InDel molecular marker related to brassica campestris branch number and application of InDel molecular marker
By developing InDel molecular markers related to the number of branches in cabbage stalks and using PCR amplification and electrophoresis detection technology, the problem of low efficiency in traditional breeding methods was solved, and rapid and accurate branching trait screening and accelerated breeding process were achieved.
Patent Information
- Application Number
- CN202510940719.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-09
- Publication Date
- 2025-10-10
AI Technical Summary
Traditional breeding methods are inefficient and time-consuming when improving the branching traits of cabbage stalks. There is a lack of effective molecular markers for rapid identification of branch numbers, resulting in a slow breeding process.
InDel molecular markers related to the number of branches in Chinese cabbage stalks were developed. PCR amplification and electrophoresis detection techniques were used to determine the branch type based on the size of the amplified product fragment. Primers A0909-F and A0909-R were designed for PCR amplification, and the GradedPool-Seq method was used to locate and screen the branching trait.
It improves the accuracy of screening for branching traits of cabbage stalks and the breeding efficiency, shortens the breeding period, enables rapid identification and screening of multi-branched or single-branched materials, and promotes the variety breeding process.
Smart Images

Figure CN120758655A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular biology, and particularly relates to a Chinese flowering cabbage branch number related InDel molecular marker and application thereof. BACKGROUND
[0002] Chinese flowering cabbage is a variety of Brassica rapa L. ssp. Pekinensis, and is widely planted in Hunan and other places, and occupies an important position in the vegetable market. Chinese flowering cabbage is a kind of vegetable with flower stalk as edible organ, and the number of flower stalks depends on the branch number. The branch trait has important significance in the growth and development, yield formation and the like of Chinese flowering cabbage.
[0003] The branch number of Chinese flowering cabbage is a quantitative trait, which is controlled by multiple genes and is easily affected by environmental factors. Traditional breeding methods face problems such as low efficiency and long cycle in the improvement of the branch trait. With the development of molecular biology technology, molecular marker assisted breeding has become an important means to break through the bottleneck of traditional breeding. Among them, the InDel marker can accelerate the screening of target traits and speed up the breeding process due to its high stability, low cost, rich polymorphism and easy detection, and needs to be widely applied.
[0004] Although researches on branches or tillers have been carried out in crops such as rice, Arabidopsis thaliana and tomato, there is no research on the branch number of Chinese flowering cabbage and the molecular marker related to the branch number of Chinese flowering cabbage. The development of the molecular marker related to the branch number of Chinese flowering cabbage can be used for molecular marker assisted breeding of Chinese flowering cabbage, and the branch trait of Chinese flowering cabbage can be rapidly identified at the seedling stage. The molecular marker is used for PCR amplification, and the branch type of Chinese flowering cabbage is determined according to the size of the product, so as to speed up the breeding process. SUMMARY
[0005] The technical scheme adopted by the application is as follows: an InDel molecular marker related to the branch number of Chinese flowering cabbage, the sequence of which is
[0006] A0909-F: AATGTTGAGTGGGGGTAAG
[0007] A0909-R: CTAAACCAAGCAACTTCTCC.
[0008] Further, the product of the InDel molecular marker related to the branch number of Chinese flowering cabbage is applied in any one of the following:
[0009] (1) molecular marker assisted breeding of Chinese flowering cabbage;
[0010] (2) identification or auxiliary identification of the branch number trait of Chinese flowering cabbage.
[0011] Further, a method for determining the branch trait of Chinese flowering cabbage comprises the following steps:
[0012] (1) extracting genomic DNA from the Chinese cabbage stalk to be tested;
[0013] (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification on it using the primers of the molecular marker, and performing electrophoresis detection on the PCR amplification product;
[0014] (3) Determine based on the electrophoresis bands in step (2).
[0015] Furthermore, the criteria for determining the electrophoresis bands are:
[0016] If the amplified product is a single band of a 108 bp nucleotide fragment identical to that of the multi-branching parent 'BCT38', the tested Chinese cabbage stalk material has the multi-branching trait;
[0017] If the amplified product is a single 117 bp band identical to that of the single-branched parent 'CX010', the tested Chinese cabbage stalk material has a single-branched trait.
