Method for increasing sporulation quantity of metarhizium anisopliae and high-spore-yield metarhizium anisopliae engineering bacteria

By knocking out the MaSlt2 gene of Metarhizium anisopliae and changing its spore production mode to microcirculation spore production, the problems of unstable control effect and high cost of Metarhizium anisopliae preparations were solved, the spore production quantity and quality were improved, and its application potential in pest control was enhanced.

CN120758541APending Publication Date: 2025-10-10CHONGQING UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510976540.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-16
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

The existing green anisopliae preparations have insufficient stability in control effects and high production costs, which restrict their actual application scale. In addition, the conventional spore production method has a slow spore production rate and low spore quality, which limits their application potential in biological control of agricultural pests.

Method used

By genetic engineering methods, the mitogen-activated protein kinase (MAPKs) gene MaSlt2 of Metarhizium anisopliae was knocked out, changing its spore production mode from conventional spore production to microcirculation spore production, thereby increasing the spore production amount.

Benefits of technology

It significantly improves the spore production and quality of Metarhizium anisopliae, reduces production costs, and does not affect the virulence and stress resistance of the strain, thereby enhancing its application effect in agricultural pest control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758541A_ABST
    Figure CN120758541A_ABST
Patent Text Reader

Abstract

The invention discloses application of a MaSlt2 gene in regulating and controlling the sporulation quantity of metarhizium anisopliae, a method for improving the sporulation quantity of metarhizium anisopliae and high-spore-yield metarhizium anisopliae engineering bacteria. The MaSlt2 gene has a negative regulation effect on the sporulation quantity of metarhizium anisopliae; the metarhizium anisopliae engineering strain is obtained by reducing the expression quantity or / and activity of mRNA or protein of a MaSlt2 gene in metarhizium anisopliae, the sporulation quantity of the strain is remarkably increased compared with that of a wild type, and it is found that the sporulation mode of the metarhizium anisopliae engineering strain on a 1 / 4 SDAY culture medium is converted into microcirculation sporulation from normal sporulation, so that the sporulation quantity of the metarhizium anisopliae engineering strain is increased. The sporulation quantity of fungi can be effectively improved by knocking out a single gene, and the toxicity and stress resistance of the fungi cannot be influenced in the process. Therefore, the method has an extremely wide and potential application prospect in the aspects of research of transgenic fungi and reduction of the production cost of green muscardine silkworm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically to a genetically engineered bacterium of Metarhizium anisopliae with significantly improved spore production. The spore production of Metarhizium anisopliae is improved by knocking out the mitogen-activated protein kinase (MAPKs) gene MaSlt2 of Metarhizium anisopliae through genetic engineering. Background Art

[0002] Metarhizium anisopliae, an important entomopathogenic fungus, has been formulated into a variety of fungal biocontrol formulations, including powders, suspensions, and granules, due to its significant insecticide efficacy, potential to slow the development of pesticide resistance, and outstanding advantages such as safety for humans, livestock, and crops, as well as its friendliness towards natural enemies. These formulations are widely used in the biological control of agricultural and forestry pests, achieving excellent results and demonstrating high ecological and economic value.

[0003] The core mechanism of action of this type of fungus is to infect by directly penetrating the outer cuticle of the insect host. Among them, conidia are the main infection units and are often used in the form of formulations for pest control. Therefore, their spore production capacity and spore quality are key characteristics that determine the large-scale production efficiency and field application effect of fungal insecticides. However, the current lack of stability in the control effect of green anisopliae preparations and the high production cost are still the key bottlenecks that restrict their actual application scale from lagging significantly behind chemical insecticides. Optimizing the yield and quality of conidia is a core research direction to enhance its market competitiveness.

[0004] Most filamentous ascomycetes (including the genus Metarhizium) have two modes of sporulation: conventional sporulation and microcirculation sporulation. Conventional sporulation is a ubiquitous mode of reproduction, which requires a period of vegetative growth before sporulation can be initiated. Microcirculation sporulation bypasses the normal life cycle, and new conidia are directly formed after spore germination, and the growth of hyphae is significantly reduced. It is particularly noteworthy that as an important locust-killing pathogenic fungus, the conidia formed by the microcirculation sporulation of Metarhizium locust have a faster sporulation rate and higher spore quality than conventional sporulation, showing stronger potential for biological control applications. Therefore, the construction of a microcirculation and high-spore-producing Metarhizium engineered strain through genetic engineering methods can provide theoretical support and valuable resources for reducing costs and selecting high-yield strains. Summary of the Invention

[0005] In view of this, one of the objects of the present invention is to provide the use of the MaSlt2 gene in regulating the spore production of Metarhizium anisopliae, wherein the nucleotide sequence of the MaSlt2 gene is as shown in SEQ ID NO. 1 or the amino acid sequence encoded by the MaSlt2 gene is as shown in SEQ ID NO. 2. The MaSlt2 gene is a mitogen-activated protein kinase (MAPKs) gene.

