KASP molecular marker related to wheat ear type and application of KASP molecular marker
By screening key SNP sites of wheat spike type through first-generation sequencing and developing KASP molecular markers, combined with PCR and fluorescence detection, the problem of time-consuming and labor-intensive traditional wheat spike type identification was solved, efficient and accurate spike type trait identification was achieved, and wheat breeding efficiency was improved.
Patent Information
- Application Number
- CN202511217014.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-28
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2045-08-28
AI Technical Summary
Traditional field phenotyping methods for wheat spike type identification are greatly affected by the environment, are highly subjective, time-consuming and labor-intensive, and difficult to quantify, making it difficult to efficiently screen for excellent haploid wheat in the early breeding stages.
Through first-generation sequencing, the key variant SNP site Chr2B-571534091 related to wheat spike type was screened, and KASP molecular marker primers were developed. Combined with Touchdown PCR and fluorescence detection technology, wheat spike type traits were quickly identified.
It has achieved high-throughput, low-cost, and high-accuracy identification of spike type traits, improved the efficiency of wheat breeding and variety selection, and quickly screened out excellent haploid wheat with longer spike length, more spikelets, and more grains per spike.
Smart Images

Figure CN120758667A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and particularly relates to a KASP molecular marker related to wheat spike type and an application thereof. Background Art
[0002] Common wheat (Triticum aestivum L.), as an important crop, is the primary food source for more than one-third of the world's population and holds an extremely important economic and nutritional position globally. Its spike type is of great significance to agricultural production, directly affecting the number of spikes and grains per spike, two factors that primarily determine wheat yield. Wheat with larger spike types (longer spike length, more spikelets, and more grains per spike) generally has higher yield potential. Spike type is also associated with disease resistance, adaptability to the external environment, and harvest efficiency. Therefore, optimizing wheat spike type through breeding and cultivation management is of great significance for improving agricultural production efficiency and sustainable development.
[0003] Identifying superior crop varieties is a complex and crucial process, involving multiple methods, principles, and techniques. Traditional field phenotyping relies on visible crop characteristics, such as morphology, physiology, and yield. Variety identification is performed by observing and measuring crop phenotypic traits. However, this approach suffers from significant environmental influences, is highly subjective, time-consuming, and labor-intensive, and difficult to quantify. With the development of molecular biology techniques, this approach is being supplemented by more precise techniques, such as marker-assisted selection (MAS), which predicts phenotypic performance by analyzing the genetic composition of individuals. This approach allows selection for specific traits in crops during early growth stages, even at the seed stage, thereby accelerating the breeding process and improving breeding efficiency. MAS is based on the linkage between DNA markers and target traits. These markers rely on DNA sequence polymorphisms, which can be single nucleotide variations (SNPs) or DNA fragment length variations (e.g., microsatellites). By identifying markers that are tightly linked to the target trait, individuals with the desired genetic background can be selected without waiting for phenotypic expression.
[0004] Currently, there are a variety of techniques for performing SNP typing in crops. These can be categorized into PCR-dependent techniques, such as the TaqMan probe method, the SNaPshot method, and the KASP method, which rely on PCR amplification to detect SNP sites; mass spectrometry-dependent techniques, such as the MassARRAY method and time-of-flight mass spectrometry (MALDI-TOF), which use mass spectrometry analysis to determine genotypes; microarray technologies, such as the Illumina BeadXpress method, which use DNA chips to detect a large number of SNP sites; and sequencing-based techniques, which directly read DNA sequences through high-throughput sequencing to discover and identify SNP sites. The KASP primers developed in this invention have the advantages of requiring a small sample size, high accuracy, and the ability to perform high-throughput detection for identifying superior haplotypes in wheat. Summary of the Invention
[0005] One of the purposes of the present invention is to provide a KASP molecular marker related to wheat spike type, thereby providing a new approach for the breeding of superior haploid wheat.
[0006] The second purpose of the present invention is to provide the application of the above-mentioned molecular markers in identifying wheat spike type traits, mainly used to identify or assist in identifying excellent haplotypes (types with longer spike length, more spikelets, and more grains per spike) of wheat.
[0007] A third object of the present invention is to provide a method for identifying wheat spike type traits.
[0008] A fourth object of the present invention is to provide a kit for wheat spike type traits and its application.
