OsSULTR1, OsSULTR1; application of protein 3 and coding gene thereof in regulating and controlling salt tolerance of rice

Abstract

The invention relates to the field of rice gene engineering, and particularly provides an application of OsSULTR1; the invention also discloses application of the protein 3 and the coding gene thereof in regulating and controlling the salt tolerance of rice. The protein meets the following conditions: B1) a protein with an amino acid sequence as shown in SEQ ID NO.1; and B2) a fusion protein which is obtained by connecting a tag to the N end and / or C end of the protein limited by B1) and has the same function. According to the invention, OsSULTR1; 3 gene knockout transgenic rice is subjected to seedling stage salt stress phenotype identification, and the result shows that when the gene segment is deleted, the salt stress sensitivity of the rice is remarkably improved, and the salt tolerance is reduced. The result proves that the OsSULTR1 is shown in the specification; the gene 3 has the function and application value in regulating and controlling the salt tolerance of the rice. Thus, OsSULTR1 of the present invention; the 3 protein and the coding gene thereof can regulate and control the salt tolerance of rice, and have important significance for cultivating salt-tolerant transgenic rice varieties.

Description

Technical Field

[0001] The present invention belongs to the field of rice genetic engineering, and in particular relates to the application of OsSULTR1;3 protein and its encoding gene in regulating the salt tolerance of rice. Background Art

[0002] Salt stress retards rice growth and inhibits the growth and differentiation of rice tissues and organs. Under increasing NaCl concentration, rice leaf growth and development are significantly inhibited, with leaf size decreasing, and plant height and dry weight are significantly reduced (Komatsu et al., 2005). Rice seedling growth is also inhibited, manifesting as dwarfing and curled heart leaves. In soda-alkali soils with a pH of 9.49, the tillering capacity of individual rice plants is significantly reduced (Liang Zhengwei et al., 2005). Salt can delay rice seed germination and emergence. Salt-alkali stress during the germination stage often results in uneven germination, reduced germination potential, and decreased germination rate. Under saline-alkali stress, the tillering peak is significantly delayed or does not occur, the heading period is prolonged, and early-maturing varieties that are not salt-alkali tolerant head later than mid-maturing varieties that are salt-alkali tolerant. The height of rice plants decreases, and the number of green leaves per stem and the number of effective tillers decrease (Tong Lichun et al., 2006).

[0003] Under saline-alkali stress, plants maintain a low Na + The concentration of Na can be regulated by regulating its inflow and outflow in tissues or cells to ensure the ion homeostasis of plants (Liu Yimin et al., 2018). + The interception effect of Na + It mainly accumulates in the root system, inhibiting its transport to the aboveground tissues, thereby reducing Na + Damage to the aboveground parts of plants (Lü Bingsheng et al., 2014). + It is the most abundant cation in plant cells and an essential nutrient for plant cells. + / K + The ratio is one of the important indicators for measuring plant salt tolerance (Maathuis et al., 2014).

[0004] Sulfur, as one of the six macronutrients required by plants, plays an important role in plant growth, development, resistance to biotic and abiotic stresses, and crop yield and quality (Watanabe et al., 2019). 2- ) is the main form of sulfur nutrition in the soil. The roots absorb SO4 from the soil environment. 2-Sulfate transporters are a class of carrier proteins required for active sulfate transport. They consist of 12 transmembrane domains (TMDs), with a sulfur transport domain (sulfate_transp) at the N-terminus and a sulfate transport anti-sigma (STAS) domain at the C-terminus. The sulfate_transp and STAS domains are connected by a linker (L) region consisting of approximately 30 amino acids (Takahashi, 2019). Plants absorb sulfur from the soil in the form of sulfate and then transport it to plastids for assimilation or to the vacuole for storage. These long-distance, regulated transport activities between different organs require the involvement of sulfate transporters (Rouached et al., 2019). Summary of the Invention

[0005] The technical problem to be solved by the present invention is how to regulate the salt tolerance of rice (e.g., increase or decrease the salt tolerance of rice). The technical problem to be solved is not limited to the technical subject matter described herein. Other technical subjects not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions: In a first aspect, the present invention provides the use of a gene for knocking out the OsSULTR1;3 protein in reducing salt tolerance in rice. The amino acid sequence of the OsSULTR1;3 protein is shown in SEQ ID NO. 1.

