Application of gene OsRGA2 to improvement of disease and pest resistance of rice

Abstract

The invention discloses application of a gene OsRGA2 to improvement of disease and insect pest resistance of rice, and the gene OsRGA2 can enhance the disease and insect pest resistance of rice to brown planthopper, bacterial leaf blight and the like, and is used for cultivating a new variety of disease and insect pest resistant rice.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology, and in particular relates to the use of the gene OsRGA2 in improving the resistance of rice to diseases and insect pests and creating disease- and insect-resistant rice germplasm resources. Background Art

[0002] Plants have evolved a multi-layered defense network to defend against diverse pathogens: pattern recognition receptors (PRRs) on the cell membrane first capture pathogen-associated molecular patterns (PAMPs), triggering primary immunity (PTI), forming the first line of defense; then, intracellular NLRs receptors detect effector proteins secreted by pathogens, initiating more intense effector-triggered immunity (ETI), serving as the second line of defense (Jones et al., 2024). NLRs are characterized by nucleotide binding domains (NBS) and leucine-rich repeat regions (LRRs), which can directly or indirectly recognize effector proteins and play a central role in signal transduction ( and Kourelis, 2023; Liu et al., 2023; Zhou and Zhang, 2020).

[0003] The N-terminus of NLR receptors contains three conserved modules: a Toll / interleukin-1 receptor (TIR)-like structure, a coiled-coil (CC), and resistance to powdery mildew 8 (RPW8). The CC and TIR mediate protein-protein interactions to determine the assembly of immune complexes. The CC module of rice BRG8 can both self-oligomerize and bind to HOS59 to promote its degradation, thereby regulating resistance to bacterial blight and rice blast (Xu et al., 2024). The CC segment of PibH8 can also self-assemble and interact with the CC of Pib (Wang et al., 2024). In flax, grapes, and Arabidopsis, at least six TIR-NLR members can bind to NbEDS1 (Chen et al., 2024).

[0004] To achieve pathogen recognition, numerous NLR proteins must localize to the plasma membrane, with their CC domains being crucial for membrane targeting. Cryo-electron microscopy revealed that the ZAR1 resistance complex assembles in an N-terminal pentamerized fashion, with a negatively charged cluster on the CC surface mediating transmembrane cation flux (Bi et al., 2021). This membrane localization is regulated by an N-terminal MADA motif, which is functionally conserved among monocot and dicot CC-NLRs. While members of the NRC-H family generally retain the MADA motif, NRC-dependent sensor-type NLRs lack it, suggesting its evolutionary degeneration (Adachi et al., 2019). Furthermore, some NLRs (such as MLA10, Pib, and N) are localized in the nucleus or cytoplasm and participate in immune regulation through interactions with nuclear transcription factors (Inoue et al., 2013; Padmanabhan et al., 2013; Shen et al., 2007).

[0005] Among NLR proteins, the LRR region is poorly conserved and is a key module that confers protein specificity and inhibits receptor activity in the resting state (Ade et al., 2007; Ellis and Jones, 1998). The TIR region of nearly all NLRs contains a C-JID motif, which is thought to expand the ligand recognition spectrum. The LRR and C-JID of tobacco ROQ1 jointly contact the surface and active site of pathogenic effectors, disrupting the autoinhibitory conformation between NB-ARC and the LRR, prompting NB-ARC to enter an activated state where it binds to ATP and oligomerizes, thereby triggering immunity (Martin et al., 2020). Similarly, Arabidopsis RPP1 utilizes its LRR and C-JID to recognize ATR1, relieve autoinhibition, and initiate defense (Ma et al., 2020).

[0006] NLR proteins play a key role in plant immunity. Studying the genes encoding NLR proteins is of great significance for the study of rice resistance mechanisms and the development of resistant varieties. Summary of the Invention

[0007] In our research on rice immunity-related proteins and genes, specifically the major QTLs for resistance to brown planthoppers and bacterial blight, we identified OsRGA2 (gene sequence number: LOC_Os07g04900, http: / / rice.plantbiology.msu.edu / ), encoding a CC-NBS protein lacking an LRR domain. We constructed OsRGA2 overexpression and knockout strains and conducted basic research, finding that OsRGA2 overexpression lines play a role in rice resistance to both brown planthoppers and bacterial blight. Accordingly, the present invention includes the following technical solutions.

[0008] The application provides a CC-NBS type protein RGA2 (or OsRGA2) with a deleted LRR domain and a use of a gene OsRGA2 encoding the same for improving the resistance of a Poaceae crop to diseases and pests.

[0009] The CC-NBS type protein RGA2 is a polypeptide as shown in SEQ ID NO: 1 or a conservative variant polypeptide thereof, the conservative variant polypeptide being a polypeptide with more than 90% homology, preferably more than 92% homology, preferably more than 95% homology, preferably more than 96% homology, preferably more than 97% homology, preferably more than 98% homology, more preferably more than 99% homology to RGA2 and having the function of the CC-NBS type protein RGA2, i.e. regulating plant immunity through CC domain oligomerization.

[0010] In one embodiment, the gene OsRGA2 has a gene number of LOC_Os07g04900 (http: / / rice.plantbiology.msu.edu / ) and a nucleotide sequence of SEQ ID NO: 2.

[0011] The diseases and pests are caused by, for example, Nilaparvata lugens and / or Xanthomonas oryzae pv. oryzae, and accordingly, the resistance to diseases and pests is the resistance to diseases and pests caused by, for example, Nilaparvata lugens and / or Xanthomonas oryzae pv. oryzae.

[0012] The Poaceae crop is selected from rice, wheat, corn, soybean, barley, oat, rye and sorghum, and is preferably rice.