[0009] In order to achieve the above object, the technical solution of the present invention is as follows:
[0010] Through next-generation sequencing, the present invention identified a key variant SNP site associated with wheat spike type, Chr2B-571534091, located at nucleotide 571534091 on chromosome 2B of the common wheat (Triticum aestivum L.) reference genome IWGSC RefSeqv1.1, with a polymorphism of either A or T. A corresponding KASP molecular marker (named TaYAB3-B-KASP) was developed. The primer sequence for amplifying the KASP molecular marker is:
[0011] TaYAB3-B-345-F 1:5'
[0012] -GAAGGTGACCAAGTTCATGCTCGACGACAGATCCGAGGCA-3' (SEQ ID NO. 1);
[0013] TaYAB3-B-345-F2:
[0014] 5'-GAAGGTCGGAGTCAACGGATTCGACGACAGATCCGAGGCT-3' (SEQ ID NO. 2);
[0015] TaYAB3-B-345-C: 5'-GTGGGGAGGGATGAATGGAC-3' (SEQ ID NO. 3).
[0016] The difference between primers TaYAB3-B-345-F1 and TaYAB3-B-345-F2 lies in the different SNPs at the 3' end. Primer TaYAB3-B-345-F1 corresponds to genotype A of the Chinese Spring wheat reference genome and belongs to the non-superior haplotype TaYAB3-B-Hap 1 mentioned in the present invention. Primer TaYAB3-B-345-F2 corresponds to genotype T of the non-Chinese Spring wheat and belongs to the superior haplotype TaYAB3-B-Hap 2 mentioned in the present invention. The superior haplotype exhibits longer spikelets, more spikelets, and more grains per spike compared to the non-superior haplotype.
[0017] The 5' end of primer TaYAB3-B-345-F1 is connected to a FAM fluorescent linker, and the 5' end of primer TaYAB3-B-345-F2 is connected to a HEX fluorescent linker. The sequences of the FAM and HEX fluorescent linkers are:
[0018] FAM: GAAGGTGACCAAGTTCATGCT (SEQ ID NO.4);
[0019] HEX: GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 5).
[0020] The present invention also protects the use of the above molecular markers in identifying wheat spike type traits.
[0021] Specifically, the method for identifying wheat spike type traits is:
[0022] (1) Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using the above-mentioned molecularly labeled primers to obtain amplified products;
[0023] (2) The amplified products were subjected to fluorescence detection and analysis. If the test result was FAM, the wheat to be tested was TaYAB3-B-Hap 1, which was a non-superior haplotype. If the test result was HEX, the wheat to be tested was TaYAB3-B-Hap 2, which was a superior haplotype (i.e., a type with longer spikelets, more spikelets, and more grains per spike). If there were two test results, the wheat to be tested was a heterozygote (which existed in theory).
[0024] Specifically, touchdown PCR was used for PCR amplification. The touchdown PCR amplification procedure was as follows: first stage, denaturation at 95°C for 15 min; second stage, denaturation at 95°C for 20 s, annealing at 65°C for 1 min (the temperature was lowered by 1°C per cycle starting from the second cycle, for a total of 9 cycles); third stage, denaturation at 95°C for 10 s, annealing at 65°C for 1 min. The components and amounts used in the PCR amplification are shown in Table 1.
[0025] Table 1 Components and dosages used in PCR amplification
[0026]
[0027] In addition, the present invention also protects a kit for identifying wheat spike traits, comprising the aforementioned KASP molecular marker primers (TaYAB3-B-345-F1, TaYAB3-B-345-F2, and TaYAB3-B-345-C). The other components of the kit are conventional reagents, specifically PCR buffer, dNTPs, and Taq DNA polymerase. The present invention does not specifically limit the concentration of the primer pairs; primer concentrations well known in the art may be used. The present invention does not specifically limit the sources of the PCR buffer, dNTPs, and Taq DNA polymerase; conventional PCR amplification reagents well known in the art may be used.
[0028] The invention also protects the use of the above-mentioned kit in identifying wheat spike type traits, and the specific identification method refers to the above-mentioned method for identifying wheat spike type traits.
[0029] Advantages of the present invention:
[0030] The present invention screened key allelic variation sites related to wheat spike type through first-generation sequencing and developed a set of KASP primers, which can use fluorescence detection technology to perform molecular marker-assisted selection of spike type-related traits in the wheat breeding process with high throughput, low cost, high accuracy and high efficiency.
