Recombinant plasmid, construction method and application of recombinant plasmid in improving synthesis capability of nostoc flagelliforme pseudocladosporin

Abstract

The invention relates to the technical field of gene engineering, in particular to a recombinant plasmid, a construction method and application of the recombinant plasmid to improvement of the synthesis capacity of nostoc flagelliforme pseudocladodin. The recombinant plasmid comprises a vector plasmid, and an sgRNA target sequence, an HR homologous sequence, a psbA promoter sequence and an ScyR regulator gene which are connected to the vector plasmid. The recombinant plasmid can over-express the key regulator gene at the MAAs gene cluster site of the nostoc flagelliforme, so that the pseudocladostin synthesis capability of the nostoc flagelliforme is remarkably improved. The recombinant plasmid is transformed into nostoc flagelliforme to obtain a nostoc flagelliforme mutant, and after the nostoc flagelliforme mutant is cultured for 15 days, the content of cladosporin is 2.4 times that of wild nostoc flagelliforme.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to a recombinant plasmid, a construction method and an application thereof in improving the synthetic ability of pseudocladonia solani in Nostoc flagelliformis. Background Art

[0002] Scytonemin, a fat-soluble aromatic alkaloid pigment, exhibits significant potential in the cosmetic and pharmaceutical industries due to its exceptional UV absorption and antioxidant properties. In the cosmetic and daily chemical sector, its highly effective photoprotective properties as a natural sunscreen active ingredient have garnered significant attention in the dermatology and cosmetics industries. In medicine, its significant anti-inflammatory and anti-proliferative properties highlight its potential as a new small molecule drug. Furthermore, scytonemin possesses significant ecological significance for cyanobacteria. Its complex with iron promotes the survival of cyanobacterial communities in sandstone environments, making it a key factor in their adaptation to natural environments.

[0003] Currently, the synthesis of pseudocladosapin can be divided into two main categories: chemical synthesis and biosynthesis. In the chemical synthesis approach, based on the chemical structure and properties of pseudocladosapin, studies have used 3-indoleacetic acid as a starting material and synthesized pseudocladosapin through a nine-step chemical reaction process, including Heck carbocyclization and Suzuki-Miyaura cross-coupling. While this synthetic route offers high flexibility and is suitable for the preparation of a variety of pseudocladosapin derivatives, it also has significant disadvantages, including numerous reaction steps, low conversion rates (only 4%), and high costs. In contrast, biosynthesis offers significant advantages and enormous potential.

[0004] The biosynthetic gene cluster of pseudocladactylin ( Npun_R1276–R1259 ) for the first time in the natural host cyanobacteria Nostoc punctiform PCC 73102 was completely characterized (Soule et al., J Bacteriol, 2007). Nostoc flagelliforme The biosynthesis of pseudocladactin was also identified in Sky Gene cluster ( COO91_00773–00791 ) and its two regulator genes ( COO91_00772–00771 ) (Gao et al., MarDrugs, 2021). Currently, Nostoc flagelliforme Cell suspension culture technology has been successfully developed and can be cultivated on a large scale under laboratory or industrial conditions. It has been reported that the synthesis of pseudocladonia in this cell suspension culture can be effectively induced by ultraviolet UV-B treatment.

[0005] However, although important progress has been made in the study of the biosynthesis pathway and regulatory mechanism of pseudocladactyls, the natural host cyanobacteria Nostoc punctiforme PCC 73102 and cyanobacteria Nostoc flagelliforme As a non-model algae strain, it presents significant technical difficulties in genetic modification and engineering applications, and stable, efficient, and green production of pseudocladoxine remains elusive. Researchers have selected Escherichia coli, the most widely used bacterium in industrial fermentation, as the base cell for pseudocladoxine biosynthesis. However, engineered E. coli strains carrying pseudocladoxine biosynthesis genes can only successfully synthesize pseudocladoxine monomers, but not the final pseudocladoxine dimer.

[0006] In view of this, this invention is proposed. Summary of the Invention

[0007] Based on the above problems, the present invention aims to provide a recombinant plasmid, a construction method and its use in improving the biosynthesis of pseudocladonia in Nostoc. The recombinant plasmid can significantly improve the biosynthesis of pseudocladonia in Nostoc when transformed into Nostoc.