[0007] The second aspect of the present invention provides an application of a biomaterial related to the OsSULTR1;3 protein, wherein the application is for reducing the salt tolerance of rice; The biological material is any one of the following E1) to E3): E1) an expression cassette containing a nucleic acid molecule encoding an OsSULTR1;3 protein; E2) a recombinant vector containing a nucleic acid molecule encoding the OsSULTR1;3 protein; E3) a recombinant microorganism containing a nucleic acid molecule encoding an OsSULTR1;3 protein, or a recombinant microorganism containing the expression cassette described in E1), or a recombinant microorganism containing the recombinant vector described in E2), wherein the microorganism is Agrobacterium; The amino acid sequence of the OsSULTR1;3 protein is shown in SEQ ID NO. 1, and the nucleotide sequence of the nucleic acid molecule encoding the OsSULTR1;3 protein is shown in SEQ ID NO. 2.

[0008] A third aspect of the present invention provides a method for cultivating plants sensitive to salt stress, comprising knocking out the gene of the OsSULTR1;3 protein in a plant to obtain a plant with reduced salt tolerance, wherein the plant is rice, and the amino acid sequence of the OsSULTR1;3 protein is shown in SEQ ID NO. 1.

[0009] In the above method, knocking out the gene encoding the OsSULTR1;3 protein in the plant is to reduce the expression level of the gene encoding the OsSULTR1;3 protein in rice by using gene knockout technology.

[0010] In the above method, the gene knockout technology is used to reduce the expression level of the gene encoding the OsSULTR1;3 protein in rice by introducing a plant expression vector integrated with the nucleic acid molecule shown in SEQ ID NO. 2 into the target plant.

[0011] In the above method, the plant expression vector is a recombinant vector constructed based on the dual target sites sgRNA1: CCATTGCAAGTCTCTGCATTCCCCAG and sgRNA2: AAAGGATATTGCAATCGGTCCGG of the nucleic acid molecule shown in SEQ ID NO. 2.

[0012] The present invention has the beneficial effects: The OsSULTR1;3 protein and its encoding gene proposed for the first time in the present invention can regulate the salt tolerance of rice by reducing the content and / or activity of the OsSULTR1;3 protein in the target plant (such as inhibiting, silencing or interfering with the OsSULTR1;3 The expression of the rice salt-tolerance protein OsSULTR1;3 and its encoding gene can significantly enhance the target plant's sensitivity to salt stress. Therefore, the rice salt-tolerance-related protein OsSULTR1;3 and its encoding gene have important theoretical and practical significance in regulating rice salt tolerance. This invention is of great significance for the development of salt-tolerant transgenic rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] 图1 for OsSULTR1;3 Gene mutants ( ko-OsSULTR1;3-1 and ko-OsSULTR1;3-2 )middle OsSULTR1;3 The mutation site of the gene and the sequences on both sides.

[0014] 图2 The wild type Zhonghua11 (WT) and OsSULTR1;3 Gene mutant (Gm) ko-OsSULTR1;3-1 and ko-OsSULTR1;3-2 Seedling phenotype under salt stress.

[0015] 图3 Wild type Zhonghua 11 (WT) and OsSULTR1;3 Gene mutant (Gm) ko-OsSULTR1;3-1 and ko- OsSULTR1;3-2 Seedling survival rate under salt stress. DETAILED DESCRIPTION

[0016] The following examples are used to illustrate the present application, which specifically describes the construction of CRISPR mutant materials of Gm OsSULTR1;3 , the identification of their genotypes to obtain homozygous mutants, and the identification of their seedling salt stress phenotypes. Based on all or part of the implementation steps described below, those skilled in the art can determine the basic features of the present application, and various changes and modifications can be made to the present application without departing from the spirit and scope of the present application to make it suitable for different application scenarios and conditions. The technical solutions described in the present application, if not specifically stated, are all conventional technical solutions in the field; the reagents or materials, if not specifically stated, can be obtained through commercial channels.

