Application of ACR11 gene in enhancing PVY resistance of plants

Abstract

The invention belongs to the technical field of crop disease-resistant molecular breeding, and particularly relates to application of an ACR11 gene in enhancing PVY resistance of plants. The application of the ACR11 gene in enhancing the PVY resistance of the plant is characterized in that the virus accumulation amount after PVY infection is reduced by improving the expression level of the ACR11 gene in the plant; wherein the ACR11 gene is shown as SEQ ID NO. 1 or SEQ ID NO. 6. The invention provides the application of the ACR11 gene in enhancing the PVY resistance of the plant, which indicates that the ACR11 plays a positive regulation role in the PVY infection resisting process of the plant.

Description

Technical Field

[0001] The present invention belongs to the technical field of crop disease resistance molecular breeding, and in particular relates to the application of the ACR11 gene in enhancing plant PVY resistance. Background Art

[0002] Potato virus Y (PVY), a representative species of the genus Potyvirus, is one of the most devastating plant viruses in global agricultural production. It can infect over 170 plant species belonging to 34 genera and nearly 400 host species, encompassing food crops, cash crops, and wild plants. Its wide host adaptability gives it significant transmission potential and ecological adaptability in natural ecosystems. PVY is particularly harmful to Solanaceae crops. Infection in tobacco, tomatoes, and potatoes often manifests as leaf mosaic, vein necrosis, and wrinkled deformities. In severe cases, it can cause systemic necrosis and even death, impacting crop quality and yield, leading to significant economic losses in agricultural production.

[0003] The ACT domain is a protein domain widely found in bacteria, archaea, and eukaryotes. Composed of 70-80 amino acids, it plays a key role in metabolic regulation, solute transport, and signal transduction. Its typical structure consists of four β-strands and two α-helices arranged in a ββαββ topology, but it exhibits significant structural diversity among different proteins. For example, the ACT domain of phosphoglycerate dehydrogenase forms a laterally connected eight-stranded β-sheet, while the ACT domain of Lrp-like transcriptional regulators is arranged face-to-face. This difference has prompted researchers to subdivide it into ACT domains and RAM domains (amino acid metabolism regulatory domains). Furthermore, some proteins (such as the Arabidopsis ACR family) contain multiple ACT domain repeats, while others (such as the YkoF thiamine-binding protein) are composed solely of ACT domains, suggesting that they may participate in ligand binding, structural stability, or transport functions. Studies have shown that the ACT domain acts as a mobile regulatory module, conferring allosteric regulatory capabilities to fusion proteins. For example, 3-phosphoglycerate dehydrogenase (PGDH) achieves feedback inhibition through serine binding through its ACT domain, and similar mechanisms exist in various amino acid metabolism enzymes.

[0004] Studies of the Arabidopsis genome have revealed that ACR family proteins are composed of four tandem ACT domains and lack a known catalytic domain, yet their ligand-binding sites are highly conserved. Given that known ACT domain ligands are all amino acids, the multi-domain nature of ACR proteins, as novel amino acid sensors, enables them to integrate multiple amino acid signals, providing new insights into plant amino acid perception and signal transduction mechanisms. Currently, research on ACR family proteins is limited, and their application in plant disease resistance has not been reported. Summary of the Invention

[0005] The present invention provides an application of an ACR11 gene in enhancing plant PVY resistance, illustrating that SlACR11 plays a positive regulatory role in the process of plant resistance to PVY infection.

[0006] The present invention provides an application of the ACR11 gene in enhancing plant resistance to PVY, and by increasing the expression level of the ACR11 gene in plants, the accumulation of viruses after PVY infection is reduced;

[0007] Furthermore, the ACR11 gene is SEQ ID NO.1 or SEQ ID NO.6.

[0008] Furthermore, the protein encoded by the gene is localized in plant chloroplasts.

[0009] Furthermore, the plant is a Solanaceae plant.

[0010] Furthermore, the Solanaceae plant is Nicotiana benthamiana or tomato.

[0011] Furthermore, the gene is derived from Nicotiana benthamiana or tomato.

