Gene FTR100 related to interferon antiviral immune response of prussian carp and application of gene FTR100
By knocking out the FTR100 gene of silver crucian carp through CRISPR/Cas9 gene editing technology, silver crucian carp with high resistance to crucian herpes virus was bred, which solved the problem of antiviral immune regulation of silver crucian carp and achieved the goal of efficient antiviral breeding and green farming.
Patent Information
- Application Number
- CN202510744610.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-05
- Publication Date
- 2025-10-10
AI Technical Summary
Existing technologies make it difficult to effectively regulate antiviral immune responses in silver crucian carp, resulting in frequent occurrences of acute gill hemorrhage caused by crucian carp herpes virus. Traditional chemical control methods bring drug residues and ecological pollution, making it difficult to meet the needs of green and healthy breeding.
Through CRISPR/Cas9 gene editing technology, the FTR100 gene of silver crucian carp was specifically knocked out, and a mutant genotype individual in which all three alleles of FTR100 were terminated prematurely was obtained. The mutant genotype was transferred using female nuclear reproduction technology to breed silver crucian carp with high resistance to crucian herpes virus.
The ability of silver crucian carp to resist crucian herpes virus was significantly improved, the survival rate increased by 100%, the risk of genetic contamination was avoided, and efficient antiviral breeding was achieved.
Smart Images

Figure CN120758528A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of fish genetic breeding, and particularly relates to a FTR100 gene related to interferon antiviral immune response of Carassius gibelio and application thereof. BACKGROUND
[0002] Carassius gibelio has the advantages of delicious meat, rapid growth and convenient management. However, with the popularization of intensive and large-scale breeding mode, the disease problem is becoming increasingly serious, and the disease occurrence frequency of Carassius gibelio is significantly improved. In particular, the acute gill hemorrhage disease of Carassius auratus caused by Carassius auratus herpesvirus (CaHV) is the most.
[0003] The acute gill hemorrhage disease of Carassius auratus caused by Carassius auratus herpesvirus has the characteristics of fast transmission speed and high mortality, which has caused large-scale death of Carassius auratus and serious economic losses to the Carassius auratus breeding industry. Traditional disease control relies on chemical drugs and antibiotics, but long-term use can easily cause drug residues, pathogen resistance and water ecological pollution, which is difficult to meet the demand of green and healthy breeding. Therefore, it is of great significance to cultivate high-quality germplasm with disease resistance for the development of Carassius gibelio industry.
[0004] Natural immunity plays an important role in resisting pathogen infection and is the first line of defense against pathogen infection. It plays a key role in the early stage of virus invasion. The natural immune system can quickly recognize pathogen-associated molecular patterns, activate a series of signal pathways, and induce the expression of antiviral factors such as interferon (IFN), thereby inhibiting the replication and spread of viruses. Finding and identifying key genes that can effectively regulate immune response has important value for cultivating new varieties of Carassius gibelio resistant to Carassius auratus herpesvirus.
[0005] The genes involved in fish natural immune response reported so far include HERC family, TRIM protein family and the like. For example, Li et al. reported that Carassius auratus HERC7 plays a negative regulatory function in antiviral immune response (The Journal of Immunology 2022, 208:1189-1203), Qu et al. reported that tetraploid Carassius auratus FTRCA1 gene negatively regulates the interferon antiviral response of tetraploid Carassius auratus (The Journal of Immunology 2022, 209:1335-1347), and Kuang Ming et al. reported the role of FTR56 gene in regulating the immune response of zebrafish (Acta Hydrobiologica Sinica, 2020, 44(01):20-25.). However, most of these reported genes are host-specific genes, and the genes belonging to the same family also have functional differentiation, which are difficult to be directly applied to Carassius gibelio.
[0006] Therefore, analyzing the antiviral immune mechanism of silver crucian carp, finding potential immune function regulatory factors of silver crucian carp, developing effective gene knockout targets, and breeding new silver crucian carp varieties with higher disease resistance are technical issues that need to be solved at present. Summary of the Invention
[0007] In order to solve the problems existing in the prior art, one of the objectives of the present invention is to provide a gene related to the antiviral immune response of gibel carp interferon, the gene is FTR100, and the CDS sequence is shown in SEQ ID NO:1.
[0008] The second purpose of the present invention is to provide an application of the FTR100 gene as described above in regulating the antiviral ability of gibel crucian carp.
