Castrated FHV virus-like particle subunit vaccine and preparation method thereof
Patent Information
- Application Number
- CN202480015551.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-03-21
- Filing Date
- 2024-02-23
- Publication Date
- 2025-10-10
AI Technical Summary
There is no method in the existing technology to construct a GnRH castrating vaccine using barn virus (FHV), and it is difficult to obtain a castrating FHV virus-like particle subunit vaccine with high yield, strong immunogenicity and fast immune response through bacterial culture.
By fusing GnRH-I with FHV coat protein, the GnRH-VLP recombinant protein is constructed and expressed in insect cells. The pBacPAK9 vector is used for cloning and purification to obtain GnRH-I-FHV virus-like particles, which are combined with adjuvants for vaccine preparation. .
It achieves an efficient and rapid immune response, significantly reduces testosterone levels and testicular volume, and is suitable for industrial production and animal castration.
Smart Images

Figure 00000021_0000 
Figure 00000021_0001 
Figure 00000022_0000
Abstract
Description
Castration-resistant FHV virus-like particle subunit vaccine and preparation method thereof
[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on March 21, 2023, with application number 202310317333.6 and invention name “GnRH-VLP recombinant castration vaccine and its preparation method”, the entire contents of which are incorporated by reference into this application. Technical Field
[0002] The present invention relates to the field of biotechnology, in particular to a castrated FHV virus-like particle subunit vaccine and a preparation method thereof. Background Art
[0003] Castration is the indirect removal of an animal's reproductive system or the resulting loss of sexual function. This includes the removal of the testes in males and the ovaries in females, collectively known as gonadectomy. In addition to surgical removal of the gonads, local radiation exposure and chemical treatment can also be used for castration. Castration deprives vertebrates of their source of sex hormones, which can sometimes lead to the degeneration of genital appendages and secondary and tertiary sexual characteristics.
[0004] Gonadotropin-releasing hormone (GnRH) is an endogenous polypeptide hormone in animals. Physiological doses of GnRH-I can increase gonadotropin concentrations (e.g., a mild increase in FSH and a significant increase in LH), promote the synthesis and secretion of gonadal hormones (e.g., estradiol, progesterone, and testosterone), and promote follicular maturation and ovulation, testicular development and sperm maturation, and the development and maintenance of secondary sexual characteristics. Furthermore, GnRH-I can directly affect the gonads, regulating the synthesis and secretion of gonadal steroid hormones and promoting gamete formation.
[0005] Self-antigen proteins are often difficult to elicit antibody responses against. One approach to improving vaccination efficacy is to increase the reproducibility of the applied antigens. Unlike isolated proteins, viruses can induce rapid and potent immune responses, both with and without T cell help, without any adjuvants. Compared to a few proteins, they can trigger immune responses far more robust than their isolated components. With respect to B cell responses, it is well known that a key factor in viral immunogenicity is the reproducibility and order of surface epitopes. Many viruses exhibit quasi-crystalline surfaces with regularly arranged epitopes that efficiently crosslink epitope-specific immunoglobulins on B cells. This crosslinking of B cell surface immunoglobulins is a strong activation signal, directly inducing cell cycle progression and IgM antibody production. Furthermore, this triggered B cell activation can activate T helper cells, in turn inducing the conversion of IgM to IgG antibodies in B cells and the generation of long-lived B cell memory targets for any vaccination. Viral structure has even been implicated in the production of anti-antibodies in autoimmune diseases and is part of the natural response to pathogens. Therefore, antigens presented on highly organized viral surfaces can induce strong antibody responses against these antigens.
[0006] Virus-like particles are the main capsid protein of an RNA bacteriophage. They are self-assembled from multiple monomers into a new type of highly immunogenic virus-like particles (VLPs). These VLPs do not contain the phage RNA genome and cannot replicate. However, studies have found that a variety of polypeptides can be fused to the N- or C-terminus of the virus-like particle protein, and the resulting fusion protein forms virus-like particles when expressed in a host, typically and preferably in Escherichia coli. In addition, it has been found that if the polypeptide contains at least one antigen, the antigen or at least one antigenic site of the antigen is displayed on the outer surface of the assembled VLP, the assembled VLP can effectively improve the immunogenicity of the target antigen. In addition to the virus-like particles AP205 and Qβ that have been reported, there are also a variety of VLP platforms such as CuMV and tobacco mosaic virus VLP, all of which have the potential to be developed into castration vaccines.
