High-sensitivity detection method for human breast cancer cells MCF-7 based on ICP-MS

Abstract

The invention belongs to the technical field of cell detection, and particularly relates to a high-sensitivity detection method of human breast cancer cells MCF-7 based on ICP-MS. The high-sensitivity detection method comprises the following steps: adding deionized water and a chloroauric acid solution into a container, heating, quickly adding a trisodium citrate solution, reacting to obtain an AuNPs solution, putting the AuNPs solution into a bottle, and preserving in a dark place; the method comprises the following steps: designing an oligonucleotide characteristic sequence for synthesizing a composite probe, and synthesizing three composite probes, namely MBs-AptMUC1, Au-H1 and Au-HCR; the carbon tetrachloride detection method with high selectivity and high sensitivity is developed by adopting an HCR amplification strategy marked by gold nanoparticles (AuNPs) and by virtue of an ICP-MS technology, and high-sensitivity detection of MCF-7 cells is realized by virtue of the ICP-MS technology.

Description

Technical Field

[0001] The present invention belongs to the technical field of cell detection, and in particular relates to a highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS. Background Art

[0002] Breast cancer is a malignant tumor that occurs in the mammary epithelial tissue and seriously threatens women's life and health. With the rapid increase in the incidence of breast cancer worldwide, breast cancer has become one of the most common malignant tumors in women. According to statistics, there are millions of new cases of breast cancer each year, and the mortality rate has remained high. Taking human breast cancer MCF-7 cells as an example, circulating tumor cells (CTCs) can reflect the biological characteristics of the tumor in real time, which is helpful for early diagnosis, prognosis assessment and the formulation of personalized treatment plans. By monitoring the changes in CTCs, tumor recurrence and metastasis can be detected in time. The detection of CTCs is expected to provide a powerful non-invasive means for effective clinical diagnosis, treatment and mechanism research.

[0003] However, the reality is that identifying CTCs is challenging for several reasons. Firstly, CTCs are present in extremely low concentrations in the blood, with only a few or fewer found per milliliter, making it akin to finding a needle in a haystack. Therefore, accurately capturing CTCs from a large pool of blood cells is extremely challenging. Secondly, CTCs closely resemble peripheral blood cells in morphology and size, making them difficult to accurately distinguish within the complex matrix. This leads to the accumulation of errors during the isolation and enrichment process, making it difficult to guarantee the sensitivity and specificity of detection methods. Summary of the Invention

[0004] The purpose of the present invention is to overcome the above-mentioned shortcomings and disclose a highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS.

[0005] The present invention provides a highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS, comprising the following steps:

[0006] Gold nanoparticle synthesis steps: Add deionized water and chloroauric acid solution to a container, heat it, and quickly add trisodium citrate solution to obtain AuNPs solution after reaction. Place it in a bottle and store it away from light.

[0007] Composite probe synthesis steps: Design the oligonucleotide characteristic sequence for synthesizing composite probes, and synthesize three composite probes, namely MBs-Apt MUC1 , Au-H1 and Au-HCR;

[0008] Inductively coupled plasma mass spectrometry detection steps: digest the cells and centrifuge them. After centrifugation, use culture medium to make up the volume and then dilute. Then, add Au-HCR reaction to the cell solution, and then add MBs-Apt MUC1 Continue the reaction, and after the reaction is completed, separate it by magnetic attraction, wash the precipitate with TET buffer, add BSA to react, wash it with TET buffer by magnetic attraction, and elute AuNPs from the reaction system with formic acid; collect the eluate, digest it with acid, and after digestion, adjust the volume, filter it through a filter membrane, and then detect it by ICP-MS.

[0009] Furthermore, the composite probe synthesis step includes:

[0010] MBs-Apt MUC1 Synthesis steps: MBs were washed with TET buffer solution and then dispersed in TES buffer solution; then, Apt MUC1 reaction; finally, washing with TET buffer and finally dispersed in PBS buffer;

[0011] Au-H1 synthesis steps: take aptamer H1 and add AuNPs, freeze it, let it thaw at room temperature, add BSA to react, centrifuge after the reaction is complete, remove the supernatant, and redissolve it in PBS buffer;

[0012] Au-HCR synthesis steps: H2, Apt AS1411-HCR and initiator chains were diluted separately; H2 and Apt AS1411-HCR The mixture was mixed and reacted, and Au-H1 and the initiator chain were added for incubation to form Au-HCR through HCR. After the reaction was completed, the mixture was centrifuged and finally redispersed in PBS buffer.