[0006] Furthermore, the regulation of the spore production of Metarhizium anisopliae is negative regulation of the spore production of Metarhizium anisopliae.

[0007] Furthermore, the negative regulation of the spore production of Metarhizium anisopliae is achieved by changing the spore production mode from a normal spore production mode to a microcirculation spore production mode.

[0008] The second object of the present invention is to provide a method for cultivating an engineered strain of Metarhizium anisopliae with increased spore production, comprising the steps of reducing the expression level and / or activity of the mRNA or protein of the MaSlt2 gene in the recipient Metarhizium anisopliae to obtain a transgenic Metarhizium anisopliae; the nucleotide sequence of the MaSlt2 gene is as shown in SEQ ID NO.1, or the encoded amino acid sequence is as shown in SEQ ID NO.2.

[0009] Furthermore, the method for reducing the expression level and / or activity of the mRNA or protein of the MaSlt2 gene in the recipient Metarhizium anisopliae is achieved by knocking out the MaSlt2 gene of the receptor.

[0010] Furthermore, the expression level of the mRNA or protein of the MaSlt2 gene in the recipient Metarhizium anisopliae is reduced by knocking out the MaSlt2 gene, and the knockout method comprises the following steps:

[0011] 1) Construction of pK2-PB-MaSlt2 recombinant plasmid

[0012] PCR primers were designed based on the genome sequence of Metarhizium anisopliae to amplify the upstream and downstream recombination arms of the MaSlt2 gene, and the amplified products were purified. The upstream homologous recombination arm is the left arm, and the gene sequence is shown in SEQ ID NO.4; the downstream homologous recombination arm is the right arm, and the gene sequence is shown in SEQ ID NO.5. The vector plasmid pK2-PB was digested with enzymes and the linearized plasmid was purified. The upstream and downstream recombination arm fragments and the linearized plasmid were cloned in one step in the presence of a recombinase, and the recombinant product was inoculated into Escherichia coli competent DH5α to obtain the pK2-PB-MaSlt2-L / R recombinant plasmid.

[0013] The pK2-PB plasmid vector is constructed from the pAN52-1 vector, and the pTrpC promoter and the glufosinate-ammonium marker Bar gene sequence controlled by it are fused by PCR amplification using the Aspergillus nidulans genomic DNA as a template. The pAN52-1 and the amplified fragment are double-digested with BamHI and EcoRV, respectively, and ligated using T4 ligase to obtain the pK2-PB vector.

[0014] 2) Transformation of Agrobacterium and Co-cultivation with Metarhizium anisopliae

[0015] The plasmid pK2-PB-MaSlt2-L / R was transformed into Agrobacterium and then co-cultured with wild Metarhizium anisopliae spores to cause homologous recombination;

[0016] 3) Screening of Metarhizium anisopliae transformants

[0017] The transformants were preliminarily verified by PCR and RT-qPCR, and the MaSlt2 gene knockout mutant of Metarhizium anisopliae was obtained, which is an engineered strain of Metarhizium anisopliae with increased spore production.

[0018] Furthermore, the spore production is increased by changing the spore production mode of Metarhizium anisopliae from normal spore production to microcirculation spore production.

[0019] The third object of the present invention is to provide an engineered bacterium of Metarhizium anisopliae with high spore production, wherein the expression level and / or activity of the mRNA or protein of the MaSlt2 gene in the engineered bacterium is reduced.

[0020] Furthermore, the method for reducing the expression level and / or activity of the mRNA or protein of the MaSlt2 gene in the engineered bacteria is achieved by knocking out, inhibiting or silencing the expression of the MaSlt2 gene.

[0021] Furthermore, the knockout is achieved through homologous recombination, that is, the marker gene replaces the MaSlt2 gene in the recipient green anisopliae through homologous recombination of the recombinant gene composed of the upstream homologous arm of the MaSlt2 gene, the marker gene and the downstream homologous arm of the MaSlt2 gene. The marker gene can preferentially be the glufosinate-ammonium marker Bar gene (glufosinate-ammonium resistance gene), and the Bar gene sequence is shown in SEQ ID NO.3.

[0022] The fourth object of the present invention is to provide an insecticide fungicide, the active ingredient of which is the above-mentioned engineered fungus Metarhizium anisopliae.

[0023] The fifth object of the present invention is to provide a method for increasing the spore production of Metarhizium anisopliae, namely, increasing the spore production of Metarhizium anisopliae by reducing the expression level and / or activity of the mRNA or protein of the MaSlt2 gene of Metarhizium anisopliae.