[0009] The third object of the present invention is to provide a method for improving the ability of silver crucian carp to resist herpes virus based on the FTR100 gene editing as described above. The CRISPR / Cas9 gene editing technology is used to specifically knock out the silver crucian carp FTR100 gene to obtain a mutant genotype individual in which all three alleles of FTR100 are terminated prematurely, that is, a silver crucian carp with high resistance to herpes virus; the FTR100 gene has three specific knockout target sites, and the sequences are shown in SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5.
[0010] Furthermore, the specific method for specifically knocking out the FTR100 gene of silver crucian carp is to inject a mixture of sgRNA and Cas9 protein containing the FTR100 specific knockout target site into the fertilized eggs of silver crucian carp to obtain F0 generation chimeras, and then raise the F0 generation silver crucian carp to sexual maturity and obtain the F1 generation through female reproduction, and screen the F1 generation for mutant genotype individuals in which all three FTR100 alleles are terminated prematurely, which are silver crucian carp with high resistance to crucian herpes virus.
[0011] Further, the following steps are included:
[0012] S1. Obtain FTR100-sgRNA1, FTR100-sgRNA2, and FTR100-sgRNA3 at a concentration of 300 ng / μL for specific knockout of the FTR100 target site and set aside.
[0013] S2. Mix 1.5 μL of each of FTR100-sgRNA1, FTR100-sgRNA2, and FTR100-sgRNA3 with 0.5 μL of 10× Cas9 protein. Inject the resulting mixture into fertilized eggs at a volume of 1-2 nL per fertilized egg.
[0014] S3. After the injection is completed, the fertilized eggs are hatched to obtain F0 generation chimeras, and the F0 generation is raised to sexual maturity and then undergoes gynogenesis to obtain the F1 generation;
[0015] S4. Select individuals with a mutant genotype in which all three alleles of FTR100 are terminated prematurely in the F1 generation, which are gibel crucian carp with high resistance to crucian herpes virus.
[0016] Furthermore, it also includes a breeding step, in which the mutant genotype silver crucian carp in which the three alleles of FTR100 are terminated prematurely in the F1 generation is reproduced again by gynogenesis to obtain the F2 generation, and the F2 generation are all silver crucian carp with high resistance to crucian herpes virus.
[0017] Furthermore, the fertilized eggs are obtained by mixed fertilization of silver crucian carp eggs and Xingguo red common carp sperm.
[0018] Furthermore, the specific operation of the female nuclear reproduction of the F1 generation is to mix the mature eggs of the silver crucian carp with the sperm of the male Xingguo red carp for fertilization and hatching to produce all-female offspring of the silver crucian carp.
[0019] Furthermore, the method for selecting the mutant genotype silver crucian carp in which all three alleles of FTR100 terminate prematurely in the F1 generation is as follows: extract the genomic DNA of the F1 generation fin rays separately, perform PCR amplification using detection primers, transform the amplified products into competent Escherichia coli, select positive monoclonal clones for sequencing, analyze the sequencing results, and select the mutant silver crucian carp whose sequencing read fragment length is 302bp shorter than that of the wild-type silver crucian carp.
[0020] Furthermore, the upstream primer sequence of the detection primer is shown as SEQ ID NO: 6, and the downstream primer sequence is shown as SEQ ID NO: 7.
[0021] The beneficial effects of the present invention are:
[0022] 1) The TRIM protein family (Tripartite motif-containing proteins) is an important protein family widely present in the animal kingdom and belongs to the RING-type E3 ubiquitin ligase. This family of proteins is involved in a variety of key biological processes, including protein degradation, antiviral immunity, cell proliferation, differentiation, transcriptional regulation, etc. There is also a unique subfamily in bony fish, called finTRIM. This application is the first to clarify the function of the FTR100 gene in the finTRIM family of silver carp. This application found that the FTR100 gene can negatively regulate the antiviral immune response of silver carp.
[0023] 2) By knocking out the FTR100 gene, a highly resistant crucian carp strain was successfully generated. Experiments confirmed that the FTR100 knockout strain significantly improved the ability of gibel crucian carp to resist CaHV infection, with a survival rate increased by 100%, exceeding the previously reported disease-resistant strains.
[0024] 3) The present invention rapidly obtains a new crucian carp germplasm with resistance to crucian herpes virus by knocking out a single gene. This method does not require the introduction of exogenous genes, thus avoiding the risk of gene contamination. It is a qualitative leap in fish antiviral breeding and has very important industrial value. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 Schematic diagram of the design of three target sites of the FTR100 gene.
[0026] Figure 2 This is the sequencing result of the homozygous FTR100 gene deletion silver carp.