[0008] In order to achieve the above object, the first technical solution adopted by the present invention is: A recombinant plasmid, characterized in that it comprises a vector plasmid, and an sgRNA target sequence, an HR homologous sequence, a psbA promoter sequence and a ScyR Regulator gene.

[0009] Furthermore, the sgRNA target sequence is Nostoc MAAS The mycosporin-like amino acid gene cluster recognition sequence consists of the sequence (20-24 bp) following the PAM site (a short structured sequence located at the end of the target DNA in the CRISPR-Cas system), with 22 bp typically selected. The nucleotide sequence of the sgRNA target sequence described in the present invention is shown in SEQ ID NO. 1.

[0010] Furthermore, the HR homologous sequence is Nostoc MAAS The homologous sequences at both ends of the gene cluster, including the upstream homologous arm and the downstream homologous arm, have nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0011] Furthermore, the psbA promoter sequence is an endogenous promoter sequence from Nostoc flagelliformis, and the nucleotide sequence is shown in SEQ ID NO.4.

[0012] Furthermore, the ScyR The regulator gene is COO91_00771 The nucleotide sequence of the gene is shown in SEQ ID NO.5, and the amino acid sequence is shown in SEQ ID NO.6.

[0013] Further, the vector plasmid is pCpf1b-sp.

[0014] The second technical solution adopted by the application is: A construction method of a recombinant plasmid, comprising the following steps: The sgRNA target sequence and the HR homologous sequence are sequentially connected to the vector plasmid to obtain an intermediate vector; The psbA promoter sequence and ScyR The regulator gene is fused and then connected to the intermediate vector.

[0015] In the specific construction process, the HR homologous sequence is amplified by taking the Zosterae genome DNA as a template, the sgRNA target sequence and the amplified HR homologous sequence are connected to the vector plasmid by using a ready-to-use seamless cloning technology, the psbA promoter sequence and ScyR The regulator gene is respectively amplified by taking the Zosterae genome DNA as a template and then fused, and then connected to the intermediate vector by using a ready-to-use seamless cloning technology.

[0016] The third technical solution adopted by the application is: The application of the above-mentioned recombinant plasmid or the recombinant plasmid constructed according to the construction method of the above-mentioned recombinant plasmid in improving the Zosterae pseudobranch algae synthesis capacity.

[0017] Further, the recombinant plasmid is transformed into wild-type Zosterae, and the Zosterae MAAS The gene cluster site is overexpressed ScyR The regulator gene is overexpressed to improve the Zosterae pseudobranch algae synthesis capacity.

[0018] The method for transforming the recombinant plasmid into Zosterae comprises: The recombinant plasmid is transformed into HB101 competent cells by using a heat shock method to obtain a recombinant strain; The recombinant strain is mixed with Zosterae cells and then cultured to obtain transformants; The transformants are selected and continuously streaked and cultured, and the Zosterae mutants are obtained through multiple rounds of resistance screening.

[0019] The fourth technical solution adopted by the application is: A Zosterae mutant, wherein the above-mentioned recombinant plasmid or the recombinant plasmid constructed according to the construction method of the above-mentioned recombinant plasmid is transformed into Zosterae.

[0020] The Zosterae mutant is cultured in a suitable environment, and compared with wild-type Zosterae, the yield of pseudobranch algae biosynthesis is significantly improved. The suitable culture environment is: a culture temperature of 24-26 ℃, a light intensity of 30-50 µmol photons m -2 s -1, the rotation speed of the shaker is 100-150 rpm, and low-intensity UV irradiation is used for 1-3 hours every day during the culture period.

[0021] Compared with the prior art, the present application has the following beneficial effects: The present application first clones the MAAS gene cluster recognition sequence and the homologous sequence at both ends thereof, and recombines the same in a pCpf1b vector to obtain an intermediate vector, first clones a psbA promoter sequence and ScyR regulator gene sequence, and recombines the same in the above intermediate vector to obtain a recombinant plasmid, which can overexpress a key regulator gene at the site of the MAAS gene cluster, and can significantly improve the pseudophilin synthesis capacity of the