[0013] Furthermore, the Apt MUC1 The oligonucleotide sequence is Biotin-AAAAAGCAGTTGATCCTTTGGATACCCTGG; Apt AS1411-HCR The oligonucleotide sequence of the primer chain is CAGCCTGCACTCTAAC GGTGGTGGTGGTTGTGGTGGTGGTGGGTTAGA; the oligonucleotide sequence of the priming chain is AGTCTAGGATTCGGTTAA; the oligonucleotide sequence of H1 is TTAACCGAATCCTAGACTC AAAGTAGTCTAGGATTCAAAAAGCACGGACGAAAAA-SH; the oligonucleotide sequence of H2 is GTGCAGGCTGAATTAAAGTCTAGGATTCGGTTAAGAATCCTAGACT ACTTTG.

[0014] Furthermore, it also includes:

[0015] Polyacrylamide gel electrophoresis analysis steps: The reaction products were analyzed by polyacrylamide gel electrophoresis in TBE buffer at a constant voltage; the gel was stained and images were captured using a gel documentation system.

[0016] Further, the reaction products include H1, H2, Apt AS1411-HCR , reaction system with / without the addition of initiator chain.

[0017] Furthermore, it also includes:

[0018] Specific detection steps: MCF-7 cells, HepG2 cells, BEAS-2B cells, mixed samples of MCF-7 cells and HepG2 cells, mixed samples of MCF-7 cells and BEAS-2B cells, and mixed samples of MCF-7 cells, HepG2 cells, and BEAS-2B cells were detected under the same conditions.

[0019] Furthermore, it also includes:

[0020] Analytical performance evaluation steps: Using ICP-MS to detect the relationship between the AuNPs signal value and the number of target MCF-7 cells within a range of multiple MCF-7 cells;

[0021] Actual biological sample detection steps: blood samples are treated with red blood cell lysis buffer and added to MCF-7 cells for CTC capture and detection; Au-HCR solution is added to the spiked sample and incubated; then MBs-AptMUC1 solution is added and incubation continues. After washing, elution and digestion are performed for ICP-MS detection.

[0022] Furthermore, the volume of the deionized water is 98-99 mL, and the volume of the chloroauric acid solution is 1.5-2.0 mL.

[0023] Furthermore, the concentration of trisodium citrate is 38-39 mM.

[0024] Furthermore, in the gold nanoparticle synthesis step, the heating time is 135-145 minutes and the reaction time is 25-35 minutes.

[0025] The technical solution provided by the present invention has at least the following technical effects:

[0026] The present invention adopts the HCR amplification strategy labeled with gold nanoparticles (AuNPs) and develops a carbon tetrachloride detection method with high selectivity and high sensitivity by means of ICP-MS technology. In this invention, MCF-7 cells are used as a model of circulating tumor cells (CTCs), and Apt MUC1 As an aptamer targeting Mucin1 (MUC1) protein.MUC1 Modified magnetic beads (MBs) can effectively capture MCF-7 cells from peripheral blood. Based on this, the present invention constructed a HCR composition containing multiple nucleoprotein AS1411 complexes and a large number of AuNPs for identifying MCF-7 cells. Using ICP-MS technology, highly sensitive detection of MCF-7 cells was achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0028] Figure 1 The morphology characterization diagram of AuNPs scanned by transmission electron microscopy (TEM) is shown in the embodiment of the present invention;

[0029] Figure 2 This is a feasibility analysis diagram of an embodiment of the present invention;

[0030] Figure 3 is a gel electrophoresis analysis diagram of the oligonucleotide sequence of the embodiment of the present invention;

[0031] Figure 4 This is a graph showing the specificity and sensitivity of MCF-7 cell detection in an embodiment of the present invention;

[0032] Figure 5 Graph showing the relationship between the response value (CPS) of AuNPs and the MCF-7 cell concentration in an embodiment of the present invention. DETAILED DESCRIPTION

[0033] The following describes embodiments of the present invention in detail. Examples of the embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals throughout represent the same or similar elements or elements having the same or similar functions. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the embodiments of the present invention, and should not be construed as limiting the present invention.

[0034] The present invention discloses a method for high-sensitivity detection of human breast cancer cells MCF-7 using ICP-MS technology, which effectively overcomes the problem of insufficient sensitivity in current MCF-7 detection technology.