[0018] Furthermore, the amplification reaction system was 6 μL of ddH2O, 1 μL of DNA, 1 μL of Buffer, 0.8 μL of dNTP, 0.2 μL of Taq enzyme, and 0.5 μL of each of upstream and downstream primers.
[0019] Furthermore, the amplification reaction procedure was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55-60°C for 30 s, extension at 72°C for 1 min, and post-extension at 72°C for 5 min.
[0020] After adopting the above structure, the beneficial effects of the present invention are as follows:
[0021] (1) The present invention can be used to screen materials with different branching characteristics of Chinese cabbage stalks, thereby improving the accuracy of selection;
[0022] (2) The multi-branched Chinese cabbage stalk ‘BCT38’ and the single-branched Chinese cabbage heart ‘CX010’ were used to generate an F2 segregating population. The population was mapped using the GradedPool-Seq method. Based on the resequencing data of the mapped intervals, an InDel molecular marker A0909 related to the branching trait was developed. This molecular marker can effectively screen out plants with different branching characteristics in the F2 segregating population.
[0023] (3) The molecular markers provided by the present invention are used to detect the F2 segregation population. The individual plants that amplify the nucleotide fragments consistent with the multi-branching trait show multi-branching, and the identification accuracy is high. They can be used as molecular markers for branching traits, accelerate the breeding process, shorten the breeding years, and promote the selection of cabbage stalk varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] The accompanying drawings are used to provide further understanding of the present invention and constitute a part of the specification. They are used to explain the present invention together with the embodiments of the present invention and do not constitute a limitation of the present invention.
[0025] Figure 1 The branching morphology of the multi-branched Chinese cabbage stalk female parent ('BCT38') and the single-branched Chinese cabbage heart male parent ('CX010');
[0026] Figure 2 The branch number statistical diagram of the two parents and the branch number distribution diagram of the F2 population plants provided in this application;
[0027] Figure 3 This is the preliminary map of the gene for identifying branch number in Chinese cabbage stalk using the GradedPool-Seq method;
[0028] Figure 4 It is a fine-mapping map of branching-related genes;
[0029] Figure 5 The characteristic sequence electrophoresis patterns of the InDel markers provided in this example in two varieties (the multi-branching parent 'BCT38') and the few-branching parent 'CX010') and in the F2 population materials;
[0030] Figure 6 Marker validation table for population phenotype. DETAILED DESCRIPTION
[0031] Example 1: Construction of genetically isolated populations
[0032] The experimental materials used in this application were provided by the Vegetable Genetics, Breeding and Biotechnology Research Group of Shenyang Agricultural University, including the multi-branched Chinese cabbage stalk 'BCT38' and the single-branched Chinese cabbage heart 'CX010'.
[0033] The Chinese cabbage stalk material 'BCT38' is a DH line derived from a multi-branched Chinese cabbage stalk by the free microspore culture method.
[0034] The Chinese flowering cabbage material 'CX010' is a DH line derived from the common single-branched flowering cabbage by the free microspore culture method.
[0035] Using 'BCT38' and 'CX010' as parents, F1 plants were obtained by hybridization. The F1 plants were self-pollinated to construct F2 segregating populations. From the 1013 F2 populations, 50 plants each of few-branched plants with 1-4 branches, many-branched plants with 8-9 branches, and many-branched plants with 5-7 branches were selected to construct F2 segregating populations. Parental and F2 few-branched pools, intermediate pools, and many-branched pools were constructed for GradedPool-Seq sequencing and genetic mapping.
[0036] The F1 population was planted in the autumn of 2021, and the F2 population was planted in the spring of 2022. During the experiment, the two parents and the constructed F2 population were planted in the greenhouse breeding base on the back mountain of Shenyang Agricultural University. After germination, the seedlings were raised in plug trays. Normal cultivation and management methods were adopted. The number of branches at the base of each plant was counted during the period when the branch phenotype was most obvious. Among them, the standard for investigating the number of branches was that the number of branches within 5 cm of the base of the stem was the branches at the base of the stem.