[0022] The present application successfully clones the recombinant plasmid, and constructs a BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 FIG. 1 is a structural schematic diagram of the recombinant vector of Example 1; Figure 2 FIG. 2 is a PCR identification result diagram in the construction process of the recombinant vector of Example 1; Figure 3 FIG. 3 is a picture of activated transformants of Example 3; Figure 4 FIG. 4 is a PCR identification result diagram of the Figure 5-9 FIG. 5 is a determination result of the biomass, relative activity, pseudophilin content, chlorophyll content and carotenoid content of the a mutant and wild type of Example 3 during the culture period. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical scheme and advantages of the present application more clear, the scheme of the present application will be further described in detail below in combination with examples. Those skilled in the art will understand that the following examples are only exemplary and are not intended to limit the scope of the present application. In addition, in the following description, the specific conditions in the examples are not specified, and the conventional conditions or the conditions recommended by the manufacturer are used. The reagents or instruments used are not specified by the manufacturer, and are conventional products that can be purchased on the market.

[0025] The preparation method of the culture medium used in the examples of the present application is as follows: LB liquid medium: Take 16 g of LB powder and add deionized water to 800 mL. Stir or shake thoroughly until the powder is completely dissolved. Sterilize at 121°C for 20 min, cool to room temperature, and store at 4°C until use.

[0026] LB solid medium: Take 16 g LB powder and 14.4 g agar powder, add deionized water to 800 mL, stir or shake thoroughly until the powder is completely dissolved, sterilize at 121°C for 20 min, cool to room temperature, and store at 4°C until used.

[0027] BG11 liquid medium: Prepare mother solutions 1-6 according to the ingredients and amounts described in Table 1. Add 800 μL of mother solutions 1, 2, 3, 4, 5, and 6 to 700 mL of deionized water, followed by 8 mL of 154 g L-1 -1 Sodium nitrate solution, add water to make up to 800 mL, and o Sterilize at 4°C for 20 min, cool and store at 4°C for later use.

[0028] BG11 solid medium: Prepare mother solutions 1-6 according to the ingredients and amounts described in Table 1. Add 800 μL of mother solutions 1, 2, 3, 4, 5, and 6 to 700 mL of deionized water, followed by 8 mL of 154 g L-1 -1 Sodium nitrate solution and 8 g agar powder, add water to make up to 800 mL, and o Sterilize at 4°C for 20 min, cool and store at 4°C for later use.

[0029] Table 1 Composition and dosage of mother liquor 1-6 .

[0030] Example 1 Construction of recombinant plasmid pCpf1b-PAM-HR-psbA- ScyR (1) Clone the target sequence into the vector plasmid The sequence after the PAM site (22 bp) was selected to form the gene editing sgRNA target sequence, and its sequence information is shown in SEQ ID NO.1. MAAS -sgRNA-F, MAAS -sgRNA-R was fused to obtain the target sequence fusion fragment. The primer information is as follows: MAAS -sgRNA-F: AGATGGCACTCTTGTATTACTAGCGA; MAAS-sgRNA-R:AGACTCGCTAGTAATACAAGAGTGCC.

[0031] Take 5 μL each MAAS -sgRNA-F and MAAS -sgRNA-R primers were used for fusion, and the fusion procedure is shown in Table 2.

[0032] Table 2 sgRNA target sequence primer fusion program .

[0033] use Aar The pCpf1b-sp vector plasmid was digested with restriction enzyme I. The digestion system is shown in Table 3. The digestion conditions were: incubation at 37°C for 10 hours, followed by incubation at 65°C for 20 minutes. Gel electrophoresis was used to verify the digestion, and the digested vector was purified using a gel recovery kit (Qingke Biotechnology).

[0034] Table 3 pCpf1-sp vector plasmid enzyme digestion system .

[0035] The digested vector plasmid and the target sequence fusion fragment were ligated using T4 DNA ligase to obtain a target sequence-containing vector. The ligation system is shown in Table 4, and the ligation conditions were: ligation at 25°C for 1.5 h.

[0036] Table 4 T4 DNA ligase ligation system .

[0037] The ligation product was transformed into DH5α competent cells using the heat shock transformation method. Specifically, 10 μL of ligation product was added to 80 μL of DH5α competent cells, placed on ice for 10 min, then incubated in a water bath at 42°C for 60 s, followed by an ice bath for 2 min, and then 800 μL of LB liquid medium was added. The cells were shaken at 37°C and 120 rpm for 1 h, and then spread onto a plate containing 175 μg mL -1 Spectinomycin (Spe), 50 mg mL -1 Isopropyl-β-D-thiogalactopyranoside (IPTG), 20 mg mL -1 After overnight incubation at 37°C on LB solid medium containing the chromogenic substrate for β-galactosidase (X-Gal), single colonies (white spots) were selected for colony PCR identification. Positive strains were expanded and plasmids were extracted using a plasmid extraction kit (Tiangen Biochemical) and sent to the company for sequencing. Correctly sequenced plasmids were identified as the target sequence-containing vectors. The colony PCR system is shown in Table 5, and the reaction procedure is shown in Table 6.