[0024] The above-mentioned microcirculation and high-spore-yielding engineered Metarhizium anisopliae was obtained by knocking out the MaSlt2 gene of the wild-type Metarhizium anisopliae CQMa102 strain. The strain is now available for purchase at the Genetic Engineering Research Center of Chongqing University.

[0025] The present invention provides the application of the MaSlt2 gene in regulating the spore production of Metarhizium anisopliae and provides an engineered strain of Metarhizium anisopliae with high microcirculation spore production. The MaSlt2 gene has a negative regulatory effect on the spore production of Metarhizium anisopliae. An engineered strain of Metarhizium anisopliae is obtained by reducing the expression level or / and activity of the mRNA or protein of the MaSlt2 gene in Metarhizium anisopliae. The spore production of the strain is significantly increased compared with the wild type, and it is found that the spore production mode of the engineered strain of Metarhizium anisopliae on 1 / 4SDAY culture medium is converted from normal spore production to microcirculation spore production, thereby increasing its spore production. In terms of constructing a fungal knockout vector, the present invention adopts a unique and ingenious method, the selected selection agent is low in price, and the entire operation procedure is concise and clear. By knocking out the expression of a single gene, the spore production of the fungus can be effectively increased, and this process will not affect the virulence and stress resistance of the fungus. Therefore, the present invention has an extremely broad and highly potential application prospect in the research of transgenic fungi and reducing the production cost of Metarhizium anisopliae. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The construction of the MaSlt2 knockout vector of the present invention, PCR verification and the relative expression results of the MaSlt2 gene;

[0027] Figure 2 The results of observation on the spore production mode and statistical results of spore production of 1 / 4SDAY culture medium of the present invention are as follows;

[0028] Figure 3 is the toxicity analysis result of the present invention;

[0029] Figure 4 This is the analysis result of the ultraviolet and heat resistance of the present invention. DETAILED DESCRIPTION

[0030] The present invention will be described in detail below with reference to the examples, which are only illustrative and are not limited to the scope of application of the present invention. The present invention is not limited to the following embodiments or examples, and any modifications and variations that do not violate the spirit of the present invention should be included within the scope of the present invention. Unless otherwise specified, the experimental materials and reagents used in the following examples are conventional products that can be purchased commercially. The CQMa102 strain of Metarhizium anisopliae used in the experiments in the following examples was provided by the Gene Engineering Research Center of Chongqing University. This strain has been deposited in the China General Microbial Culture Collection Center with a deposit number of CGMCC No. 0877, and is also recorded in the patent authorization announcement CN1216144C.

[0031] Example 1. Construction of pK2-PB-MaSlt2 recombinant plasmid

[0032] 1. Primer design

[0033] PCR primers were designed based on the genome sequence of Metarhizium anisopliae (WT genome) to amplify the upstream and downstream homology arm fragments of the MaSlt2 gene. The amplification template was the genomic DNA of Metarhizium anisopliae CQMa102 strain. MaSlt2-LF / LR was the upstream homology arm amplification primer, and MaSlt2-RF / RR was the downstream homology arm amplification primer. The amplification primer sequences for the upstream and downstream homology arms were as follows:

[0034]

[0035] The nucleotide sequence of the MaSlt2 gene is shown in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2.

[0036] 2. PCR amplification of upstream and downstream homology arm fragments of MaSlt2 gene

[0037] PCR amplified the left and right arms of MaSlt2. The upstream homology arm is the left arm, and the gene sequence is shown in SEQ ID NO. 4. The downstream homology arm is the right arm, and the gene sequence is shown in SEQ ID NO. 5. Verify the target fragments using a 1% agarose gel. Purify and recover the target fragments using a purification kit for subsequent experiments.

[0038] The PCR amplification system (25 μL) is:

[0039]

[0040] The PCR amplification procedure is:

[0041]

[0042] 3. Enzyme digestion of vector plasmid pK2-PB

[0043] The pK2-PB vector was constructed from the pAN52-1 vector (purchased from Guangzhou Tuofei Biotechnology Co., Ltd.). The pTrpC promoter and the glufosinate-labeled Bar gene sequence under its control were amplified by fusion PCR using Aspergillus nidulans genomic DNA as a template. pAN52-1 and the amplified fragment were digested with BamHI and EcoRV (TaKaRa, Japan), respectively, and ligated using T4 ligase (TaKaRa, Japan) to generate the pK2-PB vector. The Bar gene sequence is shown in SEQ ID NO. 3.

[0044] Culture and storage of pK2-PB vector:

[0045] 1) Remove the original pK2-PB plasmid vector stored at -80°C, thaw it, streak it onto LK solid medium (LB solid medium supplemented with kanamycin at a working concentration of 50 μg / mL), and culture it at 37°C overnight.