[0012] The present invention provides a method for screening PVY-resistant plants, characterized by comprising the following steps:

[0013] (1) Amplify the target gene using the primer pair of SEQ ID NO. 4 and SEQ ID NO. 5 to obtain a PCR product;

[0014] (2) Construction of NbACR11-OE overexpression vector;

[0015] (3) transforming the NbACR11-OE overexpression vector obtained in step (2) into Escherichia coli and extracting the positive clone plasmid;

[0016] (4) The plasmid is transformed into Agrobacterium, which infects plant callus tissue to obtain transgenic plants.

[0017] Furthermore, the NbACR11-OE overexpression vector was constructed as follows:

[0018] The vector plasmid pCAMBIA1302 was digested with restriction endonucleases EcoRI and BamHI, and then ligated with the PCR product to construct the NbACR11-OE overexpression vector.

[0019] The present invention provides a method for cultivating PVY-resistant plants, comprising the following steps:

[0020] (1) Introducing the ACR11 gene into target plants to obtain transgenic plants;

[0021] (2) Plants overexpressing the gene were screened, and their PVY resistance was higher than that of the wild type.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The GFP fluorescence of NbACR11 coincided with the autofluorescence of plant chloroplasts, proving that NbACR11 was localized in chloroplasts. After 6, 8, and 10 days of PVY inoculation, the expression of the NbACR11 gene was significantly downregulated and continued to decrease. Western blot analysis showed that the Anti-Flag antibody could detect NbACR11-specific bands, indicating successful gene overexpression. qRT-PCR results showed that the expression of the NbACR11 gene in the overexpression strains (NbACR11-OE1-9 and NbACR11-OE4-6) was significantly higher than that in the wild type. After PVY inoculation, UV light observation showed that the GFP fluorescence intensity of the NbACR11-OE strain was weaker than that of the wild type. PVYCP gene expression was lower in the NbACR11-OE line. SlACR11 gene expression was significantly downregulated in SlACR11-silenced plants, with a silencing efficiency of 79%. Ten days after inoculation with PVY-GFP, GFP fluorescence appeared in all systemic leaves of SlACR11-silenced plants, with fluorescence brightness and intensity higher than those in the TRV2:GUS control. qRT-PCR analysis revealed that PVYCP gene expression in SlACR11-silenced plants was significantly higher than in the control. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the subcellular localization map of NbACR11 in Nicotiana benthamiana leaves in Example 1, wherein the empty vector pCaMV35S-GFP is a negative control, Chloroplast is chloroplast autofluorescence, and Bar = 20 μm.

[0025] Figure 2 The expression analysis graph of the NbACR11 gene in Nicotiana benthamiana at different times (0, 4, 6, 8, and 10 days) after PVY inoculation in Example 2 is shown. Mock is PBS, error bars represent the standard error of three biological replicates, Student's t-test (*p value < 0.05; **p value < 0.01; ***p value < 0.001), and NbActin is the internal reference gene of Nicotiana benthamiana.

[0026] Figure 3Figure 3 shows that overexpression of the NbACR11 gene enhances the resistance of Nicotiana benthamiana to PVY. (A) Western blot detection of protein accumulation in NbACR11-overexpressing plants, OE1-9, OE2-7, OE4-6, and OE5-3 represent NbACR11 transgenic lines; Anti-Flag antibody was used to detect the protein level of NbACR11 in transgenic lines; (B) qRT-PCR detection of the expression level of the corresponding gene in NbACR11-overexpressing plants; NbActin is the internal reference gene of Nicotiana benthamiana, and the expression level of the PVY CP gene is used to represent the accumulation of PVY mRNA; (C) GFP fluorescence results of NbACR11-overexpressing plants observed under UV light 10 days after inoculation with PVY-GFP; (D) qRT-PCR detection of PVY accumulation in NbACR11-overexpressing plants after inoculation with PVY-GFP; error bars represent the standard error of three biological replicates, Student's t-test (**p value < 0.01; ***p value < 0.001; ****p value < 0.0001).

