A kasp molecular marker related to wheat ear type and application thereof

Abstract

The application discloses a KASP molecular marker related to a wheat ear type and application, finds a key variation site related to the wheat ear type through first generation sequencing, and develops a corresponding KASP molecular marker, and the primer of the KASP molecular marker can be used for quickly and efficiently identifying whether the target sample has the variation site of the corresponding gene, screening or assisting in screening the wheat ear type phenotype in the early breeding stage, accelerating the genetic improvement process of the wheat ear type, greatly improving the selection efficiency and quality of the wheat variety or strain, and having important value in the research or application of cultivating a high-yield wheat variety.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a KASP molecular marker related to wheat ear type and application. BACKGROUND

[0002] Common wheat (Triticum aestivum L.) is an important crop and the main food source for more than one-third of the world's population, and has an extremely important economic and nutritional position in the world. Ear type is of great significance to agricultural production and can directly affect ear number and grain number per ear, which are the main factors determining wheat yield. Wheat with larger ear type (longer ear length, more spikelets and more grains per ear) usually has higher yield potential, and ear type is also associated with disease resistance, adaptability to external environment and harvesting efficiency. Therefore, optimizing wheat ear type through breeding and cultivation management is of great significance to improving agricultural production efficiency and sustainable development.

[0003] The identification of excellent crop varieties is a complex and important process, which involves multiple methods, principles and operation techniques. Traditional field phenotypic identification relies on visible characteristics of crops, such as morphology, physiology and yield, and is performed by observing and measuring the phenotypic characteristics of crops. However, it has the disadvantages of being greatly affected by the environment, being highly subjective, consuming time and labor, and being difficult to quantify. With the development of molecular biology technology, it is gradually being supplemented by more accurate techniques, such as marker-assisted selection (MAS), which can predict the phenotypic performance of individuals by analyzing their genetic composition. This method can select certain traits of crops at the early growth stage or even at the seed stage, thereby accelerating the breeding process and improving breeding efficiency. The principle of MAS is based on the linkage relationship between DNA molecular markers and target traits. These molecular markers rely on the polymorphism of DNA sequences, which can be single nucleotide polymorphisms (SNPs) or DNA fragment length polymorphisms (such as microsatellites). By identifying molecular markers that are closely linked to target traits, individuals with desired genetic backgrounds can be selected without waiting for the appearance of phenotypic traits.

[0004] Currently, there are various techniques for SNP typing in crops; PCR-dependent techniques, such as TaqMan probe method, SNaPshot method and KASP technology, rely on PCR amplification to detect SNP sites; mass spectrometry-dependent techniques, such as MassARRAY method and time-of-flight mass spectrometry (MALDI-TOF), use mass spectrometry analysis to determine genotypes; chip technology, such as Illumina BeadXpress method, uses DNA chips to detect a large number of SNP sites; sequencing techniques directly read DNA sequences through high-throughput sequencing to discover and identify SNP sites. The KASP primer developed in the present application has the advantages of small sample size, high accuracy and high-throughput detection in identifying excellent haplotype wheat. SUMMARY

[0005] One of the purposes of the present application is to provide a KASP molecular marker related to wheat ear type, which provides a new way for the breeding of excellent haplotype wheat.

[0006] The second purpose of the present application is to provide the application of the above-mentioned molecular marker in identifying wheat ear type traits, which is mainly used to identify or assist in identifying excellent haplotype (wheat with longer ear length, more spikelets and more grains per ear) wheat.

[0007] The third purpose of the present application is to provide a method for identifying wheat ear type traits.

[0008] The fourth purpose of the present application is to provide a kit for wheat ear type traits and its application.

[0009] In order to achieve the above-mentioned purposes, the technical solutions of the present application are as follows:

[0010] The present application finds a key variant SNP site Chr2B-571534091 related to wheat ear type through next-generation sequencing, which is located at the 571534091th nucleotide of chromosome 2B of the common wheat (Triticum aestivum L.) reference genome IWGSC RefSeqv1.1, and the polymorphism is A or T. And a corresponding KASP molecular marker (named TaYAB3-B-KASP) is developed. The primer sequence for amplifying the KASP molecular marker is:

[0011] TaYAB3-B-345-F 1: 5'

[0012] -GAAGGTGACCAAGTTCATGCTCGACGACAGATCCGAGGCA-3' (SEQ ID NO. 1);

[0013] TaYAB3-B-345-F2:

[0014] 5'-GAAGGTCGGAGTCAACGGATTCGACGACAGATCCGAGGCT-3' (SEQ ID NO. 2);

[0015] TaYAB3-B-345-C: 5'-GTGGGGAGGGATGAATGGAC-3' (SEQ ID NO. 3).