[0013] Further, the rice is japonica rice or indica rice, and is selected from Nangjinyang 46 (NJ46), Koshihikari, Longjinyang 31 (LG31), Kongyu 131, HP486, HP274, HP119, HP341, HP362, HP327, HP492, HP577, HP396, GP72, HP407, GP134, GP3, GP51, HP263, GP669, GP567, GP677, HP91, UR28, HP48, HP103, HP314, GP551, HP11, HP390, GP688, GP104, GP124, GP536, XA384, XA85, XF1822, Wuyunjing 7, Guangluai 4, Nipponbare (NPB), Kasa, Huahui 8612, ZH11, Hejiang 19, Kendao No. 8, Nangjing 38, Longhua 96-1513, Huanghuazhan, Zhongjiazao 17 and Wuyoudao 4.

[0014] In a specific embodiment, the above use is to use the gene OsRGA2 to improve the resistance of crops to diseases and pests, breed disease and pest resistant crop varieties, or create disease and pest resistant rice germplasm resources.

[0015] The above use is implemented by causing the crops to overexpress the CC-NBS type protein RGA2 / coding gene OsRGA2 as described above.

[0016] Alternatively, the CC-NBS type protein RGA2 or its coding gene OsRGA2 is overexpressed in crops such as rice by the following methods:

[0017] A. The coding gene OsRGA2 of the CC-NBS type protein RGA2, such as the nucleotide sequence SEQ ID NO: 2, is cloned on a plasmid vector, preferably a plasmid vector suitable for expression in Agrobacterium, to form a recombinant plasmid, i.e. a CC-NBS type protein RGA2 overexpression vector, and then the plant cells or tissues are transformed by using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation or Agrobacterium-mediated transformation, and the transformed plant tissues are cultivated into plants, preferably the plants are transformed by Agrobacterium-mediated transformation, to obtain transgenic plants overexpressing the CC-NBS type protein RGA2; or

[0018] B. The coding gene OsRGA2 of the CC-NBS type protein RGA2, such as the nucleotide sequence SEQ ID NO: 2, is cloned on the plant chromosome by gene editing technology to obtain transgenic plants overexpressing the CC-NBS type protein RGA2; or

[0019] C. The existing coding gene of the CC-NBS type protein RGA2 in the plant genome is placed under the regulation of a functionally enhanced promoter, such as the Cauliflower Mosaic Virus (CAMV) 35S promoter, the Ubiquitin promoter of maize, i.e. the Ubi promoter.

[0020] In step A, the plasmid vector is selected from binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment, such as pHB-YFP, pHB-FLAG, pBin19, pUN1301, the fluorescent reporter vector pGreenII0800-LUC, pCAMBIA3300, pCAMBIA1300, pCAMBIA1301, pCAMBIA2300, pCAMBIA2301, pBI121, pTF102, etc. plant transgenic vectors or modified vectors.

[0021] The Agrobacterium can be selected from Agrobacterium tumefaciens, Agrobacterium EHA105, Agrobacterium GV3101. For example, the recombinant plasmid is transformed into the Agrobacterium strain by freeze-thaw method to form a microbial engineering strain.

[0022] The gene editing technology in step B can be selected from the group consisting of homologous double exchange, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, MuGENT.

[0023] In an embodiment, the crop is rice, and the 35S promoter is used to regulate the expression of the CC-NBS class protein RGA2 coding gene OsRGA2, such as the nucleotide sequence SEQ ID NO: 2, in step C.

[0024] The present study found that a CC-NBS class protein RGA2 with a deleted LRR domain can regulate plant immunity through CC domain oligomerization, which can effectively improve the function of rice resistance to pests and diseases, and defend against the invasion of brown planthoppers and white leaf blight bacteria, and the coding gene OsRGA2 can be used as a genetic resource to cultivate crop varieties resistant to pests and diseases or create germplasm resources of rice resistant to pests and diseases. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 The detection of OsRGA2 overexpression and knockout materials is shown. Among them, A: expression detection of OsRGA2 gene in OsRGA2 overexpression materials, OsRGA2-OE5 and OsRGA2-OE7 are overexpression lines; B: osrga2 knockout site diagram, osrga2-1 and osrga2-2 are gene knockout lines.

[0026] Figure 2 The response of OsRGA2 to brown planthopper feeding and white leaf blight invasion is shown. Among them, A: response of OsRGA2 to brown planthopper feeding; B: response of OsRGA2 to white leaf blight invasion.

[0027] Figure 3 The expression of the gene OsRGA2 in different tissue parts of rice is shown.

[0028] Figure 4 The brown planthopper resistance identification of OsRGA2 gene editing materials is shown. Among them, A: phenotype photos of single plant brown planthopper resistance identification of OsRGA2 gene editing materials; B: phenotype photos of small population brown planthopper resistance identification of OsRGA2 gene editing materials; C: mortality statistics of small population brown planthopper resistance identification of OsRGA2 gene editing materials.

[0029] Figure 5The results of bacterial blight resistance evaluation of OsRGA2 gene-edited materials are shown. A: Photo of lesions on leaves of OsRGA2 gene-edited materials 14 days after bacterial blight inoculation; B: Statistical analysis of lesion length on leaves of OsRGA2 gene-edited materials 14 days after bacterial blight inoculation.

[0030] Figure 6 Shows photos of yeast two-hybrid detection of the interactions between different domains of OsRGA2. DETAILED DESCRIPTION

[0031] Breeding pest-resistant varieties is an important means of green pest and disease control in crops. Research on plant immunity and resistance provides a theoretical basis for crop production and has significant economic value. Brown planthoppers and bacterial blight are both serious pests and diseases that harm rice production. Current methods of controlling these pests and diseases rely on pesticides, which not only pollute the environment but also significantly increase rice production costs.