[0035] A highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS, comprising the following steps:

[0036] AuNPs synthesis steps: AuNPs were synthesized according to the trisodium citrate hydrothermal method, specifically: 98.3 mL of deionized water and 1.7 mL of chloroauric acid solution (HAuCl4·6H2O, 2%) were added to a 100 mL two-necked flask, heated for 140 min, then 10 mL of trisodium citrate (38.8 mM) solution was quickly added, the solution turned wine red after 30 min of reaction, and AuNPs solution was obtained, which was placed in a blue cap bottle and stored in a 4°C refrigerator in the dark; as shown in Figure 1 , the specific particle size (13 nanometers, i.e. 13 nm) of gold nanoparticles (AuNPs) required for the subsequent synthesis step was autonomously synthesized.

[0037] Composite probe synthesis steps: design oligonucleotide characteristic sequences for synthesizing composite probes, and synthesize three composite probes, namely MBs-Apt MUC1 , Au-H1 and Au-HCR; to form a specific recognition and detection system for MCF-7.

[0038] Specifically, it includes: MBs-Apt MUC1 Synthesis steps: 5 μL of MBs (10 mg / mL) was washed with 10 μL of TET buffer solution for 3 times, and then dispersed in 15 μL of TES buffer solution; then, 10 μL of 2.5 μM of Apt MUC1 was added, and the reaction was carried out at 37°C, 300 rpm for 60 min; finally, 15 μL of TET buffer was used for washing for 3 times, and finally dispersed in 10 μL of PBS buffer. Magnetic bead-coupled Apt MUC1 (MBs-Apt MUC1 ) was synthesized and used for cell capture.

[0039] Au-H1 synthesis steps: 10 μL of 15 μM aptamer H1 was added to 10 μL of 20 μg / mL Au NPs, and placed in a -20°C refrigerator for 1 h, and after thawing at room temperature, 10 ul of 5% BSA was added and reacted at 37°C for 30 min; after the reaction was completed, centrifugation was carried out at 12000 rpm, 4°C for 15 min, the supernatant was removed, and resuspended in 10 μL of PBS buffer. The synthesized hairpin type Au-H1 is used to open the induced strand, thereby forming a free H1 single-stranded hairpin oligonucleotide sequence.

[0040] Au-HCR synthesis steps: H2, Apt AS1411-HCR and the induced strand were diluted to 10 μM with TE buffer. 15 μL of H2 and 15 ul of Apt AS1411-HCRMix and react at 37°C, 400rpm for 1h, add 10μL Au-H1 and 10μL initiator chain and incubate at 37°C, 400rpm for 24 hours to form Au-HCR through HCR. After the reaction is completed, centrifuge at 12000rpm, 4°C for 15min and redisperse in 20ul PBS buffer. The synthesized hairpin Au-H1 generates a single-stranded region with the hairpin H2 containing AS1411, which then reacts with H1 to open the hairpin H1, and the cycle continues to form a long-chain HCR assembly. Apt MUC1 、Apt AS1411-HCR The oligonucleotide sequences of , priming chain, H1 and H2 are shown in Table 1:

[0041] Table 1: Oligonucleotide sequence list

[0042]

[0043] Inductively coupled plasma mass spectrometry (ICP-MS) detection steps for MCF-7: digest the cells and centrifuge (500 rpm, 3 min). After centrifugation, the volume was fixed to 1 mL with culture medium and then diluted. Then, 10 μL Au-HCR was added to 200 μL cell solution and reacted at 4°C, 400 rpm for 45 min. Then, 20 μL MBs-Apt MUC1 The reaction was continued for 30 minutes. After the reaction was completed, the precipitate was separated by magnetic attraction. The precipitate was washed 3 times with TET buffer. 50 μL of 5% BSA (dissolved in culture medium) was added and reacted at 37°C and 500 rpm for 30 minutes. The AuNPs were washed 3 times with TET buffer by magnetic attraction. 80 μL of 1.5M formic acid was used to elute the AuNPs from the reaction system. The eluate was collected and digested with acid. After the digestion was completed, the volume was fixed to 5 mL. After filtering through a filter membrane, the sample was injected into the ICP-MS for detection. MCF-7 cells were detected by inductively coupled plasma mass spectrometry (ICP-MS) to verify the sensitivity of this method. Figure 2 As shown, the blank group did not contain MCF-7 cell samples. MUC1 MCF-7 cells can be effectively captured. Au-HCR exhibits extremely high recognition ability and can bind to the target MCF-7 cells sensitively and accurately, meeting the expected goal.