[0016] The primer TaYAB3-B-345-F1 and the primer TaYAB3-B-345-F2 differ in the 3' end SNP. The primer TaYAB3-B-345-F1 corresponds to the genotype A of the wheat reference genome Chinese Spring, and belongs to the non-superior haplotype TaYAB3-B-Hap 1 involved in the present application; and the primer TaYAB3-B-345-F2 corresponds to the genotype T other than Chinese Spring, and belongs to the superior haplotype TaYAB3-B-Hap 2 involved in the present application. The superior haplotype has the advantages of longer ear length, more spikelets, and more grains per ear compared with the non-superior haplotype.

[0017] The 5' end of the primer TaYAB3-B-345-F1 is connected with a FAM fluorescent linker, and the 5' end of the primer TaYAB3-B-345-F2 is connected with a HEX fluorescent linker, and the sequences of the FAM and HEX fluorescent linkers are respectively:

[0018] FAM: GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 4);

[0019] HEX: GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 5).

[0020] The present application also protects the application of the above-mentioned molecular marker in identifying the wheat ear type traits.

[0021] Specifically, the method for identifying the wheat ear type traits is:

[0022] (1) Taking the genomic DNA of the sample to be tested as a template, the primers of the above-mentioned molecular marker are used for PCR amplification respectively to obtain an amplification product;

[0023] (2) The amplification product is subjected to fluorescence detection and analysis, if the detection result is FAM, the wheat to be tested is TaYAB3-B-Hap 1, which belongs to the non-superior haplotype; if the detection result is HEX, the wheat to be tested is TaYAB3-B-Hap 2, which belongs to the superior haplotype (i.e. the type of longer ear length, more spikelets, and more grains per ear); if the detection result has two kinds, the wheat to be tested is a hybrid (theoretically exists).

[0024] Specifically, the PCR amplification adopts Touchdown PCR; the Touchdown PCR amplification procedure is as follows: the first stage, denaturation at 95℃ for 15 min; the second stage, denaturation at 95℃ for 20 s, annealing and extension at 65℃ for 1 min (decrease by 1℃ for each cycle from the second cycle, for a total of 9 cycles); the third stage, denaturation at 95℃ for 10 s, annealing and extension at 65℃ for 1 min, wherein the components and the amounts used in the PCR amplification are shown in Table 1.

[0025] Table 1: Components and amounts used in PCR amplification

[0026]

[0027] In addition, the present application also protects a kit for identifying wheat ear type traits, wherein the kit comprises the primers (TaYAB3-B-345-F1, TaYAB3-B-345-F2, TaYAB3-B-345-C) of the KASP molecular marker described above. The other components of the kit all belong to conventional reagents. Specifically, they further include PCR Buffer, dNTP and Taq DNA polymerase. The present application does not have special limitations on the concentration of the primer pair, and the primer concentration known in the art can be used. The present application does not have special limitations on the source of the PCR Buffer, dNTP and Taq DNA polymerase, and the ordinary PCR amplification reagents known in the art can be used.

[0028] The kit described above is also protected for use in identifying wheat ear type traits, and the specific identification method refers to the method for identifying wheat ear type traits described above.

[0029] Advantages of the present application:

[0030] The present application screens the key allelic variation sites related to wheat ear type through one generation sequencing, and develops a set of KASP primers, so that the fluorescence detection technology can be used to perform high-throughput, low-cost, high-accuracy and high-efficiency molecular marker assisted selection on the ear type related traits in the wheat breeding process.

[0031] The KASP molecular marker primer of the present application can quickly and efficiently identify whether the target sample has the variation site of the corresponding gene, and can be used as a molecular marker to screen or assist in screening the wheat ear type phenotype in the early breeding stage, so as to accelerate the genetic improvement process of the wheat ear type, greatly improve the selection efficiency and quality of the wheat variety or strain, and has important value in the research or application of cultivating high-yield wheat varieties. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1Validation of molecular marker TaYAB3-B-KASP genotyping in re-sequencing data; in the figure, blue represents non-superior haplotype TaYAB3-B-Hap 1, red represents superior haplotype TaYAB3-B-Hap 2, and black represents negative control: water.