[0032] In our research on rice immunity, we screened the major QTL genes for disease and pest resistance in NLR protein genes and found that a CC-NBS protein RGA2 lacking the LRR domain was positively correlated with rice resistance to brown planthoppers and bacterial blight. RGA2 can regulate plant immunity through CC domain oligomerization.

[0033] These results suggest that RGA2 or its conservative variant polypeptides can improve rice's resistance to pests and diseases, including resistance to brown planthoppers and bacterial blight.

[0034] Those skilled in the art can anticipate that the protein RGA2 / gene OsRGA2 may also be applied to other grass crops such as wheat, corn, soybean, barley, oats, rye, and sorghum to improve plant resistance to pests and diseases such as brown planthopper and / or bacterial blight. Therefore, the gene OsRGA2 can be used in disease-resistant breeding and the creation of disease- and pest-resistant crop germplasm resources.

[0035] Those skilled in the art can expect that it is reasonable that conservative variant polypeptides of the protein RGA2 having a high homology (identity) with the amino acid sequence of SEQ ID NO: 1, for example, more than 90%, have the same or similar functions.

[0036] As used herein, the term "conservative variant polypeptide" refers to a polypeptide that substantially retains the same biological function or activity of the polypeptide. The variation refers, in particular, to a small number of amino acid mutations, wherein the "mutation" includes, but is not limited to, replacement, deletion, insertion, or chemical modification of amino acid residues, preferably a forward mutation, i.e., a mutation that improves the function of the RGA2 protein. The substitution may be a non-conservative substitution, a conservative substitution, or a combination of non-conservative and conservative substitutions. "Conservative" amino acid substitutions or mutations refer to the interchangeability of residues with similar side chains, and therefore generally include replacing amino acids in a polypeptide with amino acids from the same or similar amino acid-defined classes. However, as used herein, if a conservative mutation can instead be aliphatic to aliphatic, non-polar to non-polar, polar to polar, acidic to acidic, basic to basic, aromatic to aromatic, or constrained residue to constrained residue substitution, then a conservative mutation does not include hydrophilic to hydrophilic, hydrophobic to hydrophobic, hydroxyl-containing to hydroxyl-containing, or small residue to small residue substitutions. As is well known in the art, common conservative substitutions include: substitutions between aromatic amino acids F, W, and Y; substitutions between hydrophobic amino acids L, I, and V; substitutions between polar amino acids Q and N; substitutions between basic amino acids K, R, and H; substitutions between acidic amino acids D and E; and substitutions between hydroxyl amino acids S and T. Furthermore, A, V, L, or I can be conservatively mutated to another aliphatic residue or another non-polar residue. Exemplary conservative substitutions can be made, for example, according to the table below.

[0037]

[0038]

[0039] "Non-conservative substitutions" refer to the substitution or mutation of an amino acid in a polypeptide with an amino acid having significantly different side chain properties. Non-conservative substitutions can use amino acids between, rather than within, the defined groups listed above. In one embodiment, a non-conservative mutation affects (a) the structure of the peptide backbone in the region of the substitution (e.g., proline for glycine), (b) charge or hydrophobicity, or (c) side chain bulk.

[0040] "Deletion" refers to a modification of a polypeptide by removing one or more amino acids from a reference polypeptide. Deletion can include the removal of 1 or more amino acids, 2 or more amino acids, 5 or more amino acids, 10 or more amino acids, 15 or more amino acids, or 20 or more amino acids, up to 10% of the total number of amino acids comprising the reference RGA2 (SEQ ID NO: 1) sequence, while retaining the improved properties of RGA2 function. Deletions can be internal and / or terminal to the polypeptide. In various embodiments, deletions can comprise continuous segments or can be discontinuous.

[0041] "Insertion" refers to the modification of a polypeptide by adding one or more amino acids from a reference polypeptide. In some embodiments, the improved engineered RGA2 includes the insertion of one or more amino acids into naturally occurring RGA2 and the insertion of one or more amino acids into other improved RGA2 polypeptides. Insertions can be internal to the polypeptide, or at the carboxyl or amino termini. As used herein, insertions include fusion proteins as known in the art. Insertions can be continuous amino acid segments or separated by one or more amino acids from the naturally occurring polypeptide.

[0042] To achieve expression of the OsRGA2 gene in crops such as rice, the OsRGA2 gene or its coding region sequence or its coding region sequence can be used as an exogenous gene to construct a gene expression cassette or expression construct as a DNA molecule. The expression cassette / expression construct is operably linked to a plasmid vector by subcloning to obtain a recombinant plasmid. The recombinant plasmid is then transformed into a host cell to obtain a transformant, i.e., a genetically engineered bacterium or recombinant bacteria, or is transferred into a plant through Agrobacterium-mediated methods to obtain a transgenic plant.

[0043] As used herein, the terms "increase (resistance to pests and diseases)", "enhance" or "enhance" may mean an increase of at least 10% compared to a reference level (such as wild-type rice), for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a 100% increase, or any increase between 10% and 100%, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times compared to a reference level.

[0044] In the description of the technical solutions of the present invention, the term "and / or" as used in phrases such as "A and / or B", "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" as used in phrases such as "A, B and / or C" is intended to cover each of the following embodiments: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0045] As used herein, the "expression cassette" or "gene expression cassette" refers to a gene expression system that contains all the necessary elements required to express the target gene OsRGA2, generally including the following elements: a promoter, a gene sequence encoding a polypeptide, and a terminator; in addition, it may optionally include a signal peptide encoding sequence such as mCherry (red fluorescent protein), GFP (green fluorescent protein), or YFP (yellow fluorescent protein); these elements are operably linked.