[0027] Figure 4 Figure 1 shows the effect of silencing the SlACR11 gene in tomato plants to promote PVY infection. (A) Phenotype of the positive control SlPDS (phytoene dehydrogenase) gene in money maker plants after 14 days of gene silencing; (B) The SlACR11 gene fragment was constructed into the TRV2 vector and co-infiltrated with TRV1 to test silencing efficiency 14 days after gene silencing. TRV2:GUS served as a negative control; (C) GFP fluorescence was observed under UV light in SlACR11-silenced plants inoculated with PVY-GFP 10 days after inoculation; (D) Expression analysis of the PVY CP gene in gene-silenced plants. Error bars represent the standard error of three biological replicates. Student's t-test (**p < 0.01; ***p < 0.001). SlActin is the internal reference gene for tomato. DETAILED DESCRIPTION

[0028] Example 1

[0029] Subcellular localization of NbACR11

[0030] Bioinformatics prediction (WoLF PSORTII) showed that NbACR11 (ACT domain repeat (ACR) protein) was localized in plant chloroplasts.

[0031] To further determine the subcellular localization of NbACR11, the pCaMV35S-NbACR11-GFP fusion expression vector was constructed:

[0032] Primers were designed based on the full-length CDS sequence of the NbACR11 gene (excluding the stop codon) and the restriction enzyme cleavage site sequence on the Vazyme online website (https: / / crm.vazyme.com / cetool / singlefragment.html). The primers were synthesized by Qingke Biotechnology (NbACR11-GFP-F: SEQ ID NO. 2:

[0033] 5'-agctcgggtacccggggatccATGGCTGTGGCTATGGCTTC-3';NbACR11-GFP-R: SEQ ID NO.3:

[0034] 5'-cttgctcaccatggtgtcgac AAAACTTGACTCTTCTGTTGTTGG -3';). High-fidelity Taq enzyme (TransStartFastPfuDNAPolymerase, Beijing Quanshijin Biotechnology Co., Ltd.) was used to amplify the target fragment.

[0035] Amplification program: pre-denaturation at 95°C for 5 min, denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, 40 cycles, followed by extension at 72°C for 5 min and storage at 4°C.

[0036] After the PCR reaction, the size of the PCR product fragment was detected by 1% agarose gel electrophoresis at a voltage of 120 V for 20 min, using DL2,000 DNA Marker (Takara) as a control.

[0037] The PCR product with the correct band size was purified using the SanPrep column-based DNA gel extraction kit (Shanghai Sangon Biotech Co., Ltd.) according to the manufacturer's instructions. The recovered product was stored at -20°C until use. The PCR product of NbACR11 was obtained.

[0038] Then, the vector pCaMV35S-sGFP was double-enzyme digested with the following enzyme digestion system (50 μL): 5 μL 10× Buffer, 2 μL restriction endonuclease I, 2 μL restriction endonuclease II, 2 μg pCaMV35S-sGFP empty plasmid, supplemented with ddH2O to 50 μL, and reacted at 37°C for 2 h. The enzyme digestion products were identified by 1.2% agarose gel electrophoresis and then recovered.

[0039] Finally, the PCR product and the digested vector were ligated using homologous recombination enzymes. The ligation system (10 μL) consisted of: 1 μL of double-digested product, 2 μL of target gene fragment, 5 μL of ligase, and ddH2O added to 10 μL. The ligation was performed at 50°C for 15 minutes. The resulting ligation product was immediately transformed into E. coli.

[0040] The plasmid was extracted from the positive colony, and a recombinant plasmid pCaMV35S-NbACR11-GFP was obtained. After the recombinant plasmid was transformed into Agrobacterium, the positive clone was obtained by tobacco injection, and the subcellular localization was observed by laser confocal microscopy.

[0041] The results are shown in Figure 1 The GFP fluorescence of NbACR11 coincides with the spontaneous fluorescence of plant chloroplast (red), which proves that NbACR11 is located in chloroplast.

[0042] Example 2

[0043] NbACR11 participates in the resistance of N. benthamiana to PVY

[0044] To detect the expression level of NbACR11 gene when PVY infects, samples at different times (0, 4, 6, 8, and 10 days) after PVY inoculation of N. benthamiana were taken, and RNA was extracted, and then reverse transcribed into CDNA. The expression of NbACR11 gene in each sample was detected by qRT-PCR.

