Gene GmSCAMP3 for regulating and controlling symbiotic nitrogen fixation capacity of soybean root nodules and application of gene GmSCAMP3

Abstract

The invention discloses a gene GmSCAMP3 for regulating and controlling the symbiotic nitrogen fixation capacity of soybean root nodules and application of the gene GmSCAMP3. Specifically, the invention provides a protein for regulating and controlling the symbiotic nitrogen fixation capacity of soybean root nodules, and the amino acid sequence of the protein is as shown in SEQ ID NO: 2. The invention also provides a method for improving soybean yield or changing soybean root nodule symbiotic nitrogen fixation capacity. The method comprises the step of introducing the polynucleotide encoding the protein into soybean cells or tissues to obtain transgenic soybeans. The invention finds that the nitrogenase activity of the Gmscamp3 mutant root nodule is only 65.79% of that of a wild type root nodule, which indicates that the GmSCAMP3 protein plays an important role in the process of regulating and controlling the symbiotic nitrogen fixation capacity of the soybean root nodule.

Description

Technical Field

[0001] The invention belongs to the fields of biotechnology and botany, and in particular relates to a gene GmSCAMP3 for regulating the symbiotic nitrogen fixation ability of soybean nodules and an application thereof. Background Art

[0002] How legumes and rhizobia symbiotically fix nitrogen is a fundamental question in natural science and an economic and ecological issue with enormous potential applications. Through symbiotic nitrogen fixation, legumes and rhizobia can fix nearly 60 million tons of nitrogen from the air annually. This not only meets the nitrogen needs of legumes, but also significantly reduces the use of chemically synthesized nitrogen fertilizers in agricultural production. Therefore, a thorough understanding of the molecular mechanisms of symbiotic nitrogen fixation is crucial for optimizing nitrogen utilization in legumes and achieving increased yield and improved quality. It also provides a theoretical basis for achieving biological nitrogen fixation in non-legumes.

[0003] The symbiont, a nitrogen-fixing site formed by rhizobia encapsulated by the host plant membrane, relies on the host cell's vesicular transport system for its development and function. The development of the symbiont is accompanied by the transport and redistribution of plant host membrane components. Furthermore, the symbiont membrane, serving as the core interface for the exchange of substances and energy between the two symbionts, houses numerous vesicular transport proteins, transporter proteins, and channel proteins. SCAMP (Secretory Carrier Membrane Protein) is an important vesicular transport component, ubiquitous in eukaryotes such as plants, animals, and yeast. Unlike other vesicular transport components, SCAMP participates in multiple vesicular transport pathways, playing a crucial role in secretion / exocytosis, endocytosis, and recycling. Furthermore, SCAMP plays a crucial role in host-microbe interactions. Therefore, it is of great significance to use SCAMP protein as a breakthrough to study the molecular mechanism of the inner membrane transport system regulating soybean symbiotic nitrogen fixation. It will not only help to improve the symbiotic nitrogen fixation ability of soybeans and increase soybean yield and quality, but also use genetic engineering to develop new biological nitrogen fixation efficiency-enhancing technologies, providing support for achieving efficient nitrogen fixation in non-legumes. Summary of the Invention

[0004] In view of the above problems, the present invention provides a gene GmSCAMP3 for regulating the symbiotic nitrogen fixation ability of soybean nodules and its application, so as to provide further support for improving soybean yield and quality.

[0005] Specifically, the present invention provides the following technical solutions.

[0006] In one aspect, the present invention provides a protein for regulating the symbiotic nitrogen fixation ability of soybean nodules, wherein the amino acid sequence of the protein is shown in SEQ ID NO: 2.

[0007] On the other hand, the present invention provides a gene that regulates the symbiotic nitrogen fixation ability of soybean nodules, and the nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0008] In another aspect, the present invention provides an expression vector comprising a polynucleotide encoding the protein as described above or a gene as described above.

[0009] In some embodiments, the expression vector comprises a marker, optionally, the marker is selected from a luminescent marker, an antibiotic marker and a chemical resistance marker, optionally, the luminescent marker is selected from a red fluorescent protein and a green fluorescent protein, the antibiotic marker is selected from an ampicillin marker, a chloramphenicol marker, a kanamycin marker, a neomycin marker, a rifampicin marker, a spectinomycin marker, a hygromycin marker, a streptomycin marker and a tetracycline marker, and the chemical resistance marker is a herbicide resistance marker.