[0007] Flock house virus (FHV) is a non-enveloped insect RNA virus of the Nodaviridae family. Its genome consists of two single-stranded RNA strands. The FHV capsid is 35 nm in diameter and is composed of 180 individual capsid α proteins arranged in a T=3 icosahedral symmetry. FHV capsid proteins can assemble into virus-like particles (VLPs) that display exogenous peptides in a multivalent, highly ordered array. However, there are no reports on the use of FHV to develop a GnRH castration vaccine.
[0008] Summary of the Invention
[0009] In view of this, the technical problem to be solved by the present invention is to provide a castration-resistant FHV virus-like particle subunit vaccine and a preparation method thereof, which is easy to obtain through bacterial culture, has a high expression yield, is convenient for industrial production, has strong immunogenicity and a fast immune response.
[0010] The present invention provides a GnRH-VLP recombinant protein, which comprises GnRH-I and a capsid protein of a veterinary hygrovirus.
[0011] The GnRH-I has the amino acid sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2; or a sequence with more than 90% homology to the amino acid sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2.
[0012] The fur shed virus coat protein (FHV) has an amino acid sequence as shown in SEQ ID NO: 5, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced on the basis of the amino acid sequence shown in SEQ ID NO: 5; or a sequence with a homology of more than 90% to the amino acid sequence shown in SEQ ID NO: 5.
[0013] In some embodiments, the C-terminus of GnRH-I in the GnRH-VLP recombinant protein provided by the present invention is connected to the N-terminus of FHV, and the amino acid sequence of the recombinant protein is shown in SEQ ID NO: 7 and SEQ ID NO: 9.
[0014] The present invention also provides:
[0015] 1), a nucleic acid encoding the GnRH-VLP recombinant protein;
[0016] II), an expression unit containing a nucleic acid encoding GnRH-VLP;
[0017] III), a recombinant vector containing a nucleic acid encoding GnRH-VLP or an expression unit as described above;
[0018] IV), transforming or transfecting host cells with an expression vector for GnRH-VLP;
[0019] V) The culture product of the host cells as described above.
[0020] The nucleic acid can be DNA, RNA, cDNA or PNA. The DNA forms include cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The nucleic acid can include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (e.g., promoters or transcription terminators). The nucleic acid can be linear or circular in topology. The nucleic acid can be, for example, a part of a vector (e.g., an expression or cloning vector) or a fragment. The nucleic acid can be obtained directly from a natural source or can be prepared with the assistance of recombination, enzymatic methods or chemical techniques. The RNA form is mRNA obtained by gene transcription, etc. The gene sequence can use a wild-type sequence or can be codon-optimized, which is not limited by the present invention. In some embodiments, the nucleic acid sequence encoding the GnRH-VLP recombinant protein of the present invention is shown in SEQ ID NO: 8 and SEQ ID NO: 10.
[0021] The expression unit provided by the present invention is an expression unit comprising a nucleic acid encoding a GnRH-VLP recombinant protein. The expression unit comprises an expression unit composed of a single or multiple tandem nucleic acids of the present invention, a promoter, and a terminator, and the present invention is not limited thereto.
[0022] Furthermore, the recombinant expression vector herein refers to a nucleic acid vector, which is a recombinant DNA molecule that contains the desired coding sequence and an appropriate nucleic acid sequence or element that is essential for the expression of the operably linked coding gene in a specific host organism. The nucleic acid sequence or element necessary for expression in bacteria includes a promoter, a ribosome binding site and possibly other sequences. The recombinant expression vector is selected according to the host. The expression vector described in the present invention can be circular or linear, and the present invention is not limited to this. Taking a prokaryotic host as an example, it can be Escherichia coli, Bacillus, Streptomyces or cyanobacteria, etc.; its backbone vector can be a pET series plasmid, a pGEX series plasmid, a pKBP series plasmid or a pcDNA series plasmid. In some embodiments, insect cells are used to express the recombinant protein, and the vector used is pBacPAK9.
[0023] The present invention provides a method for constructing the recombinant vector, comprising cloning the aforementioned nucleic acid fragment encoding the fusion protein into the prokaryotic expression vector pBacPAK9 by homologous recombination. In some embodiments, the insertion site is between the NcoI site and the XhoI site.
[0024] Furthermore, the present invention also provides a host cell transformed or transfected with the aforementioned recombinant vector, or with the aforementioned nucleic acid integrated into its genome.