[0017] Explanation of sequences SEQ ID NO. 1 and SEQ ID NO. 2: SEQ ID NO. 1 (Gm OsSULTR1;3 gene amino acid sequence): MVHQHDESTANEVSTTTQLPSYGSSEEPRVYKVRCPPQKNFAREFRDTLRETFFHDNPLRQYKDQSGSAKFMMALQFLFPIFEWGRCYNLRKFKGDLIAGLTIASLCIPQDIGYSKLANLDAQYGLYSSFVPPLIYAAMGSSKDIAIGPVAVVSLLIGSLLQNEVDPVKNKEEYLRLAFTATFFAGITQAALGFLRLGFLIEFLSHAAIVGFMGGAAITIALQQLKYVLGIKSFTKKTDIISVMRSVWTSAHHGWNWQTIVIGITFLAFLLLAKYIGKKNRKFFWVPAIAPITSVILATLFVFITRADKQGVQIVNHIKKGINPSSVHKIYFTGPFVAKGFKIGVISAMIGLTEAVAIGRTFAALKDYQLDGNKEMVALGTMNIAGSMTSCYIATGSFSRSAVNFMAGCQTPVSNIIMSAVVLLTLLVITPLFKYTPNAILGSIIISAVIGLVDYEAVILIWKVDKMDFISCMGAFFGVVFASVEIGLLIAVSISFAKILLQVTRPRTVLLGNLPGTTIYRNTDQYPEARHIPGVVIVRVDSAIYFSNSNYVRERTLRWLTEEEEKAKAEGQSKINFLIIEMSPVIDIDTSGIHALEDLYKNLKKRDIQLILANPGSIVMEKLLSSKLNEHIGSNNIFLTVADAVRFCTRKSMQEP SEQ ID NO.2( OsSULTR1;3 基因CDS序列): Example 1: Rice OsSULTR1;3 Cloning of gene coding region sequences (CDS) Using the cDNA of the aerial part of rice cultivar Zhonghua 11 seedlings as template, the primer pair consisting of Primer1 and Primer2 was used to amplify the gene OsSULTR1;3 The CDS fragment was amplified by PCR.

[0018] Primer1:5'-ATGGTTCATCAGCATGATGAGTCA-3' (SEQ ID NO.3); Primer2:5'-TCATGGTTCTTGCATCGACTTTCT-3' (SEQ ID NO. 4).

[0019] The PCR reaction system (50 μL) consisted of 1 μL template cDNA (200 ng / μL), 1.5 μL Primer 1 (10 μM), 1.5 μL Primer 2 (10 μM), 5 μL 10× PCR Buffer for KOD-Plus-Neo, 5 μL 2 mM dNTPs, 3 μL 25 mM MgSO₄, 1 μL KOD-Plus-Neo (1 U / μL), and 32 μL ddH₂O. PCR amplification was performed in a PCR amplifier. The PCR protocol was as follows: 94°C denaturation for 2 min; 35 cycles of denaturation at 98°C for 10 s, annealing at 60°C for 30 s, and extension at 68°C for 2 min; extension at 68°C for 5 min; and storage at 4°C.

[0020] The PCR product was purified using a DNA purification kit (Nanjing Novozymes Biotechnology Co., Ltd.) and ligated into the pEASY-Blunt expression vector (Beijing Quanshijin Biotechnology Co., Ltd.). The ligation product was transformed into Escherichia coli DH5α competent cells (Baoriyi Biotechnology (Beijing) Co., Ltd.), and positive clones were selected for sequencing (Sangon Biotechnology (Shanghai) Co., Ltd.).