[0044] Polyacrylamide gel electrophoresis (PAGE) analysis steps: reaction products (including H1, H2, Apt AS1411-HCR The reaction systems with and without the addition of initiator chains were analyzed by 12% polyacrylamide gel electrophoresis (PAGE) in 1× TBE buffer at a constant voltage of 100 V for 90 min. The gel was stained with 1× Gel Green and images were captured using a gel documentation system. Figure 3As shown, groups 1-6 contain H1, H2, Apt AS1411-HCR The results indicate that the two hairpin units H1 and H2 successfully underwent HCR amplification, which is in line with the expected assumption.

[0045] Specific detection steps: Under the same conditions, 200 μL of MCF-7 cells, HepG2 cells, BEAS-2B cells, and a mixture of MCF-7 cells and HepG2 cells, a mixture of MCF-7 cells and BEAS-2B cells, and a mixture of MCF-7 cells, HepG2 cells, and BEAS-2B cells (1000 cells each) were detected. The detection method was consistent with the inductively coupled plasma mass spectrometry detection steps for MCF-7. Figure 4 As shown, group A contains no cell samples, groups B and D contain 1000 HepG2 cells, 1000 BEAS-2B cells, and 1000 MCF-7 cells, respectively; group E contains a mixed sample of 1000 MCF-7 cells and 1000 HepG2 cells; group F contains a mixed sample of 1000 MCF-7 cells and 1000 BEAS-2B cells; and group G contains a sample of 1000 MCF-7 cells, 1000 HepG2 cells, and 1000 BEAS-2B cells. This result shows that the composite probe synthesized by the method of the present invention has good selectivity for MCF-7 cells and can specifically recognize MCF-7 cells.

[0046] Analytical performance investigation: Based on the above conditions, ICP-MS was used to detect the relationship between the AuNPs signal value and the number of target MCF-7 cells in the range of 50 to 2000 MCF-7 cells. Figure 5 As shown in the figure, the results show that in the range of 50-2000 MCF-7 cells, the AuNPs signal value detected by ICP-MS shows a good linear relationship with the target MCF-7 cell number, and the detection limit can be as low as 2 MCF-7 cells.

[0047] ② Blood samples were used for the detection of actual biological samples. The blood was collected by Fujian Provincial Maternal and Child Health Hospital, Affiliated Hospital of Fujian Medical University, in accordance with the regulations of the local ethics committee. Blood samples from healthy blood donors were treated with red blood cell lysate and added to MCF-7 cells for CTCs capture and detection. 20 μL of Au-HCR solution was added to 200 μL of spiked samples (containing 100, 200 and 500 MCF-7 cells) and incubated at 37°C and 400 rpm for 45 minutes. Then 10 μL of MBs-Apt was added. MUC1 The solution was incubated for 30 minutes, washed, and then eluted and digested for ICP-MS detection. The test results are shown in Table 2 below.

[0048] Table 2: Actual blood sample test results

[0049]

[0050] The results showed that the coexisting components in blood hardly interfered with the proposed analytical method, thus showing good prospects for practical application.

[0051] The present invention successfully achieved high-sensitivity and rapid detection of MCF-7 cells by utilizing ICP-MS detection technology, gold nanoparticle (AuNPs) labeling, and hybridization chain reaction (HCR) signal amplification strategy. This technology provides an important technical reference for early cancer diagnosis and other related biochemical analyses. The Au-HCR detection strategy exhibits high efficiency and stability, generating a high signal response through the AuNPs-labeled HCR assembly, while simultaneously utilizing magnetic beads modified with oligonucleotide sequences to capture and separate circulating tumor cells (CTCs) from complex samples, thereby improving the sensitivity of detection and ensuring good selectivity. In the technical solution of the present invention, as the number of MCF-7 cells increases, the counts per second (CPS) value continues to rise, showing a good linear relationship in the range of 50 to 2000 cells, achieving a low detection limit for cells containing only 2 MCF-7 cells. The recovery rate of this detection method in blood samples ranges from 96.0% to 106.0%, fully demonstrating its potential in practical applications.

[0052] The present invention not only overcomes the technical obstacle of insufficient sensitivity in existing MCF-7 detection methods, but also adheres to the concept of ecological environmental protection and adopts environmentally friendly and biocompatible reagents, achieving remarkable results.