[0025] The hosts described in the present invention include bacteria, fungi, viruses or animals. The bacteria include Gram-positive bacteria and Gram-negative bacteria; the Gram-positive bacteria include but are not limited to Escherichia coli. The fungi include molds, yeasts, and mushrooms; the yeast include Saccharomyces cerevisiae, Saccharomyces cerevisiae, Pichia pastoris and Candida, etc. The viruses include but are not limited to adenovirus, adeno-associated virus, lentivirus, and prion virus. The animals include humans, mice, rabbits, pigs, zebrafish, etc. The expression mode of the nucleic acid encoding the recombinant protein in the host can be either integrated or free, and the present invention does not limit this. In the embodiment of the present invention, the recombinant protein is expressed using insect cells as the host, and the insect cells are Sf9.
[0026] Furthermore, the present invention also provides a culture product of the host cell.
[0027] The method for preparing the GnRH-I-FHV recombinant protein of the present invention comprises: culturing the host cell as described above to obtain a culture product containing the recombinant protein.
[0028] Specifically, the preparation of the GnRH-I-FHV recombinant protein includes directly constructing GnRH-I and FHV into a vector and packaging them into VLPs. The preparation method includes cloning the gene sequences of the N-terminal portion of the FHV coat protein, GnRH-I, and the C-terminal portion of the GnRH-I coat protein into an expression vector to obtain a recombinant expression vector, transfecting the recombinant expression vector into a host, and then expressing the protein.
[0029] More specifically, the preparation of the GnRH-I-FHV recombinant protein includes:
[0030] (1) The positive recombinant plasmid FHV was obtained by directly cloning the N-terminal part of the FHV coat protein gene (GenBank: JF461542.1), the GnRH-I 10 peptide, and the C-terminal part of the coat protein gene sequence into the insect cell expression vector pBacPAK9. N -GnRH-I-FHV C -pBacPAK9;
[0031] (2) Transform the recombinant plasmid into insect cells: N -GnRH-I-FHV C -pBa cPAK9 was transiently transfected into insect cells, the supernatant was collected, and the supernatant was used to infect insect cells again;
[0032] (3) GnRH-I-FHV VLP purification: The supernatant was collected and VLPs were precipitated by adding NaCl to a final concentration of 0.2 M and polyethylene glycol 8000 to a final concentration of 8% (w / v) and stirring the mixture at 4°C for 1 hour. VLPs were purified by ultracentrifugation and sucrose density gradient centrifugation.
[0033] Furthermore, the fusion protein, the nucleic acid, the expression unit, the recombinant vector, the host cell, the culture product or the composition of the present invention are used in the preparation of subunit vaccines.
[0034] The present invention also provides a vaccine containing GnRH-VLP. Specifically, the present invention provides a castration FHV virus-like particle subunit vaccine, which includes the recombinant protein as described above. The vaccine is a castration vaccine for male animals. The male animals are animals that can be castrated, including birds and mammals. For example, mice, rats, cats, dogs, horses, or animals of the same family and genus as the above animals. Preferably, they are felines, canines, or rodents, such as mice. The vaccine also includes an adjuvant. The adjuvant includes an aluminum salt adjuvant, a protein adjuvant, a nucleic acid adjuvant, a lipid-containing adjuvant, a mixed adjuvant, or an aggregate structure adjuvant. In some embodiments of the present invention, the adjuvant is an aluminum hydroxide adjuvant. In the GnRH-VLP vaccine of the present invention, the adjuvant is not limited. In some embodiments, the GnRH-VLP vaccine is prepared using an aluminum adjuvant. The concentration of GnRH-VLP in the vaccine is 800, 400, 200, or 100 μg / mL, preferably, the concentration is 400 μg / mL.
[0035] Furthermore, the method for preparing the subunit vaccine comprises mixing the fusion protein with an adjuvant; or mixing the composition with a buffer solution. Preferably, the volume ratio of the mixture is 1:1.
[0036] Immunizing animals with the vaccine of the present invention can achieve the effect of castration. Therefore, the present invention also provides the use of the above-mentioned vaccine in animal castration. Correspondingly, the present invention also provides a method for castrating animals, comprising administering the vaccine as described above. In the present invention, the castration includes increasing the level of GnRH-I antibodies, reducing testosterone levels, reducing testicular volume and / or weight, and preventing animal pregnancy. In the present invention, the administration method includes injection. The dosage administered is 200 μg. 10 to 100 days after immunization, the anti-GnRH-I recombinant protein antibody titer and testosterone level decreased.