[0021] Sequencing results showed that the PCR amplification OsSULTR1;3 The CDS fragment of the gene has a nucleotide sequence shown in SEQ ID NO. 2, and encodes a protein consisting of 657 amino acid residues shown in SEQ ID NO. 1.

[0022] Example 2: Rice OsSULTR1;3 Construction of transgenic plants with gene mutations one, OsSULTR1;3 Construction of gene knockout vector according to OsSULTR1;3 The genome sequence of the genotype was used to design CRISPR-Cas9 sgRNA targets using the CRISPR-P V2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). OsSULTR1;3 The dual target sequences for gene editing vector construction were: CCATTGCAAGTCTCTGCATTCCCCAG (SEQ ID NO. 5) and AAAGGATATTGCAATCGGTCCGG (SEQ ID NO. 6).

[0023] Based on the target sequence, Primer3 and Primer4, Primer5 and Primer6 were synthesized, and the two pairs of primers were annealed to obtain two double-stranded DNA molecules with sticky ends. The two double-stranded DNA molecules were ligated with BsaI-cleaved pOs-sgRNA linearized vector (the vector construction method is described in the literature "Targeted mutagenesis in rice using CRISPR-Cas system") using T4 DNA ligase. The obtained ligation product was transformed into DH5a Escherichia coli. Positive clones were identified by colony PCR, and plasmids were extracted and sequenced. The sequencing results showed that a recombinant vector containing the sequences shown in SEQ ID NO.5 and SEQ ID NO.6 was obtained and named pOs-sgRNA- OsSULTR1;3 .

[0024] Primer3: 5'-ggcaCATTGCAAGTCTCTGCATTCCCCAG-3' (SEQ ID NO.7); Primer4: 5'-aaacCTGGGGAATGCAGAGACTTGCAATGG-3' (SEQ ID NO. 8); Primer5: 5'-ggcaAAAGGATATTGCAATCGGTCCGG-3' (SEQ ID NO.9); Primer6: 5'-aaacCCGGACCGATTGCAATATCCTTT-3' (SEQ ID NO. 10).

[0025] pOs-sgRNA- OsSULTR1;3 Plasmid and CRISPR-Cas9 vector plasmid were PCR amplified according to the corresponding system; PCR reaction system (10 μl) was: H2O 6 μL, CRISPR-Cas9 vector plasmid 2 μL pOs-sgRNA- OsSULTR1;3 1 μL of plasmid and 1 μL of enzyme mix were added, and then mixed on ice. After mixing, the reaction was allowed to react at room temperature (20°C) for 1 hour. Transformation of E. coli: 5 μL of the reaction solution was added to at least 50 μL of competent cells, mixed, and then placed on ice for 30 minutes. Gently remove the cells, heat shock them at 42°C for 60 seconds, and immediately place them on ice for 2 minutes. 500 μL of SOB / LB was added and incubated at 37°C at 200 rpm for 1 hour. An appropriate amount of the bacterial solution was spread on an LB plate containing kanamycin and incubated inverted at 37°C overnight. Positive clones were identified by colony PCR, and plasmids were extracted and sequenced to obtain the plasmid pH-Ubi-cas9- containing the sequences shown in SEQ ID NO.6 and SEQ ID NO.7. OsSULTR1;3 .

[0026] 2. Obtaining recombinant Agrobacterium pH-Ubi-cas9- OsSULTR1;3 Mix with Agrobacterium EHA105 competent cells, incubate on ice for 5 min, and electroporate (1500 V, 5 ms) to OsSULTROsSULTR1;3 Transformed into Agrobacterium EHA105 competent cells to obtain a recombinant strain, and the correct recombinant strain identified by colony PCR was named EH-pH-Ubi-cas9 - OsSULTROsSULTR1;3 .

[0027] Obtaining transgenic plants The above recombinant Agrobacterium strain was transformed into the rice variety Nipponbare by the following method: Seed induction: alcohol for 30 seconds, 30% sodium hypochlorite solution for 15 minutes, sterile water 5 times. Wash in the above order, remove excess water and place in induction medium for culture.