[0046] As used herein, the term "expression construct" or "expression construct" refers to a recombinant DNA molecule comprising the desired gene OsRGA2 or coding region sequence thereof, which can comprise one or more gene expression cassettes. The "construct" is typically contained in an expression vector (plasmid vector).

[0047] As used herein, the term "exogenous" or "heterologous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or between a protein (or nucleic acid) from a different source and a host cell. For example, a nucleic acid is exogenous to a host cell if the combination of the nucleic acid and the host cell is not naturally occurring. A particular sequence is "exogenous" to the cell or organism into which it is inserted.

[0048] As used herein, the term "operably linked" or "operatively linked" refers to the functional placement of two or more nucleic acid regions or nucleic acid sequences in a specific location relative to each other. For example, a promoter region is placed in a specific location relative to a gene OsRGA2 of interest such that transcription of the nucleic acid sequence is directed by the promoter region, and thus the promoter region is "operably linked" to the nucleic acid sequence.

[0049] The nucleic acid construct of the present application can be manipulated in a variety of ways to ensure expression of the gene OsRGA2. Manipulation of the nucleic acid construct prior to its insertion into a vector can be desired for a variety of reasons, for example, to direct the expression of the gene OsRGA2 in the desired host. Recombinant DNA techniques can be used to alter the polynucleotide sequence.

[0050] In certain embodiments, the nucleic acid construct is a vector. The vector can be a cloning vector, an expression vector, or a gene knock-in vector. The gene OsRGA2 or coding region sequence thereof can be cloned into a number of types of vectors, for example, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Cloning vectors can be used to provide the coding sequence of the protein or polypeptide of the present application. Expression vectors can be provided to cells in the form of bacterial vectors or viral vectors. Expression of the gene OsRGA2 or nucleic acid sequence is typically achieved by operably linking the gene OsRGA2 or nucleic acid sequence to a promoter and incorporating the construct into an expression vector. The vector can be suitable for replication and integration in eukaryotic cells. Typical expression vectors contain expression control sequences that are useful in regulating the expression of the desired nucleic acid sequence.

[0051] A knock-in vector can be used to integrate the gene OsRGA2 described herein or its coding region sequence into a region of interest in the host genome. Typically, in addition to containing the polynucleotide sequence, the knock-in vector may also contain a 5' homology arm and a 3' homology arm required for genomic homologous recombination. In some embodiments, the nucleic acid construct herein contains a 5' homology arm, a polynucleotide sequence described herein, and a 3' homology arm. When using a knock-in vector, CRISPR / Cas9 technology can be simultaneously used to homologously recombine the polynucleotide sequence into the location of interest. CRISPR / Cas9 technology uses a guide RNA designed to target the target gene, thereby guiding the Cas9 nuclease to modify the genome at the insertion location, resulting in an increased efficiency of homologous recombination in the gene-modified region, and homologously recombine the target gene OsRGA2 or sequence fragment contained in the knock-in vector into the target site. The steps of CRISPR / Cas9 technology and the reagents used, such as Cas9 nuclease, are well known in the art.

[0052] Methods well known to those skilled in the art can be used to construct nucleic acid constructs. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, and the like. The DNA sequence can be operatively linked to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters include the lac or trp promoters of Escherichia coli; the lambda phage PL promoter; eukaryotic promoters including the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoter, the LTRs of retroviruses, and other known promoters that control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. In addition, the expression vector preferably contains one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline, ampicillin resistance, or chloramphenicol for E. coli and Agrobacterium.

[0053] When the polynucleotides of the present invention are expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting DNA factors, typically about 10 to 300 base pairs in length, that act on promoters to increase gene transcription. Examples include the SV40 enhancer (100 to 270 base pairs on the late replication origin side), the polyoma enhancer on the late replication origin side, and adenovirus enhancers.

[0054] A vector containing an appropriate DNA sequence and an appropriate promoter or control sequence can be used to transform an appropriate host cell to enable it to express the protein.

[0055] In the construction of transgenic plants using the traditional Agrobacterium-mediated method, the construction method of the transgenic plants comprises:

[0056] 1) providing Agrobacterium carrying an expression vector containing the gene OsRGA2 or its coding region sequence;

[0057] 2) contacting plant cells or tissues or organs with the Agrobacterium in step 1) to transfer the coding sequence into the plant cells and integrate into the chromosomes of the plant cells;

[0058] 3) selecting plant cells or tissues into which the coding sequence is transferred; and

[0059] 4) regenerating plants from the plant cells or tissues in step 3).

[0060] The present application will be further described in detail below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present application and are not used to limit the scope of the present application.

[0061] Examples

[0062] In the examples, the addition amount, content and concentration of various substances are involved, and the percentage content referred to herein refers to the mass percentage content unless otherwise specified.

[0063] In the examples, if no specific temperature is specified for the operation temperature, the temperature generally refers to room temperature (15-35°C).

[0064] The molecular biology experiments in the examples include plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, medium preparation, etc., which are mainly performed according to the Molecular Cloning Laboratory Manual (4th Edition), M.R. Green, J. Sambrook (USA) edited, He Fuchu translated, Science Press, Beijing, 2017. If necessary, the specific experimental conditions can be determined by simple tests.

[0065] The PCR amplification experiments are performed according to the reaction conditions or kit instructions provided by the plasmid or DNA template supplier. If necessary, they can be adjusted by simple tests.

[0066] The primer synthesis and gene sequencing in the examples are completed by Shengong Bioengineering (Shanghai) Co., Ltd.