[0037] In some tests, testosterone levels are reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, and more specifically 50% to 60%, 60% to 70%, 70% to 80%, or 80% to 90%. In a specific embodiment, testosterone levels are reduced to 2.95% of the original level.
[0038] In some tests, the cat's testicular volume was reduced to 50% to 90% of its original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, more specifically 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%. In a specific embodiment, the cat's testicular volume was reduced to 91.83% of its original level.
[0039] The beneficial effects of the present invention are as follows:
[0040] First, FHV is a kennel virus. The viral capsid protein has the ability to self-assemble into nanoparticles. It is non-infectious and has strong antigenic immunity.
[0041] Second, the antigen expressed in tandem with FHV virus-like particles showed high antigenicity, inducing high levels of specific antibodies in mice, rats, cats, dogs, and horses, and a rapid humoral immune response;
[0042] Third, the GnRH-I-FHV virus-like particles of the present invention can be expressed at high levels by insect cells, with a simple production process, a short culture cycle, and high purity of the GnRH-I-FHV virus-like particles;
[0043] Fourth, it is suitable for industrialization. The insect cells selected in the present invention can secrete proteins into the culture medium, which facilitates the extraction and purification of proteins and is of great significance for large-scale production of proteins. BRIEF DESCRIPTION OF THE DRAWINGS
[0044] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are only exemplary. For those skilled in the art, other implementation drawings can be derived from the provided drawings without inventive effort:
[0045] FIG1 is a diagram of a FHV provided in an embodiment of the present invention. N -GnRH-I-FHV C Schematic diagram of the recombinant plasmid after the gene was connected to the pBacPAK9 plasmid;
[0046] FIG2 is a diagram of GnRH-I provided in an embodiment of the present invention. Q -FHV and GnRH-IE -Schematic diagram of SDS-PAGE of FHV virus-like particle protein;
[0047] FIG3 shows the serum antibody titers of mice immunized with GnRH-I-FHV virus-like particles;
[0048] FIG4 shows the testosterone levels in mouse serum;
[0049] Figure 5 shows the changes in testicular volume in male cats. DETAILED DESCRIPTION
[0050] To make the above-mentioned objects, features, and advantages of the present invention more readily apparent, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings. The following description sets forth numerous specific details to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art may make similar modifications without departing from the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.
[0051] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention pertains. The terms used herein in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.
[0052] The molecular biological experimental methods such as enzyme digestion and homologous recombination ligation used in the embodiments of the present invention can be referred to the second edition of "Molecular Cloning". The basic materials for preparing the GnRH-I-FHV virus-like particles of the present invention include: FHV protein nucleotide sequence (GenBank: JF461542.1), GnRH-I nucleotide sequence (SEQ ID NO.3 and SEQ ID NO.4), pBacPAK9 plasmid, insect Sf9 cells, Tiangen plasmid mini-extraction kit, Sf-900II SFM culture medium, ampicillin, etc. The nucleotide sequence was sent to BGI to synthesize FHV N -GnRH-I-FHV C -pBacPAK9 recombinant plasmid.
[0053] The present invention provides a GnRH-I-FHV protein expressed by recombinant insect cells. The GnRH-I-FHV protein is obtained by cloning the N-terminal portion of the FHV coat protein gene (GenBank: JF461542.1), the GnRH-I 10 peptide and the C-terminal portion of the coat protein gene sequence into an insect cell expression vector and expressing the protein in insect cells Sf9. N-GnRH-I-FHV C The amino acid sequences are SEQ ID NO: 8 and SEQ ID NO: 9.
[0054] GnRH is also referred to herein as GnRH-I, and its amino acid sequence is:
[0055] QHWSYGLRPG (SEQ ID NO: 1, denoted as GnRH-I Q )
[0056] or EHWSYGLRPG (SEQ ID NO: 2, denoted as GnRH-I E )
[0057] The nucleic acid sequence encoding GnRH-1 is:
[0058] CAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO.3, encoding GnRH-I Q )
[0059] or GAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO. 4, encoding GnRH-I E )
[0060] FHV amino acid sequence:
[0061] Nucleic acid sequence encoding FHV:
[0062] GnRH-I Q -FHV amino acid sequence:
[0063] Encoding GnRH-I Q -FHV nucleotide sequence
[0064] GnRH-I E -FHV amino acid sequence:
[0065] Encoding GnRH-I E -FHV nucleotide sequence
[0066] The present invention will be further described below in conjunction with the embodiments:
[0067] Flock House Virus (FHV), a non-enveloped insect RNA virus, has an icosahedral capsid composed of 180 identical coat protein subunits. Due to its genetic simplicity, exceptional yield, and high physicochemical stability, and the lack of known safety issues with FHV use in animals and humans, the virus is well-suited for a variety of biotechnological applications. The GnRH gene sequence is cloned into a prokaryotic expression vector to generate a recombinant expression vector, which is then expressed and purified to obtain the GnRH protein. FHV infects insect cells to produce and collect viral particles, and the GnRH protein is conjugated to the surface of the FHV particles via non-covalent or covalent means to prepare a subunit vaccine.