[0037] Example 2: InDel molecular marker development
[0038] 1.GradedPool-Seq (GPS) initial positioning
[0039] Fifty plants each from the multi-branch pool, the few-branch pool, and the intermediate pool were selected from the F2 segregating population. Leaf genomic DNA was extracted using the modified CTAB method. After extraction, the concentration was determined and the samples were diluted and adjusted before equal mixing. The extracted DNA from the mixed pool samples was sent to Shanghai Paisonno Biotechnology Co., Ltd. for GPS sequencing. The information from the Chinese cabbage genome database (http: / / brassicadb.org / brad / datasets / pub / Genomes / Brassica_rapa / V3.5 / ) was used as the The reference genome was combined with the sequencing results of the two parents, and the filtered SNP sites were tested using Ridit analysis. The frequency differences of SNPs between different mixed pools were calculated. After Ridit test analysis, the data were denoised, and the proportion of sites with significant p-values to the total sites in the sliding window area was counted to determine the regions significantly associated with the traits. Finally, three candidate regions related to the branching trait were obtained, which were 31.6Mb~32.4Mb, 32.8Mb~33.2Mb, and 34.0Mb~34.8Mb, respectively, and located on chromosome A09.
[0040] 2. InDel Primer Design
[0041] According to the GPS sequencing results, InDel markers were designed at sites with large fragment differences in the peak region, and primers were designed using Premier 5.0 software. The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.
[0042] 3. InDel Primer Screening
[0043] The linkage relationship between the polymorphic marker and the target gene was verified using individual plants from the segregating population. Based on the sequencing results, molecular markers were designed and screened for polymorphisms at InDel sites on chromosome A09 that differed by more than 5 bp between the two parents. Finally, the A0909InDel marker closest to the gene controlling the branching trait was obtained.
[0044] Example 3: Method for identifying branching traits of Chinese cabbage stalks using InDel molecular markers
[0045] 1. Method for extracting genomic DNA from leaves of parents and F2 populations
[0046] (1) Fresh leaves were quickly frozen in liquid nitrogen, ground into powder, and transferred to a 2 ml centrifuge tube. 700 μL of CTAB solution preheated to 65°C was added to allow the solution to fully contact the leaves. The centrifuge tube was placed in an oven for 40 min, inverted and shaken every 10 min. The centrifuge tube was placed in an oven for 60 min, shaken every 10 min.
[0047] (2) Remove the centrifuge tube from the oven, cool it for 10 minutes, add 700uL of chloroform:isoamyl alcohol (24:1), invert it for 3 minutes, mix it thoroughly, centrifuge it at room temperature for 10 minutes at a speed of 12000 rpm, and transfer 450uL of the supernatant to a pre-sterilized centrifuge tube.
[0048] (3) Add 2 times the volume of anhydrous ethanol (about 900 μL) pre-cooled in a -30°C refrigerator to the centrifuge tube, shake gently, place the centrifuge tube in a -80°C refrigerator for 10 minutes, centrifuge at room temperature for 10 minutes at a speed of 12,000 rpm, discard the supernatant, invert the centrifuge tube on filter paper, absorb it, add 700 μL of 70% ethanol, and centrifuge for 3 minutes at a speed of 3,000 rpm.
[0049] (4) Repeat step (3), discard the supernatant, invert the centrifuge tube overnight, add 100uL of pre-sterilized ultrapure water the next day, centrifuge for 2 minutes at 12000rpm, detect the DNA concentration with an enzyme-labeled instrument, and store in a -20℃ refrigerator.
[0050] 2. Amplification of labeled primer A0909 in parental and F2 population DNA
[0051] The amplification reaction system was as follows: 6 μL ddH2O, 1 μL DNA, 1 μL Buffer, 0.8 μL dNTP, 0.2 μL Taq, and 0.5 μL each of upstream and downstream primers. The amplification reaction procedure was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55-60°C for 30 s, and extension at 72°C for 1 min (35 cycles); and post-extension at 72°C for 5 min.