[0038] Table 5 Colony PCR system .

[0039] Table 6 Colony PCR reaction program .

[0040] (2) Cloning of HR homologous sequence to the target sequence containing vector The HR homologous sequence is the hair-like algae MAAS The homologous sequences at both ends of the gene cluster include the upstream homologous arm and the downstream homologous arm, and the sequence information is shown in SEQ ID NO. 2 and SEQ ID NO. 3. The hair-like algae genomic DNA was extracted by plant genome extraction reagent, and then the upstream and downstream homologous arms were amplified by PCR using the hair-like algae genome as a template. The size of the PCR product band was detected by gel electrophoresis, and the amplified fragments were purified and recovered by using a gel recovery kit (Qingke Biology). The PCR reaction system of the upstream and downstream homologous arms is shown in Table 7, and the PCR reaction program is shown in Table 6. The primer information in the reaction system is as follows: The upstream homologous arm amplification primer is: MAAS -UP-F: CGATATCTAGATCTCATGGAGTTACCGAGGTAGGTATG; MAAS -UP-R: GTGAGATTTCGGTAATAATTCC; The downstream homologous arm amplification primer is: MAAS -DW-F: ATTACCGAAATCTCACCCCGGGTACCAATCCACATTCTA AAGCC; MAAS -DW-R: AACGTTGTTGCCATTGCGGAAGTGGTGAGTATGCTCAA TG.

[0041] Table 7 PCR reaction system of upstream and downstream homologous arms .

[0042] Using BamH I restriction endonuclease to cut the target sequence containing vector, the enzyme cutting system is shown in Table 8, the enzyme cutting temperature is 30°C, and the time is 2 h. The effect of enzyme cutting was detected by gel electrophoresis, and purified by using a gel recovery kit.

[0043] Table 8 BamH I restriction endonuclease enzyme cutting system .

[0044] In-fusion ligase was used to ligate the target sequence-containing vector after digestion and the amplified upstream homology arms and downstream homology arms. The ligation system was shown in Table 9. The ligation temperature was 50 °C and the time was 50 min.

[0045] Table 9 In-fusion ligase ligation system .

[0046] The ligation product was transformed into DH5α competent cells using the heat shock transformation method. Specifically, 10 μL of the ligation product was added to 80 μL of DH5α competent cells, placed on ice for 30 min, then placed in a water bath at 42°C for 60 s, followed by an ice bath for 2 min, and then 800 μL of LB liquid medium was added. The cells were shaken at 37°C and 120 rpm for 1 h, and then spread onto LB solid medium (containing 175 μg mL -1 After overnight incubation at 37°C, single colonies were selected for colony PCR identification. Positive strains were expanded and plasmids were extracted using a plasmid extraction kit (Tiangen Biochemical) and sent to the company for sequencing. The plasmid that was sequenced correctly was the intermediate vector pCpf1b-sgRNA-HR. The colony PCR system is shown in Table 5, and the reaction procedure is shown in Table 6.

[0047] (3) The psbA promoter sequence and ScyR Regulator gene cloned into the intermediate vector The psbA promoter sequence is an endogenous promoter sequence from Nostoc flagelliformis, and its sequence information is shown in SEQ ID NO. 4. The psbA promoter sequence was amplified using Nostoc flagelliformis genomic DNA as a template. The amplification system is shown in Table 10, and the reaction procedure is shown in Table 6. The sequence information of the primers Nf-psbA-F and Nf-psbA-R used in the amplification system is as follows: Nf-psbA-F:GATCCCCACGGATCCGGGTTGTCATGTCACACATCCCC; Nf-psbA-R: GGTTTTATAAGTGCGGTTAG.

[0048] Table 10 psbA promoter sequence amplification system .