[0010] In another aspect, the present invention provides a host cell comprising the expression vector described above.

[0011] In some embodiments, the vector is a plant expression vector, including a binary Agrobacterium rhizogenes vector and / or a vector that can be used for plant microprojectile bombardment.

[0012] In some embodiments, the host cell is selected from Escherichia coli cells and Agrobacterium cells (eg, Agrobacterium rhizogenes cells).

[0013] In some embodiments, the Agrobacterium rhizogenes is selected from K599, AR1193, C58cl, Arqual, MSU440, LBA9402, and R1601.

[0014] In another aspect, the present invention provides use of a polynucleotide encoding the protein described above or a gene described above in breeding legumes, such as soybeans, with improved yield or altered symbiotic nitrogen fixation ability.

[0015] On the other hand, the present invention provides a method for increasing soybean yield or changing the symbiotic nitrogen fixation ability of soybean root nodules, which comprises the step of introducing a polynucleotide encoding the protein as described above or the gene as described above, or the expression vector or host cell as described above into soybean cells or tissues to obtain transgenic soybeans.

[0016] definition

[0017] Acetylene reduction method: The detection principle of the acetylene reduction method is based on the reducing property of nitrogenase, which means that it can reduce acetylene (C2H2), which has a similar structure to N2, to ethylene (C2H4). Therefore, C2H2 can be used as a surrogate substrate for N2, and the nitrogenase activity can be estimated by measuring the amount of C2H4 produced.

[0018] SPAD value: it represents the relative content of chlorophyll in plants, or the degree of green of plants. The content of chlorophyll is positively correlated with the nitrogen content in leaves.

[0019] ATS1: its full name is ATP synthase beta subunit. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 The functional verification results of the GmSCAMP3 gene of the application are shown. A shows that GmSCAMP3 is specifically expressed in the nodule infection zone; B further shows that GmSCAMP3 is specifically expressed in the nodule infection zone; C shows that the green fluorescence signal of the GFP-GmSCAMP3 fusion protein is mainly concentrated on the cell membrane and cytoplasmic punctate structure of leaf cells, which is very similar to the red fluorescence signal of the endosome marker protein in plants; D shows the obtaining of the Gmscamp3 mutant; E shows the yellowish color of the leaves of the mutant plants 14 days after inoculation with rhizobia (NN represents normal nitrogen culture solution, and Ino represents inoculation with rhizobia and application of nitrogen-deficient culture solution); F shows the leaf SPAD values of the wild type and the mutant; G shows the nitrogenase activity of the wild type and the mutant; H shows the situation of the bubble structure in the infected cells of the nodule of the wild type and the mutant; I shows the statistical analysis results of the bubble structure in the infected cells of the nodule of the wild type and the mutant; J shows the statistical analysis results of the number of rhizobium colonization in the nodule infected cells of the wild type and the mutant.

[0021] Figure 2 The map of the pDEST-GUS vector is shown. It takes spectinomycin as the bacterial resistance, AtUBQ10 drives DsRed as the positive plant screening marker, and the appropriate enzyme cutting site is selected before the ATG of the GUS sequence to insert the related promoter sequence.

[0022] The statistical test method of the application is Student's t test. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical scheme and advantages of the application more clear and obvious, the application is further described in detail below in combination with specific examples and with reference to the drawings.

[0024] Example 1 Cloning of genes

[0025] In agricultural production, the efficiency of symbiotic nitrogen fixation significantly impacts soybean yield and quality, necessitating precise regulation of nitrogen fixation efficiency. The present invention provides a gene for regulating the efficiency / ability of symbiotic nitrogen fixation in soybeans and its application. Using molecular biology and comparative genomics, the inventors cloned a gene, Glyma.06G296900 (herein referred to as GmSCAMP3), from the American soybean line Williams 82 (W82), which regulates symbiotic nitrogen fixation in soybean (Glycine max). The encoding gene for GmSCAMP3 is located at Gm06:48197353..48204403 in the sequenced genome of Williams 82a4.V1. The cloning of GmSCAMP3 provides a theoretical foundation and genetic resources for subsequent molecular-assisted breeding and molecular design breeding.