[0067] The molecular biology methods including the construction of the gene OsRGA2 overexpression plasmid, the construction of the CRISPR / cas9 plasmid, the Agrobacterium-mediated transformation, the gene editing technology, and the transgenic plant construction method are operated by using the technical means commonly used in the art.

[0068] Main experimental contents and rice materials

[0069] 1. Test materials

[0070] Japonica rice (Oryza sativa L. subsp. Japonica) cultivar Zhonghua 11 (ZH11) served as the background material for this study. During summer, rice was cultivated at the Shanghai Songjiang Experimental Field, Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, using standard field rice cultivation practices. During winter, rice was grown in a climatic chamber at the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, at 29°C ± 1°C, relative humidity 50-70% ± 5%, and a photoperiod of 7:00 AM to 7:00 PM.

[0071] 2. CRISPR / Cas9 vector construction

[0072] To design a specific sgRNA gene for OsRGA2, complementary oligonucleotides (forward sequence SEQ ID NO: 3 and reverse sequence SEQ ID NO: 4) were synthesized and annealed in vitro to form a double-stranded sgRNA fragment. This fragment was then cloned into the pOs-sgRNA intermediate vector and then cloned into the pH-Ubi-cas9 vector. For more information about these vectors, see reference (Miao et al., 2013).

[0073] 3. Genetic Transformation

[0074] Rice transformation was completed based on the Agrobacterium-mediated method reported by Hiei et al. and combined with the improved process of our laboratory (Hiei et al., 1994).

[0075] 4. Determination of resistance to brown planthoppers in individual plants

[0076] After germination, seeds were sown individually in small plastic pots and maintained normally in a greenhouse for approximately one month until they began to tiller. Individual plants were covered with a 40 cm tall, 8 cm diameter transparent plastic cover with a 6 cm x 10 cm mesh vent on one side and covered with mesh at the top. Fifteen third-instar nymphs were inoculated into each column, and the number of brown planthoppers was reconfirmed the following day. The plants were incubated in the greenhouse for 5-8 days, and the survival of the plants was observed.

[0077] 5. Resistance Determination of Small Populations of Brown Planthoppers

[0078] Germinated rice seeds were sown in blue plastic boxes at 5 rows × 10 plants / row. The control and treatment plants were arranged symmetrically. They were cultured in the greenhouse until they reached the two-leaf and one-heart stage and were inoculated with brown planthoppers (NLP), with 10 nymphs per plant. The damage was observed and photographed daily, and the rice mortality rate was calculated. Three replicates were set.

[0079] 6. Bacterial blight resistance assay

[0080] Xanthomonas oryzae pv.oryzae, Xoo) PXO99A was cultured in PSA medium at 28°C for 2-3 days and diluted with sterile water to OD600 = 0.5. Inoculate leaves 1 cm from the leaf tip. No more than three leaves should be inoculated per dip. For each rice line, inoculate 20 leaves. After 14 days, observe and photograph the leaf phenotype, and calculate and analyze the lesion length.

[0081] 8. Yeast Two-Hybrid Assay

[0082] The CDSs sequences of different domains of OsRGA2 were cloned and constructed in the pGADT7 / pGBKT7 vector, transformed into yeast AH109 and cultured in a two-deficient medium (+ADE+HIS-TRP-LEU). After 3 days, a single colony was picked and diluted with sterile water to OD 600 1, and serially diluted, 10 μl was dropped onto the two-deficiency medium and the four-deficiency medium (-ADE-HIS-TRP-LEU), and the results were observed and photographed after 3 days.

[0083] Some of the PCR primers used in the examples are listed in Table 1.

[0084] Table 1. Some PCR primers used in the examples

[0085]

[0086]

[0087] In Table 1, "-F" in the name stands for forward direction; "-R" stands for reverse direction.

[0088] Example 1: Construction of OsRGA2 overexpression mutant

[0089] The OsRGA2 gene sequence number is LOC_Os07g04900 (http: / / rice.plantbiology.msu.edu / ). We first used homologous recombination to construct the CDS fragment of OsRGA2 into the p1301-35S-Nos vector. This vector was then transformed into the japonica rice variety Zhonghua 11 using Agrobacterium-mediated transfection. Ultimately, two independent high-expressing lines (OsRGA2-OE5 and OsRGA2-OE7) were screened and obtained. qRT-PCR results showed that the transcriptional level of OsRGA2 in these transgenic lines was approximately 15-fold higher than that in the wild type ( Figure 1 Middle A).

[0090] The method for constructing an OsRGA2 overexpression mutant comprises the following steps:

[0091] 1. Amplify the CDS fragment of OsRGA2 from the cDNA of ZH11 using primers OsRGA2-FL-F and OsRGA2-FL-R and purify it.

[0092] OsRGA2-FL-F: ATGGATACCGGGATCATCGTGG,

[0093] OsRGA2-FL-R: GAGAATTAGTTCGATTTCTGGGTT;

[0094] 2. Homologous recombination of CDS fragment of OsRGA2 into p1301-35sNos vector with Xbal I and Kpn-I sites.

[0095] 3. After sequencing verification, the vector is transformed into Agrobacterium EHA105 strain.

[0096] 4. The vector is transformed into immature embryos of rice ZH11 by Agrobacterium-mediated method to obtain transgenic rice overexpressing OsRGA2.

[0097] The transgenic rice obtained by the above method is identified at the genome level, and OsRGA2 overexpression lines OsRGA2-OE5 and OsRGA2-OE7 are obtained.