[0027] Figure 3 The wild type gibel carp (FTR100) infected with CaHV virus + / + / + ) and silver carp (FTR100 - / - / - ) of the overall disease situation, of which the left side is the silver carp (FTR100 - / - / - ), the middle and right sides are wild-type gibel carp (FTR100 + / + / + ).
[0028] Figure 4 The wild type gibel carp (FTR100) infected with CaHV virus + / + / + ) and silver carp (FTR100 - / - / - )’s survival rate curve;
[0029] Figure 5 The wild type gibel carp (FTR100) infected with CaHV virus + / + / + ) and silver carp (FTR100 - / - / - ) qPCR analysis of viral genes CaHV-GP, CaHV-MCP and important antiviral response-related genes MxA and IFN in the spleen at 0, 2 dpi, 3 dpi, 4 dpi, 5 dpi and 6 dpi.
[0030] Figure 6 The wild type gibel carp (FTR100) infected with CaHV virus + / + / + ) and silver carp (FTR100 - / - / - ) qPCR analysis of viral genes CaHV-GP, CaHV-MCP and important genes MxA and IFN related to antiviral response in head kidney tissues at 0, 2 dpi, 3 dpi, 4 dpi, 5 dpi and 6 dpi. DETAILED DESCRIPTION
[0031] To facilitate understanding, the technical solution of the present invention is described in more detail below with reference to experiments.
[0032] 1. Target design of silver carp FTR100
[0033] The CDS sequence of the gibel carp FTR100 gene is shown in SEQ ID NO. 1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO. 2. Based on the complete sequence of the gibel carp FTR100 gene (gene ID: 127953778), genome-wide alignment did not find an FTR100 homologous gene located on chromosome A3. Therefore, three FTR100-specific knockout sites were designed based on chromosome B3.
[0034] like Figure 1 As shown, the target sites correspond to 66-86 bp (5'-GATCCAGTGACGATTCCCTG-3', SEQ ID NO: 3), 104-124 bp (5'-GTGGAGCGGTTTAAAAACAC-3', SEQ ID NO: 4) and 228-248 bp (5'-AAGATGTGTCCAGAAAGTG-3',
[0035] SEQ ID NO: 5), corresponding to amino acid positions 22-29, 35-42, and 76-83 of the protein sequence.
[0036] 2. Synthesize sgRNA
[0037] The amplification primers are:
[0038] sgRNA1-F: GTAATACGACTCACTATAGATCCAGTGACGATTCCCTGGTTTTAGAGCTAGAAATAGC;
[0039] sgRNA2-F: GTAATACGACTCACTATAGTGGAGCGGTTTAAAAACACGTTTTAGAGCTAGAAATAGC;
[0040] sgRNA3-F: GTAATACGACTCACTATAGAAGATGTGTCCAGAAAGTGGTTTTAGAGCTAGAAATAGC;
[0041] sgRNA-R: AAAAGCACCGACTCGGTGCC.
[0042] Using the pUC19-gRNA plasmid as a template, PCR amplification was performed using the above primers. The reaction system (50 μL) is shown in Table 1.
[0043] Table 1 PCR amplification system
[0044]
[0045] The reaction procedure is shown in Table 2:
[0046] Table 2 PCR reaction procedure
[0047]
[0048] After amplification, the PCR product was purified and recovered using a commercial gel recovery kit and eluted into a 1.5 mL RNase-free tube.
[0049] Purified DNA templates were in vitro transcribed into sgRNA using the TranscriptAid T7 High Yield Transcription Kit (ThermoFish Scientific) according to the manufacturer's instructions. Following in vitro transcription, the DNA template was removed by DNase treatment and purified by lithium chloride precipitation to ensure high RNA quality and integrity. RNA quality was assessed by agarose gel electrophoresis, and RNA concentration was determined using a NanoDrop 2000. Aliquots were stored at −80°C until use.
[0050] 3. Fertilized egg microinjection
[0051] Mix 1.5 μl FTR100-sgRNA1 (1000-1500 ng / μL), 1.5 μl FTR100-sgRNA2 (1000-1500 ng / μL), 1.5 μl FTR100-sgRNA3 (1000-1500 ng / μL) and 0.5 μL 10×Cas9 protein on ice, centrifuge at 10,000 g for 2 min at 4°C, and transfer the supernatant to a new PCR tube to prevent precipitated impurities from affecting microinjection.
[0052] Silver crucian carp eggs were spread flat in a 10 cm sterile Petri dish. Using a glass capillary, the eggs were gently moved, with the animal pole facing upward. Using a microinjector, 2 nL of the injection mixture was injected into the animal pole of the single-cell stage eggs. Uninjected eggs were kept as a control group. Semen from Xingguo red carp was added dropwise to the injected eggs. An appropriate amount of pond water was added and gently agitated for 30 seconds to 1 minute to ensure adequate fertilization. After fertilization, the eggs were transferred to an incubation tank at 22-23°C for incubation.
