paper is removed, and the number is written on the edge of the filter paper with a pencil. It is placed in an oven (constant temperature of 50°C) to dry for 20 minutes. After drying, it is taken out and evenly sprayed with 0.25% ninhydrin / ethanol solution, and placed in a 60°C oven for color development for 30 minutes. The purple part displayed on the filter paper is the area of ​​honeydew secreted by the brown planthopper. After taking a picture and scanning it, the stained area is calculated on the imageJ software. The results are as follows. Figure 2 As shown, ZH11, OsCOMT Overexpression and OsCOMT After the knockout rice plants were fed by brown planthoppers, the honeydew secreted by brown planthoppers was collected and color was developed using a 0.25% ninhydrin / ethanol solution ( Figure 2 A), calculate the honeydew area ( Figure 2 B), the results showed that compared with wild-type rice ZH11, OsCOMT Overexpressed rice showed resistance to brown planthopper. OsCOMT Knockout rice showed susceptible. At the same time, the brown planthoppers in the honeydew area test were removed and the insect weight was weighed. The results were as follows: Figure 3 As shown, compared with wild-type rice ZH11, OsCOMT Overexpression of rice materials with brown planthoppers decreased body weight and OsCOMT Increased body weight of brown planthoppers in knockout rice materials.

[0040] After culturing the three rice materials for one month, a feeding preference experiment was conducted.

[0041] The device was designed and drawn using Auto CAD 2024, and the panels were cut by Shanghai Luoyu Rubber & Plastic Products Co., Ltd. UV curing agent was used to bond and seal the device to ensure that no insects or air leaked. The device is a feeding preference test device. Rice plants after different treatments were placed in the device at intervals, and several rice planthoppers were placed in the device. The device was sealed and filmed with a camera at intervals for one day. The number of rice planthoppers feeding on different rice plants at different time periods was counted to determine whether the treated rice attracted or avoided rice planthoppers. The results are as follows: Figure 4 As shown, brown planthopper OsCOMT Overexpression rice materials have a lower feeding preference than OsCOMT Knockout rice materials.

[0042] The experiments of the present invention have shown that brown planthoppers prefer to feed on OsCOMT Knockout rice and rice with overaccumulation of OsCOMT protein have increased resistance to feeding by brown planthoppers.

[0043] The above embodiments are preferred implementations of the present invention, but the implementations of the present invention are not limited to the above embodiments. Various modifications and changes can be made to the details based on all the teachings that have been published. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. OsCOMT The use of a gene or its encoded protein in regulating rice resistance to brown planthoppers is characterized in that: described OsCOMT The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The use according to claim 1 ， The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. Use of a recombinant vector in regulating rice resistance to brown planthoppers, characterized in that: The recombinant vector contains OsCOMT Gene sequence, the OsCOMT The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. An application of an engineered bacterium in regulating rice resistance to brown planthoppers, characterized in that: The engineered bacteria contains the recombinant vector described in claim 3.

5. Use of a kit for regulating rice resistance to brown planthoppers, characterized in that: The kit contains the recombinant vector described in claim 3 or the engineered bacteria described in claim 4.

6. The use according to any one of claims 1 to 5, characterized in that: The regulation includes overexpression OsCOMT Genes that make rice more resistant to brown planthoppers, or by knocking them out OsCOMT Genes make rice less resistant to brown planthoppers.

7. A method for regulating rice resistance to brown planthoppers, characterized in that: When it is necessary to reduce the resistance of rice to brown planthoppers, OsCOMT Gene knockout; when it is necessary to improve the resistance of rice to brown planthoppers, OsCOMT Gene overexpression; OsCOMT The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

8. OsCOMT The application of the gene in rice breeding is characterized by: The rice breeding includes overexpression OsCOMT Genetic acquisition of rice lines resistant to brown planthoppers, and knockout of OsCOMT A rice line genetically acquired to be susceptible to brown planthopper; OsCOMT The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

9. A method for cultivating brown planthopper-resistant rice, characterized in that: Build OsCOMT The gene overexpression vector is transferred into rice to cultivate rice; OsCOMT The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

10. A method for screening rice resistant to brown planthopper, characterized in that: Detection of rice OsCOMT The expression level of the gene OsCOMT The expression level of the gene is positively correlated with the resistance to rice brown planthopper. OsCOMT The nucleotide sequence of the gene is shown in SEQ ID NO.1.

Images