[0098] Example 2: Construction of gene OsRGA2 knockout mutant

[0099] We edited the gene by CRISPR / Cas9 system: specific sgRNA was designed for OsRGA2, synthesized and annealed to form double-stranded, then cloned into Crisper (UBI, OsU6) vector, and then transformed into Zhonghua 11 by Agrobacterium-mediated method; molecular biology identification obtained multiple homozygous deletion mutants at target site, including osrga2-1 and osrga2-2.

[0100] Among them, the sgRNA gene sequence specific to the OsRGA2 gene includes:

[0101] Forward sequence OsRGA2-F: 5'-TGAACCCTGTGTTAGACGGC-3' (SEQ ID NO: 3);

[0102] Reverse sequence OsRGA2-R: 5'-GCCGTCTAACACAGGGTTCA-3' (SEQ ID NO: 4).

[0103] The difference between the two mutants osrga2-1 and osrga2-2 is that osrga2-1 is a deletion of the 53rd to 62nd of the coding region of the gene OsRGA2, resulting in premature termination of translation of OsRGA2 protein; osrga2-2 is a deletion of the 53rd to 59th of the coding region of the gene OsRGA2, resulting in premature termination of translation of OsRGA2 protein.

[0104] The method for constructing the gene knockout mutant comprises the following steps:

[0105] 1. The knockout target sequence is designed using the online website http: / / skl.scau.edu.cn, and the nucleic acid fragment "TGAACCCTGTGTTAGACGGC" in the conserved region of the gene OsRGA2 is selected as the target sequence according to the sequence, position, positive and negative chain, GC content, potential off-target site and evaluation information of the candidate target point.

[0106] 2. The target sequence is introduced into the downstream of the U3 / U6 promoter and the upstream of the sgRNA sequence by performing PCR using primers U-F and OsRGA2-, OsRGA2-F and gR-R respectively,

[0107] U-F: CTCCGTTTTACCTGTGGAATCG,

[0108] OsRGA2-R: GCCGTCTAACACAGGGTTCACggcagccaagccagca,

[0109] OsRGA2-F: TGAACCCTGTGTTAGACGGCgttttagagctagaaat,

[0110] gR-R: CGGAGGAAAATTCCATCCAC;

[0111] 3. The two fragments are recovered respectively, and the product mixture is subjected to PCR using primers Pps-R and Pgs-2 and the product is purified, so as to construct the complete expression cassette of the promoter, target point and sgRNA,

[0112] Pps-R: TTCAGAggtctcTaccgACTAGTCACGCGTATGGAATCGGCAGCAAA,

[0113] Pgs-2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC.

[0114] 4. The sgRNA expression cassette is assembled into the pYLCRISPR / Cas9 vector by using the Bsa I enzyme and the T4 DNA ligase through the method of cutting and connecting at the same time;

[0115] 5. After the vector is verified by sequencing, the Agrobacterium EHA105 strain is transformed;

[0116] 6. The vector is transformed into the immature embryo of rice ZH11 by using the Agrobacterium-mediated method, and the CRISPR transgenic rice is obtained.

[0117] The transgenic rice obtained by the above method was identified at the genome level, and the OsRGA2 gene knockout mutants osrga2-1 and osrga2-2 were obtained. Their sequence information is as follows Figure 1 As shown in B, both strains had deletion mutations compared to the wild type.

[0118] Example 3: Structural and functional analysis of OsRGA2 protein

[0119] In order to study the functional mechanism of CC-NBS protein RGA2 lacking LRR domain in regulating plant immunity, we used yeast two-hybrid assay to detect the interaction between different domains of OsRGA2 protein.

[0120] The yeast two-hybrid experiment generally includes the following steps:

[0121] 1. Using primers OsRGA2-CC-F and OsRGA2-CC-R, and OsRGA2-NB-F and OsRGA2-NB-R, fragments OsRGA2-CC and OsRGA2-NB were amplified from the OsRGA2 coding region, respectively.

[0122] OsRGA2-CC-F: GGGCCCAATGTGGATGCCCTC,

[0123] OsRGA2-CC-R:GATGCGGAAGTAGTCGAGCTCG,

[0124] OsRGA2-NB-F:ACAAGTATAGAGCCCACCCTGT,

[0125] OsRGA2-NB-R(TTCGGAATGTAAAATATCTAGTC;

[0126] 2. The purified OsRGA2-CC and OsRGA2-NB were constructed into plasmids pGBKT7 and pGADT7 respectively by homologous recombination to obtain BDOsRGA2-CC, ADOsRGA2-CC, BDOsRGA2-NB, and ADOsRGA2-NB;

[0127] 3. 1 μg of the constructed pGBKT7 and pGADT7 plasmid DNA, 10 μl of ssDNA, 100 μl of yeast competent Y2HGold cell suspension, and 600 μl of PEG / LiAc were mixed, incubated with shaking at 30°C for 30 min, and then in a 42°C water bath for 15 min. The plasmids were transformed into yeast competent cells by heat shock method, spread on SD-Leu-Trp medium, and cultured at 28°C for 2-4 days.

[0128] 4. Pick the positive colonies and dilute the bacterial solution with sterile water to an OD 600 =1, and follow 10 -1 , 10 -2 Perform serial dilutions at different times, spot 10 μl on SD-Leu-Trp and SD-Ade-His-Leu-Trp culture media, culture for 2 to 4 days, observe the growth of colonies and take photos.

[0129] The results showed that the CC domains of OsRGA2 interact with each other, while the NB domains do not interact with each other or with each other. The CC domain plays a key role in OsRGA2 self-association, suggesting that OsRGA2 may regulate immunity through CC domain oligomerization.