[0053] 4. Target mutation efficiency detection
[0054] Ten injected fry and control fry were taken respectively, and DNA templates were prepared by alkaline lysis method: 100 μL NaOH was added, heated at 95°C for 30 min, and stored at 4°C.
[0055] Specific detection primers were designed for the FTR100 target site, and the fragment size was 817 bp.
[0056] FTR100-F: 5'-GCACTCACTTGCTCGGTATGG-3' (SEQ ID NO: 6);
[0057] FTR100-R: 5'-TGTCCGCTCCTGTGTCCATG-3' (SEQ ID NO: 7);
[0058] PCR amplification was performed using the above primers, and the product was sent to a sequencing company for sequencing. Sequencing results revealed overlapping peaks in the sequencing peaks of the injected fry, while the sequencing peaks of the control fry showed a single peak in the upstream and downstream regions of the target, preliminarily confirming that the target knockout was effective. The purified PCR product was then ligated into the pMD-18T vector and transformed into Escherichia coli. Ten positive single clones were selected for sequencing to obtain mutant sequences. Comparison of the mutant sequences with the wild-type sequence revealed a reduction of 302 bp in the mutant sequence, ultimately confirming a 100% target site mutation efficiency after injection.
[0059] Screening of 5 homozygous target site mutations in silver crucian carp
[0060] After the F0 generation silver crucian carp fry grew to 1-2 cm, the tail fin tissue was cut for genotyping analysis. The F0 generation genotype was detected using the same method as in Example 4, and the -302bp mutant silver crucian carp was selected. The female nuclear reproduction technology was used and the sperm of Xingguo red carp (Cyprinus carpio) was used for fertilization to ensure that the offspring only inherited the maternal genome to stabilize the mutant trait. The fertilized eggs were transferred to an incubation tank with a water temperature of 22-23°C for static water incubation, and finally the homozygous FTR100 gene-deficient silver crucian carp was obtained. The results are as follows: Figure 2 shown.
[0061] Effects of 6FTR100 gene deletion on the resistance of silver crucian carp to herpes virus
[0062] FTR100 homozygous F1 generation of silver crucian carp (FTR100) - / - / - ) and wild-type gibel carp (FTR100 + / + / + ) were temporarily housed in a 70.5 cm × 48 cm × 38 cm aquarium in the laboratory. The water temperature was gradually adjusted to 22°C (±1°C). For one week, the aquarium water was maintained at a constant temperature and with adequate oxygen to prevent stress reactions. The fish were observed to ensure they were healthy and free of CaHV infection. Feeding was stopped 24 hours before infection.
[0063] Fish weighing approximately 6g were selected for the experiment. Before injection, 6μL of the virus suspension was injected intraperitoneally at a ratio of 1g CaHV virus to 1μL of body weight. After infection, the water temperature was maintained at 22°C (±1°C). The water was continuously filtered to maintain cleanliness.
[0064] The silver crucian carp (FTR100) infected with CaHV virus - / - / - ) and wild-type gibel carp (FTR100 + / + / + ) were placed on the same bottom plate, and the fish body was photographed with a special camera for the experiment. The results are as follows Figure 3 As shown, wild-type crucian carp (FTR100) infected with CaHV + / + / + ) body surface has serious pathological changes, with local congestion, especially in the gill cover, abdomen, dorsal fin base and caudal fin, congestion around the eyes and protrusion of the eyeballs. - / - / - ) are in good condition and have obvious disease-resistant phenotype.
[0065] The survival of the experimental fish was recorded, and the mortality of the experimental fish was observed every day until 10 dpi (10 days after infection). Kaplan-Meier survival curve analysis was used to compare FTR100. - / - / - Survival of silver crucian carp and wild type silver crucian carp after CaHV infection. Figure 4 The results showed that wild-type gibel carp (FTR100 + / + / + ) began to die on 4 dpi, and the survival rate dropped to 0% on 7 dpi. - / - / - ) did not die, and the survival rate was still 100% at 30dpi. - / - / - ) increased by 100% compared with the wild type.
[0066] Spleen and head kidney tissue samples were collected from experimental fish at 0, 2, 3, 4, 5, and 6 dpi. These samples were immediately snap-frozen in RNA protection solution and stored at -80°C until further use. Total RNA from the tissues was extracted using an RNA extraction kit (AG). 1.5 μg of RNA was reverse-transcribed into cDNA using a Hifair III reverse transcription kit (YESEN). After reverse transcription, qPCR was performed using SYBR Green.