[0046] 2) Pick a single colony and place it in 20 mL of LB liquid medium (LB liquid medium supplemented with kanamycin at a working concentration of 50 μg / mL) and culture in a shaking incubator at 37°C and 220 rpm for 12 h.

[0047] 3) Pipette 500 μL of 50% (v / v) glycerol and 500 μL of bacterial solution into a sterile centrifuge tube, vortex to mix, quickly freeze with liquid nitrogen, and store in a -80°C refrigerator.

[0048] 4. Ligation of the plasmid to the left homology arm

[0049] The left arm of the knockout vector plasmid pK2-PB was double-digested (XbaI and HindIII).

[0050] The enzyme digestion system (20 μL) is:

[0051]

[0052] Reaction conditions for enzyme digestion: digestion was carried out in a 37°C incubator for 30-40 min. 1% agarose gel was used to verify whether the vector was successfully digested. The plasmid that was successfully digested was then purified and recovered using a purification kit.

[0053] Use Novo Rec recombinase for ligation, mixing 1 μL of digested plasmid with 3 μL of the left-arm fragment by volume, and incubate at 50°C for 20 minutes. The digested plasmid and ligated fragments must be purified and recovered.

[0054] The ligation system (10 μL) is:

[0055]

[0056] 5. Transformation into competent E. coli

[0057] 1) Take 50 μL of competent E. coli DH5α (BGT1, Baoguang Biotechnology) stored at -80°C, add 5 μL of the ligation product, gently rotate the tube to mix evenly, and place on ice for 10 minutes.

[0058] 2) Heat shock at 42°C for 40 seconds and immediately place on ice for 10 minutes.

[0059] 3) Add 0.5-0.8 mL of LB liquid medium and culture at 37°C in a shaker at 220 rpm for 1 h.

[0060] 4) Centrifuge (5000 rpm, 5 min), collect about 50 μL of supernatant, and resuspend the cells.

[0061] 5) Spread the bacterial solution onto LK plates and incubate at 37°C for 12-16 hours.

[0062] 6. Colony PCR verification of positive plasmids

[0063] After a single colony grows on the plate, pick a single colony and place it in a PCR tube containing 10 μL of sterile water to prepare a bacterial suspension. Use the bacterial suspension as a template for colony PCR verification, using the primers MaSlt2-LF and Pt-R to verify whether the transformant has been successfully connected. If the positive transformant is confirmed, shake flask culture is performed, and plasmid is extracted for the next step. The primer sequences are:

[0064]

[0065] The colony PCR amplification system (25 μL) is:

[0066]

[0067] PCR amplification procedure:

[0068]

[0069] 7. Right arm vector plasmid ligation and transformation

[0070] Use a plasmid extraction kit to extract the positively verified left-arm homology arm plasmid, and use EcoRI and EcoRV to double-digest the pK2-PB recombinant vector plasmid connected to the left arm.

[0071] The enzyme digestion system (20 μL) is:

[0072]

[0073]

[0074] Enzyme digestion reaction conditions: digestion was carried out in a 37°C incubator for 30-40 min. 1% agarose gel was used to verify whether the vector was successfully digested. After successful digestion, the plasmid was purified and recovered using a purification kit.

[0075] The linear recombinant vector that has been digested and purified and the purified right arm fragment were ligated and transformed according to the method of steps 4 and 5 above. The principle is as shown in the attached Figure 1 As shown in A. The ligation product is pK2-PB-MaSlt2-L / R with Bar gene resistance.

[0076] 8. Colony PCR verification of positive transformants

[0077] The verification method and steps refer to the left arm PCR verification method, the verification primers are Bar_F and MaSlt2_RR, and the primer sequences are:

[0078]

[0079] The colony PCR amplification system (25 μL) is:

[0080]

[0081] PCR amplification procedure:

[0082]

[0083]

[0084] The plasmids of the successfully verified positive transformants were extracted and used for later use.

[0085] 9. Extraction of vector plasmid

[0086] The plasmid extraction in the present invention uses the TIANGEN rapid plasmid extraction kit, and the extraction steps are as follows:

[0087] 1) E. coli was cultured in LK liquid medium with shaking for approximately 16 h. 4 mL of the culture medium was collected into two 2 mL centrifuge tubes, centrifuged (12,000 rpm, 1 min), and the supernatant was discarded.

[0088] 2) Add 0.15 mL of solution P1 and resuspend the cells by pipetting.

[0089] 3) Add 0.15 mL of solution P2 and gently invert the tube to lyse the bacteria.