[0130] Results and Discussion

[0131] 1. Expression of the gene OsRGA2 in response to brown planthopper feeding and bacterial blight damage

[0132] To investigate whether OsRGA2 is involved in rice defense responses to pests and diseases, we treated wild-type material ZH11 with brown planthopper feeding and bacterial blight inoculation, and measured the transcriptional level of OsRGA2 after treatment. Figure 3 As shown in the results, both stresses could significantly induce the expression of OsRGA2, suggesting that this gene has a potential regulatory role in the process of resisting brown planthopper and bacterial blight infection.

[0133] 2. OsRGA2 expression in different tissues of rice

[0134] To further investigate whether OsRGA2 may play a role in pest and disease resistance, we examined the expression of this gene in different rice tissues, including roots, clums, young leaves, mature leaves, sheaths, and spikelets. The results showed that OsRGA2 was expressed in all these tissues, with higher expression levels in clums, mature leaves, and sheaths. Figure 3 The stems and leaf sheaths are the main feeding sites of brown planthoppers, and the leaves are the main sites of rice damaged by rice blast and bacterial blight, which further suggests that OsRGA2 may be involved in the process of rice disease and pest resistance.

[0135] 3. OsRGA2 gene positively regulates rice resistance to brown planthopper

[0136] Using two brown planthopper resistance evaluation systems, single plant and small population, we performed phenotypic analysis and mortality statistics on OsRGA2 overexpression lines (OsRGA2-OE5, OsRGA2-OE7) and knockout lines (osrga2-1, osrga2-2). The results consistently showed that the overexpression materials showed significant resistance in both tests, while the knockout materials were clearly susceptible, with significant differences in mortality ( Figure 4 ), suggesting that OsRGA2 positively regulates rice resistance to brown planthopper infestation.

[0137] 4. OsRGA2 gene positively regulates rice resistance to bacterial blight

[0138] We evaluated the effect of the OsRGA2 gene on resistance to bacterial blight by inoculating rice leaves with bacterial blight using the leaf clipping method. The results showed that compared to the wild-type, 14 days after bacterial blight inoculation, the lesion lengths of OsRGA2-OE5 and OsRGA2-OE7 rice leaves were significantly shorter, while the lesion lengths of OsRGA2-knockout rice leaves were significantly longer ( Figure 5 This suggests that the OsRGA2 gene positively regulates rice resistance to bacterial blight.

[0139] 5. OsRGA2 CC domain self-association

[0140] We used yeast two-hybrid assay to detect the interaction between different domains of OsRGA2 protein. Figure 6 Yeast transformed with all plasmids were able to grow on SD-Leu-Trp medium, indicating successful transformation. Yeast co-transformed with ADOsRGA2-CC and BDOsRGA2-CC were able to grow on SD-Ade-His-Leu-Trp medium, while yeast transformed with other plasmids were unable to grow on SD-Ade-His-Leu-Trp medium. These results indicate that the CC domains of OsRGA2 interact with each other, while the NB domains do not interact with each other, or with each other. The CC domain plays a key role in OsRGA2 self-association, suggesting that OsRGA2 may regulate immunity through CC domain oligomerization.

[0141] The above embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the protection scope of the present invention.

[0142] It should be noted that the listing and discussion of previously disclosed documents in this specification should not be regarded as an admission that the documents are prior art or common knowledge.

[0143] References

[0144] Adachi, H., Contreras, M.P., Harant, A., Wu, C.H., Derevnina, L., Sakai, T., Duggan, C., Moratto, E., Bozkurt, T.O., Maqbool, A., Win, J. and Kamoun, S. (2019) An N-terminal motif in NLR immune receptors is functionally conserved across distantly related plant species. Elife 8.

[0145] Ade, J., DeYoung, B.J., Golstein, C. and Innes, R.W. (2007) Indirect activation of a plant nucleotide binding site-leucine-rich repeat protein by a bacterial protease. Proc Natl Acad Sci U S A 104, 2531-2536.

[0146] Bi, G.Z., Su, M., Li, N., Liang, Y., Dang, S., Xu, J.C., Hu, M.J., Wang, J.Z., Zou, M.X., Deng, Y.A., Li, Q.Y., Huang, S.J., Li, J.J., Chai, J.J., He, K.M., Chen, Y.H. and Zhou, J.M. (2021) The ZAR1 resistosome is a calcium-permeable channel triggering plant immune signaling. Cell 184, 3528-+.

[0147] Chen,J.,Zhang,X.X.,Bernoux,M.,Rathjen,J.P.and Dodds,P.N.(2024)PlantToll / interleukin-1receptor / resistance protein domains physically associatewith enhanced disease susceptibility1 family proteinsin immunesignaling.Iscience27.

[0148] Ellis,J.and Jones,D.(1998)Structure and function of proteinscontrolling strain-specific pathogen resistance in plants.Curr Opin PlantBiol1,288-293.

[0149] A.and Kourelis,J.(2023)NLR immune receptors:structure andfunction in plant disease resistance.Biochem Soc T51,1473-1483.

[0150] Hiei,Y.,Ohta,S.,Komari,T.and Kumashiro,T.(1994)EfficientTransformation of Rice(Oryza-Sativa L)Mediated by Agrobacterium and Sequence-Analysis of the Boundaries of the T-DNA.Plant Journal6,271-282.

[0151] Inoue,H.,Hayashi,N.,Matsushita,A.,Liu,X.Q.,Nakayama,A.,Sugano,S.,Jiang,C.J.and Takatsuji,H.(2013)Blastresistance of CC-NB-LRR protein Pb1 ismediated by WRKY45 through protein-protein interaction.P Natl Acad SciUSA110,9577-9582.

[0152] Jones,J.D.G.,Staskawicz,B.J.and Dangl,J.L.(2024)The plantimmunesystem:From discovery to deployment.Cell187,2095-2116.