[0068] Example 1
[0069] Provided is a method for preparing GnRH-I-FHV virus-like particles, comprising the following steps:
[0070] (1) The N-terminal portion of the FHV coat protein gene (GenBank: JF461542.1), the GnRH-I 10 peptide, and the C-terminal portion of the coat protein gene sequence were directly synthesized and cloned into the pBacPAK9 insect expression vector to obtain positive recombinant plasmids FHV N -GnRH-I Q -FHV C -pBacPAK9 and FHV N -GnRH-I E -FHV C -pBacPAK9;
[0071] (2) Transform the recombinant plasmid into insect cells: N -GnRH-I Q -FHV C -pB acPAK9 and FHV N -GnRH-I E -FHV C -pBacPAK9 were transiently transfected into insect cells, the supernatant was collected, and the supernatant was used to infect insect cells again;
[0072] (3) GnRH-I-FHV VLP purification: The supernatant was collected and VLPs were precipitated by adding NaCl to a final concentration of 0.2 M and polyethylene glycol 8000 to a final concentration of 8% (w / v) and stirring the mixture at 4°C for 1 hour. VLPs were purified by ultracentrifugation and sucrose density gradient centrifugation.
[0073] Specifically, the steps for expressing and purifying GnRH-I-FHV virus-like particles are as follows:
[0074] (1) Recombinant plasmid FHV N -GnRH-I Q -FHV C -pBacPAK9 and FHV N -GnRH-I E -FHV C Preparation of pBacPAK9
[0075] The N-terminal portion of the FHV coat protein gene (GenBank: JF461542.1), GnRH-I Q and GnRH-I E The C-terminal part of the gene sequence of 10 peptides and coat protein was directly synthesized and cloned into the pBacPAK9 insect expression vector to obtain positive recombinant plasmids FHV N -Gn RH-I Q -FHV C -pBacPAK9 and FHV N -GnRH-I E -FHV C -pBacPAK9. Use a pipette to inoculate 5 μl of the glycerol stock containing the plasmid into 5 mL of LB medium (containing 50 μg / mL kanamycin). Incubate with shaking at 37°C for 14-16 hours. After incubation, remove 1 mL of the culture medium for sequencing. Extract the plasmid using a plasmid extraction kit.
[0076] (2) Obtaining recombinant baculovirus
[0077] Add 95 μL of Sf-900II SFM medium and 5 μL of Promega FuGENE Hd Transfection Reagent to a sterile 1.5 mL centrifuge tube and mix thoroughly. At the same time, add 95 μL of Sf-900II SFM medium, 2 μL of baculovirus expression vector qBac-IIIG DNA and 3 μL of recombinant plasmid FHV to another sterile 1.5 mL centrifuge tube. N -GnRH-I Q -FHV C -pBacPAK9 or FHV N -GnRH-I E -FHV C-pBacPAK9, mix thoroughly; mix the solutions in both centrifuge tubes and let stand at room temperature for 20 minutes; add the DNA mixture dropwise to the culture medium of Sf9 insect cells grown to 50% virulence and culture in a 28°C, non-CO2 incubator for 4-6 days; observe for green fluorescence on the 2nd to 3rd day; if green fluorescence is present, recombinant baculovirus is successfully obtained. When abundant green fluorescence appears in the Sf9 cells, collect the culture medium from the dish and centrifuge at 4°C, 500 rpm, for 5 minutes. The supernatant is the P0 recombinant baculovirus. Take 20-200 μL of the P0 recombinant baculovirus and infect Sf9 insect cells grown to 50% virulence. Culture in a 28°C, non-CO2 incubator for 4-6 days; collect the culture medium from the dish and centrifuge at 4°C, 500 rpm, for 5 minutes. The supernatant is the P1 recombinant baculovirus. Serial passages of P2 and P3 recombinant baculovirus are obtained using the same method. Sf9 insect cells were infected with P2 and P3 recombinant baculoviruses, and the supernatants of Sf9 insect cell culture medium were collected 4 to 5 days after infection.