[0028] Callus subculture: Use sterile tweezers to remove the young shoots and seeds, retain the mature callus tissue, and place it on the culture medium for further cultivation.

[0029] Agrobacterium activation: Use a 200 μL pipette tip to dip the Agrobacterium liquid, streak on YEP plates, and culture in the dark at 28 degrees for 2 days.

[0030] Agrobacterium infection: Use infection solution to flush the carrier on the plate into a suspension, soak the callus tissue with the suspension for 15 minutes, then transfer the callus to sterile filter paper to absorb excess liquid, place it at 25 degrees, and culture for 3 days.

[0031] Screening culture: Wash the callus after dark culture with water containing carbenicillin, use the air of the clean bench to dry the surface moisture, and then place it on the screening culture medium for screening culture.

[0032] Differentiation and regeneration: The positive particles grown on the screening medium are transferred to the differentiation medium for regeneration.

[0033] Rooting of seedlings: The seedlings grown on the differentiation medium take root in the rooting tubes and undergo root strengthening culture.

[0034] The differentiated rice seedlings are hardened and transferred to the field for growth, and the T0 generation transgenic plants are obtained.

[0035] Example 3: Rice OsSULTR1;3 Molecular identification of gene mutants and transgenic plants The obtained OsSULTR1;3 The aboveground part of the seedlings of the T0 generation transgenic plants was sampled, and genomic DNA was extracted as a template. The primers consisting of Primer7 and Primer8 were used to PCR amplify the editing target sites shown in SEQ ID NO.6 and SEQ ID NO.7 and the DNA fragments on both sides.

[0036] Primer7: 5'-TGGGGCAGGTGCTACAACTTAAGA-3' (SEQ ID NO. 11); Primer8: 5'-GCCGTGAAAGCAAGGCGCAGATAT-3' (SEQ ID NO. 12).

[0037] The obtained PCR products were detected by 1% agarose gel electrophoresis and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. According to the sequencing results, two OsSULTR1;3 The individual strains with specific gene mutations are: ko- OsSULTR1;3 -1 and ko- OsSULTR1;3 -2, the editing target sites and the DNA sequences on both sides of these two strains are as follows 图1 shown.

[0038] in ko- OsSULTR1;3 -1 in a single plant, OsSULTR1;3 The gene has one nucleotide (T) inserted in exon 1 and one nucleotide (T) inserted in exon 3; in ko- OsSULTR1;3 -2 in a single plant, OsSULTR1;3 The base inserts a nucleotide (C) in the third exon; In these two mutant strains OsSULTR1;3 Mutations in the gene CDS sequence all lead to frameshift mutations and premature termination of the encoded protein.

[0039] Embodiment 4: OsSULTR2;2 Identification of salt-tolerance phenotype of gene mutant plants at the seedling stage The two gene mutants identified in Example 3 were self-crossed for two generations to obtain homozygous mutant lines ko-1 and ko-2. OsSULTR1;3 The two homozygous mutant lines were used for salt tolerance identification experiment at seedling stage together with wild type Zhonghua 11. OsSULTR1;3 OsSULTR1;3 The two homozygous mutant lines were used for salt tolerance identification experiment at seedling stage together with wild type Zhonghua 11.

[0040] (1) Full rice seeds were soaked in tap water at 37℃ for 2 days and then germinated for 1 day. Uniformly germinated seeds were selected and sowed on 96-well PCR plates without tube bottom, and then placed in blue culture pots containing tap water, and seedling culture was carried out in an artificial climate chamber. The culture conditions were: 14h light (28℃) / 10h darkness (24℃), light intensity 100%, relative humidity 70%. After 1 week of culture with tap water, 800x Yoshida rice nutrient solution (three components) was used for culture.

[0041] (2) When the rice seedlings grew to the three-leaf-one-heart stage, the nutrient solution was replaced with 800x Yoshida rice nutrient solution (three components) containing 8‰ NaCl for salt stress treatment.