[0031] The KASP molecular marker primers of the present invention can quickly and efficiently identify whether the target sample contains the mutation site of the corresponding gene. As a molecular marker, they can be used to screen or assist in screening wheat spike phenotypes in the early stages of breeding. This will accelerate the genetic improvement of wheat spike type and greatly improve the selection efficiency and quality of wheat varieties or lines. They are of great value in the research or application of breeding high-yield wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1This is the verification of the molecular marker TaYAB3-B-KASP genotyping in resequencing data; in the figure, blue represents the non-superior haplotype TaYAB3-B-Ha p 1, red represents the superior haplotype TaYAB3-B-Ha p 2, and black represents the negative control: water.
[0033] Figure 2 This is the typing status of the molecular marker TaYAB3-B-KASP in the natural population; in the figure, blue represents the non-superior haplotype TaYAB3-B-Hap 1, red represents the superior haplotype TaYAB3-B-Hap 2, and pink represents the genotype that was not successfully typed.
[0034] Figure 3 The results of association analysis between the molecular marker TaYAB3-B-KASP genotype information and phenotypes (spike length, spikelet number, and number of spikelets per grain); in the figure, Hap1 is TaYAB3-B-Hap 1; Hap2 is TaYAB3-B-Hap 2; * indicates P < 0.05. DETAILED DESCRIPTION
[0035] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. However, the specific experimental methods involved in the following examples, unless otherwise specified, are all conventional methods or are performed under the conditions recommended by the manufacturer's instructions.
[0036] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.
[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0038] Biomaterials:
[0039] The natural population used was a natural population of 219 wheat materials with ear development phenotypic information from Xiao Jun's group at the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.
[0040] Experimental reagents:
[0041] 2×KASP master Mix (LGC Genomics, https: / / www.lgcgroup.com / ).
[0042] Experimental equipment:
[0043] Bio-Rad S1000 384-well PCR instrument (https: / / www.bio-rad.com / ).
[0044] Example 1 Primer development for KASP molecular markers
[0045] The present invention uses whole-genome resequencing variation detection and performance observation analysis to find a key variation site related to wheat spike type, which is located at nucleotide 571534091 on chromosome 2B of the common wheat (Triticum aestivum L.) reference genome IWGSCRefSeqv1.1, and the polymorphism is A or T.
[0046] The wheat genome was searched using BLAST of SNP marker flanking sequences (CS RefSeq v1.0, http: / / www.wheatgenome.org / ; IWGSC, 2018) to obtain sequences with high homology and perform multiple sequence alignment. Chromosome-specific KASP molecular marker primers were designed based on the alignment results:
[0047] TaYAB3-B-345-F1:5'
[0048] -GAAGGTGACCAAGTTCATGCTCGACGACAGATCCGAGGCA-3';
[0049] TaYAB3-B-345-F2:
[0050] 5'-GAAGGTCGGAGTCAACGGATTCGACGACAGATCCGAGGCT-3';
[0051] TaYAB3-B-345-C: 5'-GTGGGGAGGGATGAATGGAC-3'.
[0052] The KASP primers include two competitive primers (TaYAB3-B-345-F1 and TaYAB3-B-345-F2) and one common primer (TaYAB3-B-345-C). The 3′-terminal bases of the two competitive primers correspond to the two allelic variants, and the 5′-termini contain FAM (5′GAAGGTGACCAAGTTCATGCT 3′) and HEX (5′GAAGGTCGGAGTCAACGGATT 3′) tag sequences, respectively. The 3′-terminus of the common primer is located near the position where the sequence differs between the homologous sequences to maximize primer amplification specificity and minimize the amplification product fragment to less than 200 bp.
[0053] In this experiment, the 5' end of primer TaYAB3-B-345-F1 was connected to a FAM fluorescent linker, and the 5' end of primer TaYAB3-B-345-F2 was connected to a HEX fluorescent linker.
[0054] Using the known retested variety information, we selected wheat varieties corresponding to two haplotypes, extracted the whole genome DNA of the corresponding varieties, and then used the designed KASP primers to first test the experimental small group of these varieties. Figure 1 We found that different wheat varieties can be divided into two haplotypes. The typing results need to be consistent with the resequencing data to confirm that the KASP primers are usable.
[0055] Example 2 Application of KASP molecular marker primers in detecting wheat spike type
[0056] (1) Using the genomic DNA of the sample to be tested as a template, PCR amplification was performed using the above-mentioned molecularly labeled primers, and Touchdown PCR was used; the Touchdown PCR amplification procedure was as follows: first stage, denaturation at 95°C for 15 min; second stage, denaturation at 95°C for 20 s, annealing at 65°C + extension for 1 min (starting from the second cycle, the temperature was lowered by 1°C per cycle, for a total of 9 cycles); third stage, denaturation at 95°C for 10 s, annealing at 65°C + extension for 1 min.