[0053] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. Such changes and modifications are intended to fall within the scope of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS, characterized in that: The steps include: Gold nanoparticle synthesis steps: Add deionized water and chloroauric acid solution to a container, heat it, and quickly add trisodium citrate solution to obtain AuNPs solution after reaction. Place it in a bottle and store it away from light. Composite probe synthesis steps: Design the oligonucleotide characteristic sequence for synthesizing composite probes, and synthesize three composite probes, namely MBs-Apt MUC1 , Au-H1 and Au-HCR; Inductively coupled plasma mass spectrometry detection steps: digest the cells and centrifuge them. After centrifugation, use culture medium to make up the volume and then dilute. Then, add Au-HCR reaction to the cell solution, and then add MBs-Apt MUC1 Continue the reaction, and after the reaction is completed, separate it by magnetic attraction, wash the precipitate with TET buffer, add BSA to react, wash it with TET buffer by magnetic attraction, and elute AuNPs from the reaction system with formic acid; collect the eluate, digest it with acid, and after digestion, adjust the volume, filter it through a filter membrane, and then detect it by ICP-MS.

2. The highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS according to claim 1, characterized in that The composite probe synthesis step comprises: MBs-Apt MUC1 Synthesis steps: MBs were washed with TET buffer and then dispersed in TES buffer; then, AptMUC1 was added for reaction; finally, the MBs were washed with TET buffer and finally dispersed in PBS buffer. Au-H1 synthesis steps: take aptamer H1 and add AuNPs, freeze it, let it thaw at room temperature, add BSA to react, centrifuge after the reaction is complete, remove the supernatant, and redissolve it in PBS buffer; Au-HCR synthesis steps: H2, Apt AS1411-HCR and initiator chains were diluted separately; H2 and Apt AS1411-HCR The mixture was mixed and reacted, and Au-H1 and the initiator chain were added for incubation to form Au-HCR through HCR. After the reaction was completed, the mixture was centrifuged and finally redispersed in PBS buffer.

3. The highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS according to claim 2, characterized in that, The Apt MUC1 The oligonucleotide sequence is Biotin-AAAAAGCAGTTGATCCTTTGGATACCCTGG; Apt AS1411-HCR The oligonucleotide sequence of the primer chain is CAGCCTGCACTCTAACGGTGGTGGTGGTTGTGGTGGTGGTGGGTTAGA; the oligonucleotide sequence of the priming chain is AGTCTAGGATTCGGTTAA; the oligonucleotide sequence of H1 is TTAACCGAATCCTAGACTCAAAGTAGTCTAGGATTCAAAAAGCACGGACGAAAAA-SH; the oligonucleotide sequence of H2 is GTGCAGGCTGAATTAAAGTCTAGGATTCGGTTAAGAATCCTAGACTACTTTG.

4. The highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS according to claim 1, characterized in that Also includes: Polyacrylamide gel electrophoresis analysis steps: Reaction products were analyzed by polyacrylamide gel electrophoresis in TBE buffer at a constant voltage; The gel was stained and images were captured using a gel documentation system.

5. The highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS according to claim 4, characterized in that, The reaction products include H1, H2, Apt AS1411-HCR , reaction system with / without the addition of initiator chain.

6. The highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS according to claim 1, characterized in that: Also includes: Specific detection steps: MCF-7 cells, HepG2 cells, BEAS-2B cells, mixed samples of MCF-7 cells and HepG2 cells, mixed samples of MCF-7 cells and BEAS-2B cells, and mixed samples of MCF-7 cells, HepG2 cells, and BEAS-2B cells were detected under the same conditions.

7. The highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS according to claim 6, characterized in that: Also includes: Analytical performance evaluation steps: Using ICP-MS to detect the relationship between the AuNPs signal value and the number of target MCF-7 cells within a range of multiple MCF-7 cells; Actual biological sample detection steps: blood samples are treated with red blood cell lysis buffer and added to MCF-7 cells for CTC capture and detection; Au-HCR solution is added to the spiked sample and incubated; then MBs-AptMUC1 solution is added and incubation continues. After washing, elution and digestion are performed for ICP-MS detection.

8. The highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS according to claim 1, characterized in that: The volume of the deionized water is 98-99 mL, and the volume of the chloroauric acid solution is 1.5-2.0 mL.

9. The highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS according to claim 1, characterized in that: The concentration of trisodium citrate is 38-39 mM.

10. The highly sensitive detection method for human breast cancer cells MCF-7 based on ICP-MS according to claim 1, characterized in that: In the gold nanoparticle synthesis step, the heating time is 135-145 minutes and the reaction time is 25-35 minutes.

Images