[0078] (3) Purification of GnRH-I-FHV virus-like particles
[0079] Ethylphenyl polyethylene glycol (NP-40) was added to the supernatant of the above culture medium to a final concentration of 1% (v / v). After incubation on ice for 10 to 15 minutes, the mixture was centrifuged at 15,300 × g at 4°C for 10 minutes to collect the supernatant. NaCl at a final concentration of 0.2 M and PEG8000 at a final concentration of 8% (w / v) were added to the supernatant, and the mixture was stirred at 4°C for 1 hour to precipitate the VLPs in the supernatant. The mixture was centrifuged at 9,632 × g at 4°C for 10 minutes to collect the precipitate, and the precipitate was resuspended in 50 mM Hepes (pH = 7.5) buffer and centrifuged at 15,300 × g for 20 minutes at 4°C to remove insoluble matter. 4 mL of 50 mM Hepes (pH = 7.5) buffer containing 30% (w / w) sucrose was added, the mixture was centrifuged at 184,048 × g at 11°C for 2.5 hours, and the supernatant was removed. The precipitate was resuspended in 50 mM Hepes (pH = 7.5) buffer was added, and a 0-40% (w / w) sucrose gradient was added thereto. The mixture was centrifuged at 103745 × g for 3 h, and VLPs were collected using a syringe. Ultrafiltration was performed using a 30 kDa ultrafiltration tube, and the solvent was replaced with PBS to obtain FHV virus-like particles.
[0080] Pipette 10 μL of the sample and add 10 μL of 2× protein electrophoresis loading buffer, then heat at 100°C for 4 min. Detect the target band using SDS-PAGE. As shown in Figure 2, there is a single band at around 52 kDa, which is GnRH-I. Q -FHV and GnRH-I E-FHV virus-like particles.
[0081] Comparative Example
[0082] GnRH-I-AP205 virus-like particles were prepared according to the same system as the GnRH-I-AP205 virus-like particle preparation method mentioned in patent CN112500456B for subsequent immune control experiments.
[0083] Example 2
[0084] A method for preparing GnRH-I and FHV virus-like particles is provided, comprising the following steps:
[0085] (1) GnRH-I Q , GnRH-I E and FHV coat protein gene sequences were directly synthesized and cloned into the pBacPAK9 insect expression vector to obtain positive recombinant plasmids GnRH-I Q -pBacPAK9, GnRH-I E -pBacPAK9 and FHV-pBacPAK9;
[0086] (2) Transformation of recombinant plasmid into insect cells: The recombinant plasmid GnRH-I Q -pBacPAK9, GnRH-I E -pBacPAK9 and FHV-pBacPAK9 were transiently transfected into insect cells, the supernatants were collected, and the supernatants were used to infect insect cells again;
[0087] (3) Purification of target protein: The supernatant was collected and VLPs were precipitated by adding NaCl to a final concentration of 0.2 M and polyethylene glycol 8000 to a final concentration of 8% (w / v) and stirring the mixture at 4°C for 1 hour. VLPs were purified by ultracentrifugation and sucrose density gradient centrifugation.
[0088] Example 3
[0089] Provided is a GnRH-I-FHV virus-like particle subunit vaccine immunization method:
[0090] The GnRH-I described in Example 1 Q -FHV and GnRH-I E -FHV virus-like particles and aluminum hydroxide adjuvant were mixed in a volume ratio of 1:1 for immunization. On day 0, day 14, and day 28, 50 μg GnRH-I Q -FHV and GnRH-I EEight-week-old male C57BL / 6 mice were immunized with FHV virus-like particle vaccine (five mice per group), and GnRH-I-AP205VLP+aluminum hydroxide adjuvant immunization group, GnRH-I Q -FHV without adjuvant group, GnRH-I E -FHV without adjuvant group, PBS negative group, simple FHV experimental group and simple GnRH-I Q and GnRH-I E Experimental group. Anti-GnRH-I recombinant protein antibody titers and testosterone levels were measured in these mice. On day 70 after immunization, the mice were sacrificed and testicular weights were measured.