[0045] The results are shown in Figure 2 There is no difference in the expression of NbACR11 in the control (inoculated with 1xPBS buffer) group, but the expression of NbACR11 gene is significantly down-regulated and continuously decreased after 6 days, 8 days, and 10 days of PVY inoculation. The above results show that NbACR11 gene participates in the resistance of N. benthamiana to PVY.

[0046] The RNA extraction adopts the Trizol method, and the steps are as follows:

[0047] (1) 0.1 g of N. benthamiana leaf sample was taken and placed in a sterile centrifuge tube, and then frozen and ground into powder;

[0048] (2) 1 mL of Trizol extraction solution was immediately added and mixed well, 200 μL of RNA extraction solution was added after 2 min, and then mixed immediately and stood for 5 min;

[0049] (3) Centrifugation at 12000 rpm for 10 min at 4°C, and the supernatant was taken into an RNase-free centrifuge tube;

[0050] (4) Immediately add an equal volume of pre-cooled isopropanol, mix gently, and then place in a -20°C refrigerator for 30 min or stand at room temperature for 10 min;

[0051] (5) After standing, centrifuge at 2000 rpm for 10 min at 4°C, carefully pour off the supernatant, and immediately add 1 mL of 70% alcohol to wash the precipitate, and repeat this step twice;

[0052] (6) Centrifuge at 12,000 rpm for 5 min at 4°C to carefully remove the alcohol and air dry. Dissolve the solution in 30 μL of DEPC water and store in a -80°C refrigerator until use.

[0053] cDNA synthesis according to III 1st Stand cDNA Synthesis Kit instructions: Synthesize cDNA using the extracted RNA as a template and store in a -20°C refrigerator until use.

[0054] Example 3

[0055] NbACR11 positively regulates Nicotiana benthamiana resistance to PVY

[0056] To test whether the NbACR11 gene has the function of resisting PVY infection, NbACR11 was stably overexpressed in Nicotiana benthamiana.

[0057] Primer Premier 6 software was used to design the CDS amplification primers for NbACR11 (SEQ ID NO. 4:

[0058] 5'-tatgaccatgattacgaattcATGGCTGTGGCTATGGCTTC-3' and SEQ ID NO.5:

[0059] 5'-caggtcgactctagaggatccAAAACTTGACTCTTCTGTTGTTGGTC-3');

[0060] Using the designed primers, the target gene was amplified from the cDNA synthesized in Example 2;

[0061] PCR amplification was performed using TransStart FastPfu FLy DNAPoLymerase (Full Gold);

[0062] Among them, the PCR amplification system is:

[0063]

[0064] The PCR products were purified using Vazyme (DC301) to obtain the products;

[0065] Construction of NbACR11-OE overexpression vector: The vector plasmid pCAMBIA1302 was digested with corresponding restriction endonucleases (EcoRI, BamHI) (Thermo, FastDiges) and the PCR products were ligated with homologous recombinases to construct the NbACR11-OE overexpression vector, namely NbACR11-pCAMBIA1302.

[0066] The enzyme digestion system was (50 μL): 5 μL 10× Buffer, 2 μL restriction endonuclease I, 2 μL restriction endonuclease II, 2 μg pCAMBIA1302 empty plasmid, supplemented with ddH2O to 50 μL, reacted at 37°C for 2 h, and the digestion products were recovered after identification by 1.2% agarose gel electrophoresis.

[0067] Ligation system (10 μL): 1 μL double-digested product, 2 μL target gene fragment, 5 μL ligase, add ddH2O to 10 μL, and ligate at 50°C for 15 min.

[0068] The obtained NbACR11-OE overexpression vector was immediately transformed into Escherichia coli;

[0069] The positive clone plasmids were extracted and transformed into Agrobacterium tumefaciens GV3101 strain, which was then used to infect Nicotiana benthamiana callus tissues to obtain T3 transgenic plants.

[0070] The transcription and protein levels of T3 transgenic plants were detected, such as Figure 3 As shown in (A), Western blot analysis results showed that the Anti-Flag antibody could detect NbACR11-specific bands, indicating that the two genes were successfully overexpressed in tobacco.