[0042] (3) After 14 days of NaCl treatment, 800x Yoshida rice nutrient solution (three components) without NaCl was used for rehydration treatment, and after 7 days, the survival rate of rice seedlings was counted. Survival rate = number of surviving seedlings / total number of treated seedlings x 100%.

[0043] (4) The results of salt tolerance identification are shown: compared with wild type Zhonghua 11 (WT), the two gene mutant lines (ko-1 and ko-2) had lighter salt damage symptoms such as leaf wilting and drying (). OsSULTR1;3 OsSULTR1;3 OsSULTR1;3 图2 OsSULTR1;3 OsSULTR1;3 图3

[0044] The above experimental results show that the gene has a positive regulatory function on rice seedling salt tolerance, and knocking out the gene leads to sensitivity of rice to salt stress and decreased salt tolerance. OsSULTR1;3 The above experimental results show that the gene has a positive regulatory function on rice seedling salt tolerance, and knocking out the gene leads to sensitivity of rice to salt stress and decreased salt tolerance.

[0045] The above experimental results show that the gene has a positive regulatory function on rice seedling salt tolerance, and knocking out the gene leads to sensitivity of rice to salt stress and decreased salt tolerance.

[0046] ​​​​​​​​The term "protein" is used interchangeably herein to mean a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as to amino acid polymers in which one or more amino acid residues is a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0047] The term "transformation" refers to the process of introducing a heterologous DNA sequence into a host cell or organism.

[0048] The term "expression" refers to the transcription and / or translation of an endogenous gene or transgene in a plant cell.

[0049] It will be apparent to those skilled in the art that various modifications and variations can be made in the present application without departing from the spirit or scope of the application. Thus, it is intended that the present application cover modifications and variations of this application provided they come within the scope of the appended claims and their equivalents.

Claims

1. Application of knockout gene of OsSULTR1;3 protein in reducing salt tolerance of rice, characterized in that: The amino acid sequence of OsSULTR1;3 protein is shown in SEQ ID NO.

1.

2. Use of a biomaterial related to the OsSULTR1;3 protein according to claim 1, characterized in that: The application is to reduce the salt tolerance of rice; The biological material is any one of the following E1) to E3): E1) an expression cassette containing a nucleic acid molecule encoding an OsSULTR1;3 protein; E2) a recombinant vector containing a nucleic acid molecule encoding the OsSULTR1;3 protein; E3) a recombinant microorganism containing a nucleic acid molecule encoding an OsSULTR1;3 protein, or a recombinant microorganism containing the expression cassette described in E1), or a recombinant microorganism containing the recombinant vector described in E2), wherein the microorganism is Agrobacterium; The amino acid sequence of the OsSULTR1;3 protein is shown in SEQ ID NO. 1, and the nucleotide sequence of the nucleic acid molecule encoding the OsSULTR1;3 protein is shown in SEQ ID NO.

2.

3. A method for cultivating plants sensitive to salt stress, characterized in that: The method comprises knocking out the gene of the OsSULTR1;3 protein in a plant to obtain a plant with reduced salt tolerance, wherein the plant is rice, and the amino acid sequence of the OsSULTR1;3 protein is shown in SEQ ID NO.

1.

4. The method according to claim 3, characterized in that The knockout of the OsSULTR1;3 protein gene in the plant is to reduce the expression level of the OsSULTR1;3 protein encoding gene in claim 1 in rice by using gene knockout technology.

5. The method according to claim 4, characterized in that The method of using gene knockout technology to reduce the expression level of the gene encoding the OsSULTR1;3 protein in rice according to claim 1 is to introduce a plant expression vector integrated with the nucleic acid molecule shown in SEQ ID NO. 2 into the target plant.

6. The method according to claim 5, characterized in that The plant expression vector is a recombinant vector constructed based on the dual target sites sgRNA1: CCATTGCAAGTCTCTGCATTCCCCAG and sgRNA2: AAAGGATATTGCAATCGGTCCGG of the nucleic acid molecule shown in SEQ ID NO.2.

Images