[0049] ScyR The regulator gene is COO91_00771 The nucleotide sequence of the gene is shown in SEQ ID NO.5, and the amino acid sequence is shown in SEQ ID NO.6. ScyR The regulator gene was amplified, the amplification system is shown in Table 11, and the reaction procedure is shown in Table 12. The sequence information of primers 00771-F and 00771-R in the amplification system is as follows: 00771-F: CGCACTTATAAAACCATGCATGAATCACCAAAGAAAT; 00771-R: AAAAAAAGGATCTCAAGAAGATCCTTTGATTTTTCAGCAAT TTTGCCAAAGTTTTAC.

[0050] Table 11 ScyR Regulator gene amplification system .

[0051] Table 12 ScyR Regulator gene PCR reaction procedure .

[0052] The psbA promoter sequence was amplified and fused to the psbA promoter using fusion PCR. ScyR The regulator gene fragments were ligated to obtain a fusion product. The fusion system is shown in Table 13, and the fusion procedure is shown in Table 14. PCR amplification was performed by adding primers Nf-psbA-F and 00771-R to the fusion product. The PCR reaction system is shown in Table 15, and the reaction procedure is shown in Table 6. The PCR product band size was detected by gel electrophoresis, and the amplified fragment was recovered using a DNA fragment gel recovery kit.

[0053] Table 13 Fusion system .

[0054] Table 14 Fusion procedures .

[0055] Table 15 Fusion product PCR identification reaction system .

[0056] use Good morning The intermediate vector was digested with restriction endonuclease I using the digestion system shown in Table 16, at 30°C for 2 h. The digestion efficiency was verified by gel electrophoresis, and the product was purified using a gel recovery kit.

[0057] Table 16 Intermediate carrier Good morning I enzyme digestion system .

[0058] In-fusion ligase was used to connect the digested intermediate vector and the amplified fusion product. The ligation system was shown in Table 17. The ligation temperature was 50°C and the time was 50 min.

[0059] Table 17 Ligation system of intermediate vector after enzyme digestion and fusion product after amplification .

[0060] The ligation product was transformed into DH5α competent cells using the heat shock transformation method. Specifically, 10 μL of the ligation product was added to 80 μL of DH5α competent cells, placed on ice for 30 min, then placed in a water bath at 42°C for 60 s, followed by an ice bath for 2 min, and then 800 μL of LB liquid medium was added. The cells were shaken at 37°C and 120 rpm for 1 h, and then spread onto LB solid medium (containing 175 μg mL -1 Spe and 25 μg mL -1 Kanamycin (Kan) was added and placed at 37°C overnight. Single colonies were picked for colony PCR identification. The PCR reaction system and reaction procedures are shown in Tables 5 and 6. The successfully identified strains were expanded and the plasmids were extracted using a plasmid extraction kit (Tiangen Biochemical) and sent to the company for sequencing. The plasmid with the correct sequencing result was the recombinant plasmid pCpf1b-sgRNA-HR-psbA- ScyR The structural diagram of the recombinant plasmid is shown in Figure 1 shown.

[0061] The PCR identification results during the construction of the above recombinant plasmids are as follows Figure 2 As shown, A, B, and C in the figure respectively represent the PCR identification results of the target sequence-containing vector, the intermediate vector, and the recombinant plasmid.

[0062] Example 2 Transformation of recombinant plasmids into Nostoc flagelliformis The recombinant plasmid pCpf1b-sgRNA-HR-psbA- ScyR The transformants were obtained by transformation into Nostoc, and the specific transformation steps were as follows: (1) The recombinant plasmid with correct sequencing was transformed into HB101 competent cells by heat shock method. After positive clones were identified by colony PCR, positive single clones were picked and inoculated into LB liquid medium (containing 175 μg mL -1 Spe) and cultured in a shaking incubator at 37°C. 1 mL of the cultured bacterial suspension was then transferred to 100 mL of LB liquid medium (containing 175 μg mL -1 Spe) and cultured at 37°C and 200 rpm until the logarithmic growth phase (OD 600The suspension was centrifuged at 4000 rpm for 5 min, the supernatant was discarded, and the suspension was rinsed twice with LB liquid medium without antibiotics and resuspended in 1.5 mL LB liquid medium.

[0063] (2) Take 100 mL of wild-type Nostoc flagelliformis cells in the logarithmic growth phase, centrifuge at 7500 rpm for 10 min, remove the supernatant, rinse twice with BG11 liquid culture medium, and resuspend in 1.5 mL of BG11 liquid culture medium.