[0071] The strains NbACR11-OE1-9 and NbACR11-OE4-6 with strong protein expression were selected for gene expression analysis, such as Figure 3 As shown in (B), qRT-PCR results showed that the expression of NbACR11 gene in the above strains was significantly higher than that in the wild type.

[0072] Phenotypic determination was performed after further inoculation with PVY. The results of ultraviolet light observation showed that the GFP fluorescence intensity of the NbACR11-OE overexpression strain was weaker than that of the wild-type control ( Figure 3 C), and their corresponding PVY CP gene expression levels were also lower ( Figure 3 D), indicating that NbACR11 transgenic plants are more disease-resistant.

[0073] Experimental Example 1

[0074] Tomato (Lycopersicon esculentum) variety Moneymaker.

[0075] Tomato culture conditions: temperature 24℃, humidity 60%, light 16h, dark 8h.

[0076] Silencing tomato SlACR11 gene promotes PVY infection

[0077] Tomato was selected as the research object, and TRV-mediated gene silencing method was used to perform gene silencing in tomato,

[0078] Specifically, according to the Sol genomics Network database, SlACR11 gene silencing specific primers (SlACR11-TRV2-F primer, SEQ ID NO. 7:

[0079] 5'-gtgagtaaggttaccgaattcATGATTTCTGGGGTTTATACTAATTTAA-3' and SlACR11-TRV2-R primer, SEQ ID NO. 8:

[0080] 5'-cgtgagctcggtaccggatccTGTGTCAAGAAGAGCCCCAA-3') were designed and amplified, and a fusion expression vector TRV2:SlACR11 was constructed, which was co-infected with TRV1 into tomato leaves for 14 days. Then the silenced plants were inoculated with PVY-GFP by rubbing, and the infection was analyzed.

[0081] The positive control TRV2:SlPDS system leaves and new leaves were white, and the negative control TRV2:GUS did not appear white, indicating that the silencing effect was good Figure 4 A).

[0082] In order to detect the silencing efficiency, the system leaves of the control group (TRV2:GUS) and the SlACR11 silenced group were taken, and the silencing efficiency of the above genes was detected by qRT-PCR. The results showed that compared with the control, the expression of SlACR11 gene was significantly down-regulated, and the silencing efficiency was 79% Figure 4 B).

[0083] Among them, the calculation method of silencing efficiency is: divide the average value of qRT-PCR expression of SlACR11 gene in the silenced plant by the control group.

[0084] The leaves of the gene-silenced plants and the control plants were inoculated with PVY-GFP. The GFP fluorescence signal was observed under UV light 10 days after infection. The results showed that GFP fluorescence appeared in the leaves of the SlACR11 gene-silenced plants, and the fluorescence brightness and intensity were higher than those of the control TRV2:GUS plants ( Figure 4 C).

[0085] Subsequently, the RNA of the above samples was extracted and reverse transcribed, and the expression of PVY CP gene was detected by qRT-PCR. The results showed that the expression level of PVY CP gene was significantly higher after silencing the tomato SlACR11 gene than that of the control group ( Figure 4 D), showing that PVY accumulated more in silenced plants.

[0086] The above results indicate that SlACR11 plays a positive regulatory role in tomato resistance to PVY infection.

[0087] NbACR11 gene sequence, SEQ ID NO.1:

[0088] 5'-ATGGCTGTGGCTATGGCTTCTTGTGGGATAATTTCTGGGATTCACACT -3';

[0089] NbACR11-GFP-F引物,SEQ ID NO.2:

[0090] 5'-agctcgggtacccggggatccATGGCTGTGGCTATGGCTTC-3';

[0091] NbACR11-GFP-R primer, SEQ ID NO. 3:

[0092] 5'-cttgctcaccatggtgtcgacAAAACTTGACTCTTCTGTTGTTGG-3';

[0093] NbACR11-OE-F: SEQ ID NO. 4:

[0094] 5'-tatgaccatgattacgaattcATGGCTGTGGCTATGGCTTC-3';

[0095] NbACR11-OE-R: SEQ ID NO.5:

[0096] 5'-caggtcgactctagaggatccAAAACTTGACTCTTCTGTTGTTGGTC-3'.