[0090] 4) Add 0.35 mL of solution P3 and mix thoroughly until a yellow flocculent precipitate appears in the tube.

[0091] 5) Centrifuge (12,000 rpm, 10 min), collect the supernatant, and transfer it to the adsorption column (the adsorption column is placed in the collection tube).

[0092] 6) Add 0.35 mL of rinse solution PW (to which anhydrous ethanol has been added) to the adsorption column adsorbed with the target DNA, centrifuge (12000 rpm, 1 min), and discard the waste liquid.

[0093] 7) Repeat step 6.

[0094] 8) Empty the column (12,000 rpm, 2 min) to remove any remaining rinse solution. Open the cap of the adsorption column and allow it to air dry at room temperature for approximately 10 min to evaporate any remaining ethanol.

[0095] 9) Place the adsorption column with the target DNA in a new 1.5 mL centrifuge tube, add 30-50 μL of 65°C ddH2O to elute the plasmid from the adsorption membrane, and store at -20°C until use.

[0096] Example 2: Transformation of Agrobacterium and Co-cultivation with Metarhizium anisopliae

[0097] 1. Chemical transformation of Agrobacterium

[0098] 5 μL of pK2-PB-MaSlt2-L / R plasmid was placed in 50 μL of Agrobacterium competent medium (purchased from Broadtech Biotechnology Co., Ltd.), placed on ice for 5 minutes, treated with liquid nitrogen for 5 minutes, and treated in a 37°C metal bath for 5 minutes. Then, after placing on ice for 5 minutes, 600 μL of LB liquid culture medium was added and cultured on a shaker at 28°C and 200 rpm for 2 hours. 50 μL was spread on LK medium, and positive transformants were verified by colony PCR.

[0099] 2. Co-culture of Agrobacterium and Metarhizium anisopliae CQMa102

[0100] 1) Inoculate the successfully verified Agrobacterium positive colonies into 20 mL of LK liquid culture medium and culture in a constant temperature shaking incubator (28°C, 200 rpm) for 16-20 hours until the absorbance value OD 660 It is 0.6-1.0.

[0101] 2) Collect 6 mL of bacterial culture in a sterile centrifuge tube and centrifuge (12,000 rpm, 1 min). Discard the supernatant and retain the precipitate.

[0102] 3) Add 1 mL of NIM liquid medium (containing 200 μM acetosyringone), resuspend the cells, and measure the absorbance A 660 .

[0103] 4) According to the formula A=[(0.15×10) / A 660 ]mL, calculate the A value. The A value is the initial bacterial liquid volume required in 10mL NIM liquid medium (containing 200μM acetosyringone).

[0104] 5) Culture in a constant temperature shaking incubator (28°C, 220 rpm) in the dark for 12-16 hours until the absorbance value OD 660 It is 0.5-0.7.

[0105] 6) Scrape the conidia of the Metarhizium anisopliae strain and prepare a spore suspension (1×10 6 spores / mL).

[0106] 7) Mix the prepared Metarhizium spore suspension and the induced Agrobacterium in a ratio of 1:1.

[0107] 8) Pipette 0.1 mL of the mixed bacterial solution onto NIM solid medium (containing 200 μM acetosyringone) covered with a sterile microporous filter membrane and incubate in a 28°C incubator in the dark for 48 h.

[0108] 9) After culturing in the dark for 48 hours, the conversion membrane was transferred to a Czapek medium plate containing the corresponding resistance (containing 120 μg / mL glufosinate (PPT) and 200 mg / mL cephalexin).

[0109] 10) Incubate the culture in an inverted position at 28°C until a single colony grows. The culture time is generally 7-10 days.

[0110] 11) Pick resistant colonies onto Czapek screening plates containing the corresponding resistance, culture them upside down at 28°C for about 5 days, inoculate them into 1 / 4SDAY liquid culture medium, and micro-extract the genome for PCR verification.

[0111] Example 3: Screening of Metarhizium anisopliae transformants

[0112] 1. PCR electrophoresis verification of Metarhizium anisopliae knockout transformants

[0113] In the knockout strain selected, the MaSlt2 gene was replaced by the selection gene Bar, which enables growth on media containing glufosinate-ammonium (PPT). Therefore, positive transformants of the knockout strain were initially screened using Czapek medium (containing 120 μg / mL glufosinate-ammonium (PPT) and 200 mg / mL cephalexin).

[0114] Pick out knockout strain transformants:

[0115] 1) After 7-10 days of culture, a single dark-colored colony will appear on the conversion film. Pick the colony with a sterile pipette tip and streak it onto Czapek solid medium (containing 120 μg / mL glufosinate (PPT) and 200 mg / mL cephalexin).