[0153] Liu,Y.,Zhang,Y.M.,Tang,Y.,Chen,J.Q.and Shao,Z.Q.(2023)The evolutionof plant NLR immune receptors and downstream signal components.Curr OpinPlant Biol73.

[0154] Ma,S.C.,Lapin,D.,Liu,L.,Sun,Y.,Song,W.,Zhang,X.X.,Logemann,E.,Yu,D.L.,Wang,J.,Jirschitzka,J.,Han,Z.F.,Schulze-Lefert,P.,Parker,J.E.and Chai,J.J.(2020)Direct pathogen-induced assembly of an NLR immune receptor complexto form a holoenzyme.Science370,1184-+.

[0155] Martin, R., Qi, T.C., Zhang, H.B., Liu, F.R., King, M., Toth, C., Nogales, E. and Staskawicz, B.J. (2020) Structure of the activated ROQ1 resistosome directly recognizing the pathogen effector XopQ. Science 370, 1185-+.

[0156] Miao, J., Guo, D.S., Zhang, J.Z., Huang, Q.P., Qin, G.J., Zhang, X., Wan, J.M., Gu, H.Y. and Qu, L.J. (2013) Targeted mutagenesis in rice using CRISPR-Cas system. Cell Res 23, 1233-1236.

[0157] Padmanabhan, M.S., Ma, S.S., Burch-Smith, T.M., Czymmek, K., Huijser, P. and Dinesh-Kumar, S.P. (2013) Novel Positive Regulatory Role for the SPL6 Transcription Factor in the N TIR-NB-LRR Receptor-Mediated Plant Innate Immunity. Plos Pathog 9.

[0158] Shen, Q.H., Saijo, Y., Mauch, S., Biskup, C., Bieri, S., Keller, B., Seki, H., B., Somssich, I.E. and Schulze-Lefert, P. (2007) Nuclear activity of MLA immune receptors links isolate-specific and basal disease-resistance responses. Science 315, 1098-1103.

[0159] Wang,ZC,Yang,DW,Zhong,GT,Li,SP,Wang,W.and Tang,DZ(2024)Nucleotide-binding leucine-rich repeatreceptor homologs Pib and PibH8interact andcontribute toimmunity in rice.Plant Physiol.

[0160] Xu,S.,Wei,X.,Yang,Q.,Hu,D.,Zhang,Y.,Yuan,X.,Kang,F.,Wu,Z.,Yan,Z.,Luo,X.,Sun,Y.,Wang,S.,Feng,Y.,Xu,Q.,Zhang,M.and Yang,Y.(2024) immune receptor BRG8-mediated immunityin rice.Plantcommunications,101001.

[0161] Zhou,JMand Zhang,YL(2020)Plant Immunity:Danger Perception andSignaling.Cell181,978-989.

Claims

1. CC-NBS protein RGA2 lacking LRR domain and its encoding gene OsRGA2 Use of the invention to improve the resistance of gramineous crops to diseases and insect pests.

2. The use according to claim 1, characterized in that The CC-NBS protein RGA2 is a polypeptide having an amino acid sequence as shown in SEQ ID NO: 1 or a conservative variant polypeptide thereof, wherein the conservative variant polypeptide is a polypeptide having more than 90% homology with RGA2 and having the function of the CC-NBS protein RGA2, wherein the function is to regulate plant immunity through CC domain oligomerization; The gene OsRGA2 The gene number is LOC_Os07g04900 (http: / / rice.plantbiology.msu.edu / ), and the nucleotide sequence is SEQ ID NO:

2.

3. The use according to claim 1, characterized in that The pests and diseases are pests and diseases caused by brown planthoppers and / or bacterial blight pathogens. Accordingly, the resistance to pests and diseases is resistance to pests and diseases caused by brown planthoppers and / or bacterial blight pathogens.

4. The use according to claim 2, characterized in that The gramineous crop is selected from rice, wheat, corn, soybean, barley, oats, rye and sorghum, preferably rice.

5. The use according to claim 1, characterized in that Gene OsRGA2 Used to improve the resistance of crops to diseases and pests, cultivate disease- and pest-resistant crop varieties, or create disease- and pest-resistant rice germplasm resources.

6. The use according to claim 5, characterized in that The method is implemented by overexpressing the CC-NBS protein RGA2 according to claim 1 in crops.

7. The use according to claim 6, characterized in that Overexpression of CC-NBS protein RGA2 or its encoding gene in crops by the following method OsRGA2 : A. Transfect the gene encoding CC-NBS protein RGA2 OsRGA2 For example, the nucleotide sequence SEQ ID NO: 2 is cloned into a plasmid vector to form a recombinant plasmid, i.e., a CC-NBS protein RGA2 overexpression vector, and then plant cells or tissues are transformed by using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, or Agrobacterium-mediated methods, and the transformed plant tissues are cultivated into plants to obtain transgenic plants overexpressing CC-NBS protein RGA2; or B. Using gene editing technology to modify the gene encoding CC-NBS protein RGA2 OsRGA2 For example, the nucleotide sequence SEQ ID NO: 2 is cloned on a plant chromosome to obtain a transgenic plant overexpressing the CC-NBS protein RGA2; or C. Place the gene encoding the CC-NBS protein RGA2 already in the plant genome under the regulation of a function-enhanced promoter.

8. The use according to claim 7, characterized in that The plasmid vector in step A is selected from a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment; The gene editing technology described in step B is selected from the following group: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, MuGENT.

9. The use according to claim 8, characterized in that The Agrobacterium is selected from Agrobacterium tumefaciens, Agrobacterium EHA105, and Agrobacterium GV3101.

Images