[0097] S1ACR11 gene sequence, SEQ ID NO.6:

[0098] 5'-ATGGCTGTGGCTATGGCTTCTTGTGGGAGCATTTCTGGGGTTTATACT AATTTAAATGCAATTGAGAAAATACCCATTTCAAGTTCAGTTCTCTTCAGAGGTTCTTTTGGTTTGGATCCTGTACAGAGAATATGCCTTGTTCCCAAGAGATTAGCTTTTTCTGAGAGTACAATTATTCCAAAAGCATCTTCAACTGCAGCTGTTGAGGGTGGAAGTTCCCAAGATACTGCTGTCCCAACGCCCAAAGTCATAATAGATTTGGATTCGGATCCAGAAACAACTGTAGTGGAGGTTACCTTTGGTGATCGCCTTGGGGCTCTTCTTGACACAATGACTGCACTAAAAAATCTTGGACTGAATGTTGTCAAGGCTAATGTCTATCTAGATTCATCAGGGAAGCACAATAAATTATGCATCACACATGCTTCTACAGGTAGAAAGGTTGAGGATCCAGAGCTGCTAGAAGCAATTCGATTGACAATTATCAACAATTTGATGGAGTTTCATCCGGAATCTAGCTCTCAGTTAGCTATGGGTGAAGCCTTTGGTGCTTTTCAACCAAGTCAAAAGCTAGATGTGGACATAGCAACTCATATCCATGTCTATGATGATGGTCCTGAACGAAGCTTACTGTGTGTAGAGGCAGCAGATCGACCTGGATTAATAGTTGATCTCGTCAAGATCATTACTGAAATAAACATTGATGTTATATCAGGAGAATTTGACACCGAGGGACTGCTAGCTAAGGCAAAATTTCATGTAAGCTACAAGAACAAAGCTCTCATCAAACCCCTTCAACAGGTTCTTGCAAACAGCTTGCGCTATTACTTGAGGAGACCAACAACAAACGAGTCAAGCTTCTAA-3';

[0099] SlACR11-TRV2-F引物,SEQ ID NO.7:

[0100] 5'-gtgagtaaggttaccgaattcATGATTTCTGGGGTTTATACTAATTTAA-3';

[0101] S1ACR11-TRV2-R primer, SEQ ID NO.8:

[0102] 5'-cgtgagctcggtaccggatccTGTGTCAAGAAGAGCCCCAA-3'.

[0103] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of the ACR11 gene in enhancing plant PVY resistance, characterized in that: By increasing the expression level of the ACR11 gene in plants, the accumulation of viruses after PVY infection is reduced; Among them, the ACR11 gene is SEQ ID NO.1 or SEQ ID NO.

6.

2. The use according to claim 1, characterized in that The protein encoded by the gene is localized in plant chloroplasts.

3. The use according to claim 1, characterized in that The plant is a Solanaceae plant.

4. The use according to claim 3, characterized in that The Solanaceae plant is Nicotiana benthamiana or tomato.

5. The use according to claim 1 or 2, characterized in that: The gene is derived from Nicotiana benthamiana or tomato.

6. A method for constructing a PVY-resistant plant, characterized in that: The following steps are involved: (1) Amplify the target gene using the primer pair of SEQ ID NO. 4 and SEQ ID NO. 5 to obtain a PCR product; (2) Construction of NbACR11-OE overexpression vector; (3) transforming the NbACR11-OE overexpression vector obtained in step (2) into Escherichia coli and extracting the positive clone plasmid; (4) The plasmid is transformed into Agrobacterium, which infects plant callus tissue to obtain transgenic plants.

7. The method according to claim 6, characterized in that The NbACR11-OE overexpression vector was constructed as follows: The vector plasmid pCAMBIA1302 was digested with restriction endonucleases EcoRI and BamHI, and then ligated with the PCR product to construct the NbACR11-OE overexpression vector.

8. A method for cultivating PVY-resistant plants, characterized in that: The steps include: (1) introducing the ACR11 gene described in claim 1 into a target plant to obtain a transgenic plant; (2) Plants overexpressing the gene were screened, and their PVY resistance was higher than that of the wild type.

Images