[0116] 2) Culture in a 28°C incubator for 3-4 days. Pipette 0.5 mL of 1 / 4SDAY liquid culture medium into a 1.5 mL centrifuge tube and scrape a small amount of cells into the centrifuge tube. After 60 hours of culture, perform micro-extraction for genome verification.

[0117] 3) Culture in a constant temperature shaking incubator (28°C, 220 rpm) for 3 days.

[0118] Mini-extract the genome of the knockout strain transformant:

[0119] 1) Centrifuge (12,000 rpm, 5 min) and discard the supernatant.

[0120] 2) The cells were quickly frozen in liquid nitrogen and then ground using a fully automatic rapid grinder (60 Hz, 90 s grinding twice).

[0121] 3) After grinding, add 0.4 mL of Lysis Buffer to the centrifuge tube and mix thoroughly. Incubate at 37°C for 2-3 hours to lyse the cells. Shake the tube 1-2 times during lysis to ensure complete lysis.

[0122] 4) Add 0.25 mL of potassium acetate solution to each tube of sample and mix thoroughly by inverting.

[0123] 5) The sample was allowed to stand at 4°C for 10-15 min and then centrifuged (12,000 rpm, 10 min);

[0124] 6) Pipette 0.5 mL of supernatant into a new centrifuge tube, add 0.5 mL of isopropanol, mix well, and place on ice for at least 30 minutes.

[0125] 7) Centrifuge (12,000 rpm, 10 min). After discarding the supernatant, a small amount of white precipitate can be seen at the bottom of the centrifuge tube, which is DNA.

[0126] 8) Add 1 mL of 70% ethanol, centrifuge (12,000 rpm, 5 min), and discard the supernatant.

[0127] 9) Open the centrifuge tube and air dry to allow the residual ethanol to fully evaporate. Add 30-35 μL of 65°C sterile double-distilled water, dissolve, and store in a -20°C refrigerator. This will serve as a template for preliminary transformant screening.

[0128] PCR verification of positive strain transformants:

[0129] The left arm verification primers of the knockout strain transformants are: MaSlt2-VF (located upstream of the left arm) and Pt-R, and the right arm verification primers of the knockout strain transformants are: Bar-F and MaSlt2-VR (located downstream of the right arm). The base sequences are as follows:

[0130]

[0131] The amplification system (25.0 μL) is:

[0132]

[0133] PCR amplification procedure:

[0134]

[0135] 1% agarose gel was used to verify whether the PCR amplification band size was correct. Figure 1 As shown in B, the knockout strain ΔMaSlt2 was obtained.

[0136] Example 4: Quantitative PCR Verification

[0137] 1. Sample collection

[0138] ΔMaSlt2 and WT strains were cultured on 1 / 4SDAY medium for 14 days, and the mycelia were scraped into sterile ddH2O, quickly frozen in liquid nitrogen and stored for later use.

[0139] 2. RNA Extraction

[0140] Total RNA was extracted using the Bioviz Ultrapure RNA Kit (DNase I). Detailed steps are described in the manufacturer's instructions.

[0141] 3. Reverse transcription and quantitative PCR

[0142] ① Synthesize cDNA: First, reverse transcribe the total RNA of Metarhizium anisopliae into cDNA using PrimeScript TM RNA was reverse transcribed using the RTMaster Mix kit (TAKARA, Dalian). Specific steps are described in the instructions.

[0143] ②Prepare template and primers: The specific internal reference gene is GAPDH (glyceraldehyde 3phosphate dehydrogenase).

[0144] The reaction system (20.0 μL) is:

[0145]

[0146] The base sequences of qF primer and qR primer are:

[0147] Primers Sequence(5'-3') GAPDH-qF GACTGCCCGCATTGAGAAG GAPDH-qR AGATGGAGGAGTTGGTGTTG MaSlt2-qF CTTGCTCGTGGCTTTTCG MaSlt2-qR CGTCTCCTCATTGGGGGTC

[0148] ③ Real-time PCR reaction: Preheat the PCR instrument to 95°C, set the annealing temperature, extension time, cycle number and other parameters for real-time PCR reaction.

[0149] ④Data analysis: Based on the Ct value (the number of amplification cycles required to reach the threshold) corresponding to each qRT-PCR sample, the data were processed as follows to obtain the relative expression levels of the relevant genes.

[0150] 2 -ΔΔCt Calculation steps of Livak method:

[0151] 1) Calculation of the difference in Ct values ​​among samples in the same group: ΔCt = Ct 目的基因 -Ct 内参基因 ;

[0152] 2) Calculate the ΔΔCt value of the treatment group and the control group, that is: ΔΔCt = ΔCt 处理 -ΔCt 对照 ;

[0153] 3) The differential expression fold of genes in each treatment group relative to the control group, i.e., relative expression fold = 2 -ΔΔCt .