[0033] Figure 2 Genotyping of molecular marker TaYAB3-B-KASP in natural population; in the figure, blue represents non-superior haplotype TaYAB3-B-Hap 1, red represents superior haplotype TaYAB3-B-Hap 2, and pink represents genotype untyped successfully.

[0034] Figure 3 Results of association analysis of genotype information of molecular marker TaYAB3-B-KASP and phenotypes (ear length, spikelet number, and number of grains per spike); in the figure, Hap1 is TaYAB3-B-Hap 1; Hap2 is TaYAB3-B-Hap 2; * represents P < 0.05. DETAILED DESCRIPTION

[0035] The advantages and features of the present application will become more apparent with the description of specific embodiments. However, the specific experimental methods involved in the following examples are conventional methods or are implemented according to the suggested conditions in the manufacturer's instructions, unless otherwise specified.

[0036] Unless otherwise specified, the technical means used in the examples are conventional means known to those skilled in the art. The experimental methods in the following examples are conventional methods, unless otherwise specified. Unless otherwise specified, the reagents and materials used are commercially available.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as familiar to one skilled in the art. In addition, any method and material similar or equivalent to those described can be used in the present application. The preferred implementation methods and materials described herein are only for demonstration.

[0038] Biological materials:

[0039] The natural population used is a natural population of 219 wheat materials with spike development phenotype information from the Xiao Jun Group of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0040] Experimental reagents:

[0041] 2x KASP master Mix (LGC Genomics, https: / / www.lgcgroup.com / ).

[0042] Experimental equipment:

[0043] Bio-Rad Model S1000 384-Well PCR Machine (https: / / www.bio-rad.com / ).

[0044] Example 1 Primer development of KASP molecular markers

[0045] The present application finds a key variation site related to wheat ear type by whole genome resequencing variation detection and performance observation analysis, which is located at the 571534091th nucleotide of chromosome 2B of the common wheat (Triticum aestivum L.) reference genome IWGSCRefSeqv1.1, and the polymorphism is A or T.

[0046] BLAST search the wheat genome (CS RefSeq v1.0, http: / / www.wheatgenome.org / ; IWGSC, 2018) using SNP marker flanking sequence, obtain sequences with higher homology and perform multiple sequence alignment, and design chromosome-specific KASP molecular marker primers according to the alignment results:

[0047] TaYAB3-B-345-F1: 5'

[0048] -GAAGGTGACCAAGTTCATGCTCGACGACAGATCCGAGGCA-3';

[0049] TaYAB3-B-345-F2:

[0050] 5'-GAAGGTCGGAGTCAACGGATTCGACGACAGATCCGAGGCT-3';

[0051] TaYAB3-B-345-C: 5'-GTGGGGAGGGATGAATGGAC-3'.

[0052] The KASP primer includes two competitive primers (TaYAB3-B-345-F1, TaYAB3-B-345-F2) and a common primer (TaYAB3-B-345-C), wherein the 3' ends of the two competitive primers correspond to two allelic variations, respectively, and the 5' ends are added with FAM (5' GAAGGTGACCAAGTTCATGCT 3') and HEX (5' GAAGGTCGGAGTCAACGGATT 3') tag sequences, respectively; The common primer is located near the 3' end of the sequence difference between the homologous sequences to ensure the specificity of the primer amplification as much as possible, and at the same time, the amplification product fragment is less than 200bp as much as possible.

[0053] In the experiment, the 5' end of primer TaYAB3-B-345-F1 is connected with FAM fluorescent linker, and the 5' end of TaYAB3-B-345-F2 is connected with HEX fluorescent linker.

[0054] Two wheat varieties corresponding to the haplotype are selected by using known re-sequenced variety information, the whole genome DNA of the corresponding varieties is extracted, and then the KASP primer designed is used to detect the small population formed by the varieties first, such as Figure 1 After seeing that different wheat varieties can be divided into two haplotypes, the typing result needs to be consistent with the re-sequencing data, and it is confirmed that the KASP primer can be used.

[0055] Example 2 Application of KASP molecular marker primer in detection of wheat ear type

[0056] (1) Using the above molecular marker primer, the genomic DNA of the sample to be detected is used as a template for PCR amplification, and Touchdown PCR is used; the Touchdown PCR amplification program is as follows: the first stage, denaturation at 95℃ for 15min; the second stage, denaturation at 95℃ for 20s, annealing + extension at 65℃ for 1min (decrease by 1℃ for each cycle from the second cycle, a total of 9 cycles); the third stage, denaturation at 95℃ for 10s, annealing + extension at 65℃ for 1min.