[0091] Example 4
[0092] Provided is a method for determining the titer of mouse anti-GnRH-I antibodies:
[0093] At different time points during the experiment, sera were collected from immunized mice and control mice. Anti-GnRH-I IgG antibody titers were determined by ELISA as follows. Q and GnRH-I E Coat 96-well plates overnight at 4°C, adding 100 μl per well. The next day, wash the plates five times with 1:1000 PBS-T and block with 300 μl of 2% BSA at 37°C for 2 h. Wash the plates five times with 1:1000 PBS-T. Then, serially dilute mouse serum with 2% BSA at a starting concentration of 1:500, then dilute them two-fold to 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, and 1:256000. Incubate at room temperature for 45 min with shaking, adding 100 μl per well, starting from the highest to the lowest dilution. Wash the plates five times with 1:1000 PBS-T. HRP-labeled goat anti-mouse polyclonal antibody was used as the secondary antibody at a dilution of 1:5000 in 2% skim milk powder. 100 μl was added to each well and incubated at room temperature with shaking for 45 minutes. TMB color development was performed for 5-10 minutes, followed by addition of 2M sulfuric acid for termination. The absorbance was read at a wavelength of 450 nm. The optical density (OD) at 450 nm was measured using an ELISA reader (BioRad Benchmark). The maximum OD was calculated using these data. 450 Serum dilution.
[0094] FIG3 shows that, in the GnRH-I prepared in Example 1 Q -FHV and GnRH-I EIn male mice immunized with -FHV virus-like particles without adjuvant, the average titer reached 8000 on day 28, and after the third booster, the average titer first rose to 64000, then decreased and maintained at 32000. Q -FHV and GnRH-I E The average titer of the FHV virus-like particle adjuvant group reached 64,000 on day 28, and then maintained at 128,000 after the third injection. Q and GnRH-I E The titer of the immunized group was only 4000 after 28 days, and no antibody titers were detected in the FHV mixed adjuvant and PBS mixed adjuvant immunization groups. Compared with all immunization groups, the GnRH-I-FHV + adjuvant immunization group significantly increased the antibody titer of GnRH-I in the mouse blood. Compared with the comparative example, the GnRH-I-FHV virus-like particles constructed in Example 1 can stimulate the body to produce antibodies faster and more sustainably, making it more suitable for the preparation of castration vaccines.
[0095] Example 5
[0096] Provided is a method for determining testosterone levels in mouse serum:
[0097] At various time points during the above experiments, serum was collected from immunized mice and control mice. Testosterone levels in mouse serum were determined using Testosterone-ELISA (IBL, Hamburg, Germany).
[0098] Figure 4 shows that the use of GnRH-I Q -FHV and GnRH-I E In mice immunized with -FHV without aluminum hydroxide adjuvant, the average testosterone level was greatly suppressed (<2 ng / ml) on day 42 after immunization, and the level was still below 1.5 ng / ml on day 70. Q In mice immunized with -FHV supplemented with aluminum hydroxide adjuvant, the average testosterone level dropped to below 2 ng / ml on the 28th day, and remained stable at around 0.12 after 42 days. From the 28th day onwards, the average testosterone level was significantly lower than that of the group immunized without adjuvant, and was significantly lower than that of the control group GNRH-I at the same time. Q The average level of hormones in the central nervous system of mice immunized with aluminum hydroxide was about 46 times lower. E In mice immunized with -FHV supplemented with aluminum hydroxide adjuvant, the average testosterone level remained stable at around 0.14 after 42 days, which was significantly higher than that of the control group GNRH-I at the same time. EThe average level of hormones in the central nervous system of mice immunized with GnRH-I-AP205+aluminum hydroxide was approximately 38 times lower. In contrast, the central nervous system hormone levels of mice immunized with GnRH-I-AP205+adjuvant were only 23 times lower than those in the control group. This clearly demonstrates that the GnRH-I-FHV+adjuvant immunization group has a stronger inhibitory effect on mouse testosterone, while the virus-like particles constructed with the control group cannot achieve a similar effect.
[0099] Mice were sacrificed on day 70, and the testicles were removed and weighed before being fixed in 4% formaldehyde.
[0100] Table 1 shows the results of GnRH-I Q and GnRH-I E The testicular weight of immunized mice was not significantly reduced, while that of mice receiving GnRH-I Q -The testicular weight of mice immunized with FHV virus-like particles and aluminum hydroxide adjuvant was reduced by 82.88%, and mice receiving GnRH-I E -The testicular weight of mice immunized with FHV virus-like particles and aluminum hydroxide adjuvant decreased by 81.44%, which clearly showed that GnRH-I Q The vaccine, which combines FHV with an adjuvant, had a significant inhibitory effect on the mouse testicles. However, the virus-like particles constructed in the control group failed to achieve a similar effect, reducing the mouse testicular weight by only 77.36%.