[0064] (3) The resuspended bacterial and algal solutions were placed at 25°C under low light (5-10 μmol photons m -2 s -1 After culturing for 1 h under 40 μmol photons m -2 s -1 After culturing for 24 h, the nitrocellulose membrane containing the Nostoc solution was transferred to a 30 μg mL -1 Spe and 20 μg mL -1 The culture medium was grown on Kan's BG11 solid medium at 25 °C and a light intensity of 40 µmol photons m -2 s -1 The cells were cultured under the following conditions and transformants appeared after about 3-4 weeks of culture.

[0065] Example 3 Construction of Nostoc flagelliforme mutants (1) Select the transformants obtained in Example 2 and add 30 μg mL -1 Spe and 20 μg mL -1 Kan was streaked onto BG11 solid medium (cultured at 25°C under continuous illumination). After 2-3 generations of transfer, the cultured transformants were picked and transferred to a medium containing 20 μg mL -1 The activated transformants were obtained by streaking on Kan's BG11 solid medium (cultured at 25°C under continuous illumination). Figure 3 As shown; (2) The activated transformants were transferred to BG11 liquid medium for cultivation at a temperature of 24-26 °C and a light intensity of 30-50 µmol photons m -2 s -1, shaker speed 100-150 rpm, transfer 2-3 times, collect the culture liquid, extract the genome and use three sets of primers for PCR identification in sequence. The three sets of primers are: ①00771-F and 00771-R, ②Nf-psbA-F and 00771-R, MAAS -sgRNA-F and MAAS The identification reaction system is shown in Table 18, and the identification procedure is shown in Table 19. The correct identification result is the Nostoc flagelliformis mutant. Figure 4 The results of PCR identification of Nostoc flagelliforme mutants are shown in Figure 2.

[0066] Table 18 PCR identification reaction system for Nostoc flagelliforme mutants .

[0067] Table 19 PCR identification procedure for Nostoc flagelliforme mutants .

[0068] Example 4 Analysis of growth phenotype and pseudocladactyl synthesis ability of Nostoc moss mutants The cell suspension culture of Nostoc flagelliforme mutant and wild-type Nostoc flagelliforme cells in logarithmic growth phase were exposed to UV-B at 0.528 W m -2 PAR is 20 µmol photons m -2 s -1 The cells were irradiated under ultraviolet conditions for 15 days, with irradiation for 1 hour every day. At the same time, the substrate tryptophan (0.5 mM) was added to the culture medium. Samples were taken every 5 days to measure the biomass, relative cell activity, scytonemin content, and chlorophyll content. a (Chl a ) content and carotenoid (Car) content.

[0069] The measurement methods for the above indicators are as follows: (1) Biomass Weigh a 10 mL centrifuge tube and collect 20 mL of cell suspension. Centrifuge at 7500 rpm for 10 min, discard the supernatant, and freeze-dry the tube in a freeze dryer until a constant weight is reached. Weigh the centrifuge tube containing the dried cells and calculate the biomass according to the following formula: Biomass (mg mL -1 ) = (weight of centrifuge tube containing dried cells - weight of centrifuge tube before drying) / 20.

[0070] (2) Relative cell activity Take 2 mL of cell suspension culture medium and treat it in the dark for 20 min. Then use a chlorophyll fluorescence instrument to measure the relative cell activity value. Set the parameters as Measurecolor=630 nm, Flash pulse=60%, and Super pulse=40%.

[0071] (3) Chlorophyll a , carotenoids, and pseudocladoxine content Take 20 mL of cell suspension culture medium, centrifuge at 7500 rpm for 5 min, discard the supernatant, dry in a freeze dryer, moisten the dried cells, add 3 ml of 100% acetone, extract at 4 ° C in the dark overnight, rinse once with 1 ml of 100% acetone, collect all the acetone solution (total 4 mL), filter with a 0.22 μm organic filter membrane, measure the absorbance of the filtrate at 384 nm, 490 nm and 663 nm, and calculate the chlorophyll content according to the following formula a , carotenoids and pseudocladonia solani concentrations: C (mg mL -1 ) = A / Kb Where C is the concentration of the substance (mg mL -1 ), A is the corrected absorbance, K is the molar absorptivity, and b is the cuvette thickness (cm). a ) = 92.6 mL mg -1 cm -1 ; K (Car) = 250 mL mg -1 cm -1 ;K(Scytonemin)=112.6mL mg -1 cm -1 .