[0057] (2) Detect and analyze the amplified products.
[0058] The molecular marker TaYAB3-B-KASP of the present invention is used to detect wheat germplasm resources of multiple varieties. If the test result is FAM, the genotype of the wheat to be tested is TaYAB3-B-Hap 1, which belongs to the non-excellent haplotype; if the test result is HEX, the genotype of the wheat to be tested is TaYAB3-B-Hap 2, which belongs to the excellent haplotype.
[0059] Based on the results of marker detection, it is determined whether there is a superior allele variation of the wheat spike type gene TaYAB3-B in each variety, and the superior haplotype of wheat is screened. The detection results of wheat germplasm resources are shown in Figure 2 , among which the typing results of wheat germplasm resources are shown in Table 2.
[0060] Table 2 Results of wheat germplasm resources and genotype detection
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079] Figure 3 The typing of the natural populations tested is shown in Table 2 and Figure 3 It can be seen that the present invention can effectively distinguish between excellent haplotypes and non-excellent haplotypes of wheat, and quickly screen out excellent haplotype wheat with longer spike length, more spikelets, and more grains per spike. This method can reduce the workload of later screening and identification, and can complete the seed purity identification work within a short time, with the advantages of being fast, low-cost, and easy to operate.
[0080] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, it is of course possible to easily make other implementation methods by replacing or changing the technical content disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.
Claims
1. A KASP molecular marker related to wheat spike type, characterized in that: The spike type is divided into superior haplotype and non-superior haplotype, wherein the superior haplotype is characterized by longer spike length, more spikelets, and more grains per spike compared to the non-superior haplotype; the primer sequence for amplifying the KASP molecular marker is: TaYAB3-B-345-F1:5' -GAAGGTGACCAAGTTCATGCTCGACGACAGATCCGAGGCA-3'; TaYAB3-B-345-F2: 5'-GAAGGTCGGAGTCAACGGATTCGACGACAGATCCGAGGCT-3'; TaYAB3-B-345-C: 5'-GTGGGGAGGGATGAATGGAC-3'.
2. The KASP molecular marker according to claim 1, characterized in that The 5' end of primer TaYAB3-B-345-F1 is connected to a FAM fluorescent linker, and the 5' end of primer TaYAB3-B-345-F2 is connected to a HEX fluorescent linker. The sequences of the FAM and HEX fluorescent linkers are: FAM: GAAGGTGACCAAGTTCATGCT; HEX: GAAGGTCGGAGTCAACGGATT.
3. Use of the KASP molecular marker according to claim 1 or 2 in identifying wheat spike type traits.
4. The use according to claim 3, characterized in that The KASP molecular marker is used for identifying or assisting in identifying the spike type traits of wheat.
5. A kit for identifying wheat spike traits, characterized in that: A primer comprising the KASP molecular marker described in claim 1.
6. Use of the kit according to claim 5 in identifying wheat spike type traits.
7. A method for identifying wheat spike traits, characterized in that: The method comprises the following steps: (1) using the genomic DNA of the wheat sample to be tested as a template and performing PCR amplification using the primers of the KASP molecular marker described in claim 1 to obtain an amplified product; (2) The amplified products were subjected to fluorescence detection and analysis. If the detection result was FAM, the wheat genotype to be tested was TaYAB3-B-Hap 1, which was a non-superior haplotype. If the detection result was HEX, the wheat genotype to be tested was TaYAB3-B-Hap 2, which was a superior haplotype.
8. The method for identifying wheat spike type according to claim 7, wherein Touchdown PCR was used for PCR amplification. The touchdown PCR amplification program was as follows: first stage, denaturation at 95°C for 15 min; second stage, denaturation at 95°C for 20 s, annealing and extension at 65°C for 1 min, with the temperature decreasing by 1°C each cycle starting from the second cycle, for a total of 9 cycles. The third stage was denaturation at 95°C for 10 s and annealing + extension at 65°C for 1 min.
Citation Information
Patent Citations
KASP marker relevant with wheat head length under low-salt condition and application of KASP marker
CN110527742A
SNP locus related to per-spike spikelet number and per-spike grain number characters of wheat and application of SNP locus
CN113699269A
SNP (Single Nucleotide Polymorphism) site related to spikelet number character of wheat per ear and application thereof
CN114410817A
Wheat plants with an increased yield
WO2023052562A1