[0067] The qPCR detection primer sequences are shown in Table 3:
[0068] Table 3 qPCR detection primer sequences
[0069]
[0070]
[0071] The reaction procedure is shown in Table 4:
[0072] Table 4 qPCR reaction procedure
[0073]
[0074] Spleen results are shown in Figure 5 , head kidney results see Figure 6 , it can be seen that silver carp (FTR100 - / - / - Compared to the WT group, after CaHV infection, the expression levels of MxA and IFN in all three tissues were lower, and the copy numbers of the viral genes CaHV-GP and CaHV-MCP were also lower. This suggests that FTR100 deficiency can significantly inhibit viral gene replication, reduce inflammatory damage, and reduce the body's antiviral stress response.
[0075] The above results show that knocking out the FTR100 gene successfully obtained crucian carp with high antiviral ability, and the survival rate was increased by 100% compared with the wild type.
[0076] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A gene related to the antiviral immune response of gibel carp interferon, the gene is FTR100, and the CDS sequence is shown in SEQ ID NO:
1.
2. Use of the FTR100 gene as claimed in claim 1 in regulating the antiviral ability of silver crucian carp.
3. The method for improving the ability of silver crucian carp to resist herpes virus based on the FTR100 gene editing as claimed in claim 1, characterized in that: Using CRISPR / Cas9 gene editing technology, the FTR100 gene of silver crucian carp was specifically knocked out, and a mutant genotype individual in which all three alleles of FTR100 were terminated prematurely was obtained, that is, silver crucian carp with high resistance to crucian herpes virus; the FTR100 gene has three specific knockout target sites, and the sequences are shown in SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:
5.
4. The method according to claim 3, characterized in that The specific method for specifically knocking out the FTR100 gene of silver crucian carp is to inject a mixture of sgRNA and Cas9 protein containing the FTR100 specific knockout target site into the fertilized eggs of silver crucian carp to obtain F0 generation chimeras, and then raise the F0 generation silver crucian carp to sexual maturity and obtain the F1 generation through female reproduction. The mutant genotype individuals in which all three FTR100 alleles are terminated prematurely in the F1 generation are screened, which are silver crucian carp with high resistance to crucian herpes virus.
5. The method according to claim 4, characterized in that The following steps are involved: S1. Obtain FTR100-sgRNA1, FTR100-sgRNA2, and FTR100-sgRNA3 at a concentration of 300 ng / μL for specific knockout of the FTR100 target site and set aside. S2. Mix 1.5 μL of each of FTR100-sgRNA1, FTR100-sgRNA2, and FTR100-sgRNA3 with 0.5 μL of 10× Cas9 protein. Inject the resulting mixture into fertilized eggs at a volume of 1-2 nL per fertilized egg. S3. After the injection is completed, the fertilized eggs are hatched to obtain F0 generation chimeras, and the F0 generation is raised to sexual maturity and then undergoes gynogenesis to obtain the F1 generation; S4. Select individuals with a mutant genotype in which all three alleles of FTR100 terminate prematurely in the F1 generation, which are gibel crucian carp with high resistance to crucian herpes virus.
6. The method according to claim 5, characterized in that It also includes a propagation step, in which the mutant genotype silver crucian carp in which all three FTR100 alleles are terminated prematurely in the F1 generation is used again through female nuclear reproduction to obtain the F2 generation, and all the F2 generations are silver crucian carp with high resistance to crucian herpes virus.
7. The method according to claim 5, characterized in that The fertilized eggs are obtained by mixed fertilization of silver crucian carp eggs and Xingguo red carp sperm.
8. The method according to claim 5, wherein The specific operation of female reproduction of the F1 generation is to mix the mature eggs of silver crucian carp with the sperm of male Xingguo red carp for fertilization and hatching to produce all-female offspring of silver crucian carp.
9. The method according to claim 5, wherein: The method for selecting the mutant genotype silver crucian carp in which all three alleles of FTR100 are terminated prematurely in the F1 generation is as follows: extract the fin genomic DNA of the F1 generation separately, use detection primers for PCR amplification, transform the amplified products into competent Escherichia coli, select positive monoclonal clones for sequencing, analyze the sequencing results, and select the mutant silver crucian carp whose sequencing read fragment length is 302bp shorter than that of the wild-type silver crucian carp.
10. The method according to claim 9, wherein The upstream primer sequence of the detection primer is shown in SEQ ID NO: 6, and the downstream primer sequence is shown in SEQ ID NO: 7.