[0154] The relative expression results of MaSlt2 gene are as follows Figure 1 As shown in C, it shows that the MaSlt2 gene of the knockout strain ΔMaSlt2 was successfully knocked out, and the ΔMaSlt2 strain was used in subsequent experiments.

[0155] Example 5: Observation experiment on conversion of spore production mode

[0156] Prepare the Metarhizium anisopliae spore suspension with a concentration of 1×10 7 Spores / mL. Preparation of spore suspension: Use a sterile pipette to scrape spores of WT and ΔMaSlt2 strains cultured for 15 days and add them to sterile 0.05% Tween. Vortex and mix thoroughly. Filter with sterile lens paper. Dilute to a certain multiple and count using a hemocytometer. The final concentration of the spore suspension is 1×10 7 spores / mL.

[0157] Spreading observation: 100 μL of spore suspension of each strain (WT and ΔMaSlt2) was evenly spread on 1 / 4 SDAY medium. After spreading, the plates were inverted and incubated in a 28°C incubator. The sporulation patterns of the cells were observed under a microscope and recorded for 36 hours.

[0158] Sporulation observation experiment Figure 2 As shown in A, after knocking out MaSlt2, the spore production mode of Metarhizium anisopliae on 1 / 4SDAY solid culture medium changed from normal spore production to microcirculation spore production, and the number of spores of the WT strain was significantly less than that of ΔMaSlt2, indicating that the knockout of MaSlt2 promoted the microcirculation spore production of Metarhizium anisopliae on 1 / 4SDAY culture medium.

[0159] Example 6: Spore production determination experiment

[0160] Prepare the Metarhizium anisopliae spore suspension with a concentration of 1×10 6 Spores / mL, the configuration of the spore suspension is as in Example 5. 2 μL of the spore suspension of each strain was aspirated with a pipette and dropped into a 24-well plate. Each well contained 2 mL of 1 / 4SDAY solid culture medium. Sampling was performed every 3 days starting from the 3rd day (inclusive) until the 15th day, with three replicates for each strain. The taken samples needed to be ground, then vortexed with water, mixed thoroughly, and diluted a certain multiple, and the spores were counted using a hemocytometer to calculate the spore production of each strain. Repeat the experiment 3 times.

[0161] The spore production of WT and ΔMaSlt2 strains was counted, and the spore production of each strain at different time points was counted under a microscope using a hemocytometer. The results showed that starting from the ninth day, the spore production of WT and ΔMaSlt2 strains was significantly different (p<0.05), and the spore production of ΔMaSlt2 strain increased by 56.52% compared with WT. On the 12th day, the difference in spore production was extremely significant (p<0.001), and the spore production of ΔMaSlt2 strain increased by 41.69% compared with WT. Until the 15th day, the difference was still significant (p<0.05), indicating that the MaSlt2 gene affects the spore production of Metarhizium locust and the spore production time is faster ( Figure 2 B).

[0162] Example 7: Toxicity Analysis Experiment

[0163] Prepare paraffin oil spore suspension of WT and ΔMaSlt2 (1×10 7 5 μL of the strain (100 spores / mL) was drip-inoculated onto the dorsal plates of fifth-instar nymphs of the East Asian migratoria manilensis (provided by the Genetic Engineering Research Center of Chongqing University) at 28°C. The nymphs were fed a diet of water and fresh corn leaves. The number of dead locusts was counted every 12 hours until all nymphs died or stopped dying. The survival rate and mean lethality time (LT50) of the two strains were compared. A blank control group was drip-inoculated with 5 μL of liquid paraffin.

[0164] The surface drip experiment showed that there was no significant difference in the mortality rate of locusts infected by WT and ΔMaSlt2 strains. All locusts inoculated with WT and ΔMaSlt2 strains died on the 8th day ( Figure 3 A), there was no significant difference in LT50 between the ΔMaSlt2 strain (4.84±0.03d) and the WT (4.85±0.06d) ( Figure 3 B) This indicates that the virulence of M. anisopliae is not affected by the knockout of the MaSlt2 gene.

[0165] Example 8: Ultraviolet and heat sensitivity analysis experiment

[0166] 1. Determination of spore germination rate under ultraviolet conditions: fresh mature spores of WT and ΔMaSlt2 strains were prepared at a concentration of 1×10 7 Take 100 μL of the water spore suspension of 100 μL and spread it evenly on a 1 / 4 SDAY medium plate. 2 After irradiation with ultraviolet light for 0.5 h, 1.0 h, 1.5 h, and 2.0 h, the spores were cultured at 28 °C for 18 h, and the spore germination rate was counted microscopically.