[0101] Table 1 Average testicular weight of mice
[0102] Example 6: Testicular volume determination of experimental cats
[0103] Six healthy male rural cats aged 12 months were divided into two groups, 3 in each group, one of which was the injection group and the other was the control group. Q Immunization was performed with a mixture of FHV virus-like particles and aluminum hydroxide adjuvant at a volume ratio of 1:1. 200 μg was injected subcutaneously behind the ear and neck. A second injection was given 28 days later at the same dose and route. A control group received no injection. All experimental animals were housed individually under the same conditions and observation.
[0104] After the first vaccination, measure the width and length of the testicles with a vernier caliper and a tape measure every 14 days, and calculate the testicular volume according to the following formula: Testicular volume = (width / 4) × (length / 2) × 4 / 3 × 3.14.
[0105] As shown in Figure 5, the testicular volume of the male cats in the injection group decreased, while the testicular volume of the male cats in the control group increased. This clearly shows that GnRH-I Q -FHV vaccine combined with adjuvant has a significant inhibitory effect on the testicles of cats.
[0106] Example 7: Determination of pregnancy status of experimental cats
[0107] Ten healthy rural cats aged 12-24 months (6 male cats and 4 female cats) were divided into two groups, with 3 male cats and 2 female cats in each group. One group was the injection group and the other was the control group.
[0108] The injection group received a subcutaneous injection of 200 μg GnRH-I behind the ear and neck. Q -FHV+adjuvant was injected a second time 28 days later through the same route, while the control group received no injection. All experimental cats were housed and observed under the same conditions, and all cats were housed individually.
[0109] Eight healthy male and twelve female cats aged 12 to 24 months were cage-paired with the injected and control groups. Fourteen days after the second injection, three male cats from the injected and control groups were cage-paired with two healthy female cats, while four female cats from the injected and control groups were cage-paired with two healthy male cats. Males from each group were rotated to breed to minimize behavioral incompatibilities that could affect successful pairing.
[0110] After the cohabitation test begins, check whether the female cats in the experimental group and the male cats in the same cage are pregnant. After 30 days of observation, ultrasound is used to check for pregnancy.
[0111] As can be seen from Table 2, the female cats in the injection group and the paired female cats did not become pregnant, while the female cats in the control group and the paired female cats became pregnant, indicating that GnRH-I Q -FHV+adjuvant is very effective for castration of cats and is suitable for the development of castration vaccines.
[0112] Table 2 Pregnancy status of experimental animals
Claims
1. GnRH-VLP recombinant protein, characterized in that Including GnRH-I and strychnine virus coat protein.
2. The recombinant protein according to claim 1, characterized in that in, GnRH-I has the amino acid sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2; The coat protein of the animal shed virus has the amino acid sequence shown in SEQ ID NO: 5 The amino acid sequence of the recombinant protein is shown in SEQ ID NO: 7 or SEQ ID NO:
9.
3. Biomaterial, characterized in that Include any of the following: 1), a nucleic acid encoding the recombinant protein according to claim 1 or 2; II), an expression unit containing the nucleic acid described in I); III), a recombinant vector containing the nucleic acid described in I) or the expression unit described in II); IV), a host cell transformed or transfected with the expression vector described in III); V) and IV) the culture products of the host cells.
4. The method for preparing the recombinant protein according to claim 1 or 2, characterized in that: The method comprises culturing the host cell described in claim 3 to obtain a culture product containing the recombinant protein described in claim 1.
5. Use of the recombinant protein according to claim 1 or 2, the biological material according to claim 3 or the product obtained by the preparation method according to claim 4 in the preparation of a subunit vaccine for animal castration.
6. A vaccine, characterized in that The invention comprises the recombinant protein according to claim 1 or 2 and an adjuvant.
7. The vaccine according to claim 6, characterized in that The adjuvant is aluminum hydroxide adjuvant.
8. The method for preparing the vaccine according to claim 6 or 7, characterized in that: The method comprises mixing the recombinant protein according to claim 1 or 2 with an adjuvant.
9. The preparation method according to claim 8, characterized in that: The volume ratio of the mixture is 1:
1.
10. A method for castration of an animal, characterized in that: Comprising administration of the vaccine of claim 6 or 7.