[0057] (2) The amplification product is detected and analyzed.

[0058] Using the molecular marker TaYAB3-B-KASP of the application, a plurality of varieties of wheat germplasm resources are detected, if the detection result is FAM, the genotype of the wheat to be detected is TaYAB3-B-Hap 1, which belongs to a non-superior haplotype; if the detection result is HEX, the genotype of the wheat to be detected is TaYAB3-B-Hap 2, which belongs to a superior haplotype.

[0059] According to the detection result of the marker, it is judged whether the superior allelic variation of the wheat ear type gene TaYAB3-B exists in each variety, and the superior haplotype of wheat is screened. The detection results of the wheat germplasm resources are as follows Figure 2 , wherein the typing results of the wheat germplasm resources are shown in Table 2.

[0060] Table 2 Detection results of wheat germplasm resources and genotypes

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079] Figure 3 The typing of the detected natural populations is shown in Table 2 and... Figure 3 As can be seen, this invention can effectively distinguish between superior haplotypes and non-superior haplotypes of wheat, and quickly screen out superior haplotype wheat with longer spike length, more spikelets, and more grains per spike. This method can reduce the workload of subsequent screening and identification, and can complete the seed purity identification work in a short time. It has the advantages of being fast, low-cost, and easy to operate.

[0080] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. Use of a KASP molecular marker associated with wheat ear type in identifying wheat ear type traits, characterized in that, The ear type is divided into superior haplotype and non-superior haplotype, wherein the superior haplotype is longer in ear length, more in spikelet number and grain number per spike than the non-superior haplotype; the primer sequence of the KASP molecular marker is: TaYAB3-B-345-F1: 5'-GAAGGTGACCAAGTTCATGCTCGACGACAGATCCGAGGCA-3'; TaYAB3-B-345-F2: 5'-GAAGGTCGGAGTCAACGGATTCGACGACAGATCCGAGGCT-3'; TaYAB3-B-345-C: 5'-GTGGGGAGGGATGAATGGAC-3'; the 5' end of primer TaYAB3-B-345-F1 is connected with FAM, and the 5' end of primer TaYAB3-B-345-F2 is connected with HEX; if the detection result is FAM, the genotype of the wheat to be tested is TaYAB3-B-Hap 1, which belongs to non-superior haplotype; if the detection result is HEX, the genotype of the wheat to be tested is TaYAB3-B-Hap 2, which belongs to superior haplotype.

2. Use of a kit for identifying wheat spike type traits, characterized in that, The kit comprises the primer of the KASP molecular marker in claim 1, the ear type is divided into superior haplotype and non-superior haplotype, wherein the superior haplotype is longer in ear length, more in spikelet number and grain number per spike than the non-superior haplotype; the 5' end of primer TaYAB3-B-345-F1 is connected with FAM, and the 5' end of primer TaYAB3-B-345-F2 is connected with HEX; if the detection result is FAM, the genotype of the wheat to be tested is TaYAB3-B-Hap 1, which belongs to non-superior haplotype; if the detection result is HEX, the genotype of the wheat to be tested is TaYAB3-B-Hap 2, which belongs to superior haplotype.

3. A method of identifying a wheat spike type trait, characterized by, The method comprises the following steps: (1) using the genomic DNA of the wheat sample to be tested as a template, and using the primer of the KASP molecular marker in claim 1 to perform PCR amplification to obtain an amplification product; (2) performing fluorescence detection and analysis on the amplification product; if the detection result is FAM, the genotype of the wheat to be tested is TaYAB3-B-Hap 1, which belongs to non-superior haplotype; if the detection result is HEX, the genotype of the wheat to be tested is TaYAB3-B-Hap 2, which belongs to superior haplotype.

4. The method for identifying a wheat spike type trait according to claim 3, characterized by, Touchdown PCR is used for PCR amplification; the Touchdown PCR amplification program is as follows: the first stage is denaturation at 95°C for 15 min; the second stage is denaturation at 95°C for 20 s, annealing and extension at 65°C for 1 min, and the temperature is reduced by 1°C for each cycle starting from the second cycle, and a total of 9 cycles; the third stage is denaturation at 95°C for 10 s, annealing and extension at 65°C for 1 min.

Images