[0052] 3. Polyacrylamide gel electrophoresis detection
[0053] The PCR products were separated by 6% non-denaturing polyacrylamide gel electrophoresis at 220V constant power, and finally silver stained for color development. After color development, the gel was placed under a film viewing light to read and record the band pattern.
[0054] 4. Genotyping Statistics
[0055] The electrophoresis results were photographed under a light. If the band separated by primer A0909 was consistent with the band of the multi-branched Chinese cabbage 'BCT38' and contained only a 108bp DNA fragment, its sequence was Seq ID No.1, indicating that the material showed multi-branching and was recorded as A; if it was consistent with the band of the few-branched Chinese cabbage 'CX010' and contained a 117bp DNA fragment, its sequence was Seq ID No.2, indicating that the material showed few branches and was recorded as B; if the material with both 108bp and 117bp bands was present, it was a dominant heterozygous single plant, showing moderate branching and was recorded as H.
[0056] Seq ID No.1:
[0057] AATGTTGAGTGGGGGTAAGATCCAAAGCTTTCGTCTTTTTGCGGGATTGATACTAAAGTTTGAGCCTTTTGATTTGATCTGTTTG AGGAGAAGTTGCTTGGTTTAG
[0058] Seq ID No.2:
[0059] AATGTTGAGTGGGGGTAAGATCCAAAGCTTTCGTCTTTTTGCGGGATTGATACTAAAGTTTGAGCCTTTTTTGGCTTTGATATTTG ATCTGTTTGAGGAGAAGTTGCTTGGTTTAG
[0060] 5. Feasibility Verification
[0061] To verify the feasibility and accuracy of this marker, 30 F2 samples were identified using this method. All sample materials were from the Vegetable Genetics, Breeding and Biotechnology Laboratory of Shenyang Agricultural University, and the degree of individual plant correspondence was high.
[0062] The above results show that the use of InDel markers and primers developed in this study can more quickly screen the number of branches based on the genotype of F2 individual plants, greatly improving breeding efficiency, having important application value, and providing theoretical and technical support for the cultivation of high-quality new varieties of Chinese cabbage stalks.
[0063] Although the embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents. In short, if those skilled in the art are inspired by the present invention and, without departing from the purpose of the present invention, design structures and embodiments similar to the technical solution without inventiveness, they shall fall within the scope of protection of the present invention.
Claims
1. An InDel molecular marker related to the number of branches in Chinese cabbage stalks, characterized by: The sequence is A0909-F:AATGTTGAGTGGGGGTAAG A0909-R: CTAAACCAAGCAACTTCTCC.
2. Use of the product of InDel molecular marker related to the number of branches of Chinese cabbage stalks according to claim 1 in any of the following: (1) Molecular marker-assisted breeding of Chinese cabbage stalks; (2) Identify or assist in identifying the characteristics of the number of branches of cabbage stalks.
3. A method for determining the branching characteristics of cabbage stalks, characterized in that: The following steps are involved: (1) extracting genomic DNA from the Chinese cabbage stalk to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification on it using the primers of the molecular marker, and performing electrophoresis detection on the PCR amplification product; (3) Determine based on the electrophoresis bands in step (2).
4. The InDel molecular marker related to the number of branches of Chinese cabbage stalks according to claim 3, characterized in that: The criteria for determining the electrophoresis bands are: If the amplified product is a single band of a 108 bp nucleotide fragment identical to that of the multi-branching parent 'BCT38', the tested Chinese cabbage stalk material has the multi-branching trait; If the amplified product is a single 117 bp band identical to that of the single-branched parent 'CX010', the tested Chinese cabbage stalk material has a single-branched trait.
5. The method for determining the branching characteristics of Chinese cabbage stalks according to claim 4, wherein: The amplification reaction system was 6 μL of ddH2O, 1 μL of DNA, 1 μL of Buffer, 0.8 μL of dNTP, 0.2 μL of Taq enzyme, and 0.5 μL of each of upstream and downstream primers.
6. The method for determining the branching characteristics of Chinese cabbage stalks according to claim 4, wherein: The amplification reaction program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55-60°C for 30 s, extension at 72°C for 1 min, and post-extension at 72°C for 5 min.