[0072] The corrected absorbance is calculated as: A* 663 (Chl a ) = 1.02A 663 -0.027A 384 +0.01A 490 ; A* 490 (Car) = 1.02A 490 -0.08A 384 -0.026A 663 ; A* 384 (Scytonemin) = 1.04A 384 -0.79A 663 -0.27A 490 ; Chlorophyll was then calculated according to the following formula a , carotenoids and pseudoclade algae content: M=C / DW Where M is the substance content (mg g -1 DW), C is the substance concentration (mg mL -1 ), DW is biomass.

[0073] Biomass, relative cell activity, pseudocladonia content, and chlorophyll content of Nostoc flagelliforme mutants and wild type a The results of the determination of carotenoid content were as follows: Figure 5-9 As shown in the figure, Nf-psbA-ScyR The results in the figure show that the biomass of wild-type Nostoc moss and Nostoc moss mutants showed a continuous upward trend during the 15-day culture period, and the relative activity first decreased and then increased. a The contents of carotenoids gradually decreased, and the carotenoid content also showed a downward trend. When the culture reached the fifth day, the wild type of Nostoc flagelliformis did not produce pseudocladactyl, while the pseudocladactyl content of the Nostoc flagelliformis mutant reached 2.3 mg g -1 After 15 days of cultivation, both wild-type and mutant Nostoc flagelliformis produced pseudocladactylsin, with the mutant Nostoc flagelliformis producing 4.6 mg g -1 , which is 2.4 times that of wild type Nostoc. MAAS Gene cluster loci overexpression ScyR The regulator gene can significantly enhance the ability of Nostoc moss cells to synthesize pseudocladactyl.

[0074] Those skilled in the art may make various changes, modifications, substitutions and variations in form and details to these embodiments without departing from the spirit and principles of the present invention. The scope of the present invention is defined by the claims and their equivalents.

Claims

1. A recombinant plasmid, characterized in that: It includes a vector plasmid, and an sgRNA target sequence, an HR homologous sequence, a psbA promoter sequence and a sequence connected to the vector plasmid. ScyR Regulator gene.

2. The recombinant plasmid according to claim 1, wherein The sgRNA target sequence is Nostoc MAAs Gene cluster identification sequence, the nucleotide sequence is shown in SEQ ID NO.

1.

3. The recombinant plasmid according to claim 1, wherein The HR homologous sequence is Nostoc MAAs The homologous sequences at both ends of the gene cluster, including the upstream homologous arm and the downstream homologous arm, have nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. The recombinant plasmid according to claim 1, wherein The psbA promoter sequence is an endogenous promoter sequence from Nostoc flagelliformis, and the nucleotide sequence is shown in SEQ ID NO.

4.

5. The recombinant plasmid according to claim 1, wherein described ScyR The regulator gene is COO91_00771 The nucleotide sequence of the gene is shown in SEQ ID NO.5, and the amino acid sequence is shown in SEQ ID NO.

6.

6. The recombinant plasmid according to claim 1, wherein The vector plasmid is pCpf1b-sp.

7. A method for constructing a recombinant plasmid, characterized in that: The following steps are involved: The sgRNA target sequence and HR homologous sequence were sequentially connected to the vector plasmid to obtain an intermediate vector; The psbA promoter sequence and ScyR The regulator gene is fused and connected to the intermediate vector.

8. Use of the recombinant plasmid according to any one of claims 1 to 6, or the recombinant plasmid constructed by the construction method of the recombinant plasmid according to any one of claim 7, in improving the ability of Nostoc flagelliformis to synthesize pseudocladactyl.

9. The use according to claim 8, characterized in that The recombinant plasmid was transformed into Nostoc by MAAs Gene cluster loci overexpression ScyR Regulator gene to improve the synthesis ability of pseudocladonia solani in Nostoc flagelliformis.

10. A Nostoc flagelliforme mutant, characterized in that: The recombinant plasmid according to any one of claims 1 to 6, or the recombinant plasmid constructed according to the method for constructing a recombinant plasmid according to any one of claim 7, is transformed into Nostoc flagelliformis to obtain the product.

Images