[0167] Analysis of UV treatment results showed that the tolerance of ΔMaSlt2 to UV radiation was the same as that of WT strain ( Figure 4 A), there was no significant difference in LT50 between the strain (1.22±0.02h) and WT (1.24±0.03h) ( Figure 4 B).

[0168] 2. Determination of spore germination rate under hot and humid conditions: The concentration of WT and ΔMaSlt2 mature Metarhizium anisopliae spores was 1×10 7 The aqueous spore suspension of 1000 spores / mL was treated in a 42.5°C water bath for 2 h, 4 h, 6 h and 8 h, then evenly spread on a 1 / 4SDAY medium plate and cultured at 28°C for 18 h. The spore germination rate was counted microscopically.

[0169] Analysis of the results of heat treatment showed that after 2h and 4h of heat shock treatment, there was no difference in the germination rate of conidia between the ΔMaSlt2 strain and the WT strain. After 6h and 8h of heat shock treatment, the germination rate of conidia of the ΔMaSlt2 strain was lower than that of the WT strain ( Figure 4 C), but the LT50 value of the ΔMaSlt2 strain (4.60±0.05h) was not significantly different from that of the WT (4.72±0.12h) ( Figure 4 D).

[0170] This shows that the stress resistance of Metarhizium anisopliae is not affected by the knockout of the MaSlt2 gene.

[0171] In summary, it is shown that the MaSlt2 gene affects the spore production of Metarhizium anisopliae and has a negative regulatory effect on the spore production. After knocking out the MaSlt2 gene, Metarhizium anisopliae switches to microcirculation spore production, and the spore production is significantly improved. Knocking out the MaSlt2 gene has no effect on the virulence and stress resistance of Metarhizium anisopliae. Therefore, the engineered strain of the present invention has extremely broad and highly potential application prospects in the research of transgenic fungi and reducing the production cost of Metarhizium anisopliae.

[0172] The conventional techniques and schemes not described in detail in the above embodiments are well known in the art and will not be described in detail here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail, but the present invention is not limited to the specific details of the above embodiments. Within the scope of the technical concept of the present invention, various simple variations of the technical scheme of the present invention can be made, and these simple variations all fall within the scope of protection of the present invention.

Claims

1. Application of the MaSlt2 gene in regulating the spore production of Metarhizium anisopliae, wherein the nucleotide sequence of the MaSlt2 gene is as shown in SEQ ID NO.1, or the encoded amino acid sequence is as shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that The method of regulating the spore production of Metarhizium anisopliae is to negatively regulate the spore production of Metarhizium anisopliae.

3. A method for cultivating an engineered strain of Metarhizium anisopliae with increased spore production, characterized in that: The method comprises the steps of reducing the expression level and / or activity of the mRNA or protein of the MaSlt2 gene in the recipient Metarhizium anisopliae to obtain a transgenic Metarhizium anisopliae; the nucleotide sequence of the MaSlt2 gene is as shown in SEQ ID NO.1, or the encoded amino acid sequence is as shown in SEQ ID NO.

2.

4. The method according to claim 3, wherein: The method for reducing the expression amount and / or activity of the mRNA or protein of the MaSlt2 gene in the receptor Metarhizium anisopliae is achieved by knocking out, inhibiting or silencing the expression of the MaSlt2 gene of the receptor.

5. The method according to claim 4, wherein The spore production amount is increased by changing the spore production mode of Metarhizium anisopliae from normal spore production to microcirculation spore production to increase the spore production amount.

6. A high-spore-producing engineered strain of Metarhizium anisopliae, characterized in that: The expression level and / or activity of the mRNA or protein of the MaSlt2 gene in the engineered bacteria is reduced.

7. The engineered strain of Metarhizium anisopliae according to claim 6, wherein The method for reducing the expression level and / or activity of the mRNA or protein of the MaSlt2 gene in the engineered bacteria is achieved by knocking out, inhibiting or silencing the expression of the MaSlt2 gene.

8. The engineered strain of Metarhizium anisopliae according to claim 7, wherein The knockout is achieved by homologous recombination, wherein the homologous recombination comprises a recombinant gene consisting of an upstream homologous arm of the MaSlt2 gene, a marker gene and a downstream homologous arm of the MaSlt2 gene, so that the marker gene replaces the MaSlt2 gene.

9. An insecticide, characterized in that: The active ingredient is the engineered Metarhizium anisopliae bacteria described in any one of claims 6-8.

10. A method for increasing the spore production of Metarhizium anisopliae, characterized in that: The spore production of Metarhizium anisopliae is increased by reducing the expression level and / or activity of the MaSlt2 gene mRNA or protein of Metarhizium anisopliae.

Citation Information

Patent Citations

  • Metarhizium anisopliae

    CN1216144C