[0026] Example 2 Analysis of the Expression Site of the GmSCAMP3 Gene

[0027] Legume nodule tissue can be divided into two main parts: the infection region (IR) and the cortex region (CR). The IR is the most important region responsible for nitrogen fixation. We used micromanipulation to separate the IR and CR tissues of soybean nodules, extracted RNA, and analyzed the expression levels of GmSCAMP3 in each tissue using RT-qPCR. We found that GmSCAMP3 was specifically expressed in the IR of the nodule ( Figure 1 A).

[0028] The RNA extraction kit used in the present invention is Kangwei Century CW0581 ultra-pure RNA nucleic acid extraction kit.

[0029] RT-PCR primers are as follows:

[0030] GmSCAMP3-qF CCTAAATAATGCAAAGGACGCAAA (SEQ ID NO:4)

[0031] GmSCAMP3-qR CCTCTATAACTATTCCAGCTCGTG (SEQ ID NO:5)

[0032] Internal reference primer

[0033] GmATS1-qFGCGATTCTTAAGCCAGCCTTT (SEQ ID NO:6)

[0034] GmATS1-qRACACACCCTGGAAACTGGTGA (SEQ ID NO:7)

[0035] The Tiangen Talent qPCR PreMix (SYBR Green) kit was used for real-time quantitative PCR. First, the soybean cDNA obtained by reverse transcription was diluted 20-fold as the RT-qPCR template and placed on ice. The reagents in the kit were thawed, vortexed, and mixed on ice until ready for use. The reaction was as follows:

[0036] 2 × Talent qPCR PreMix 10 μL

[0037] 0.6 μL of each 10 μM primer

[0038] 4 μL of diluted cDNA template

[0039] RNase-Free ddH2O 2.8 μL

[0040] Close the reaction cap, mix gently, centrifuge briefly for 30 seconds until the tube is at the bottom, and place the reaction system in a fluorescent quantitative PCR instrument for reaction. The reaction steps are as follows:

[0041] Step 1: 95°C for 3 min;

[0042] Step 2: 95°C for 5 seconds;

[0043] Step 3: 60°C for 15 seconds;

[0044] Step 4: 72°C for 15 seconds;

[0045] Step 5: Repeat steps 2-4 40 times;

[0046] Step 6: Melting curve analysis.

[0047] Example 3 Further Verification of the Expression Specificity of the GmSCAMP3 Gene in the Nodule-Infected Area

[0048] To further confirm the nodule infection zone expression specificity of GmSCAMP3 and visualize its expression pattern, we constructed a vector pDEST-GUS with the GmSCAMP3 gene promoter sequence (3000 bp region before the ATG translation start site) linked to the β-glucuronidase (GUS) coding gene, transformed into Agrobacterium rhizogenes K599 (ZC1506D) and obtained pGmSCAMP3-GUS transient transformed roots using the soybean hairy root transformation system. After 28 days of inoculation with Bradyrhizobium USDA110 (a gift from Professor Hans-Martin Fischer, ETH Zurich (Ledermann et al., 2015) Ledermann, R., Bartsch, I., Remus-Emsermann, M.N., Vorholt, J.A., and Fischer, H.M. (2015). Stable fluorescent and enzymatic tagging of Bradyrhizobium diazoefficiens to analyze host-plant infection and colonization. Mol. Plant-Microbe Interact. 28, 959-967), pGmSCAMP3A-GUS transformed nodules were collected, GUS histochemical staining was performed and observed under a microscope (B). Figure 1 B). The results showed that the blue signal of GUS staining appeared exclusively in the soybean nodule infection zone, and almost no GUS signal was observed in the root tissue and nodule cortex tissue. This result further confirmed that GmSCAMP3 is indeed a soybean nodule infection zone-specific expression gene. The above results show that GmSCAMP3 plays an important role in soybean symbiotic nitrogen fixation, especially in the infection process.

[0049] The vector construction method is as follows:

[0050] The genomic DNA of wild-type Williamas 82 was used as a template to amplify the GmSCAMP3 promoter sequence. At the same time, the pDEST-GUS plasmid was taken out from -20°C and placed on ice to melt, and a linear plasmid was obtained using a double enzyme digestion reaction system. After the reaction was completed, the amplified product and the digestion product were subjected to agarose gel electrophoresis, and the gel containing the target band was cut out under ultraviolet light and placed in a 2mL centrifuge tube. The PCR-amplified DNA fragments and digestion products were recovered using the Promega agarose gel recovery kit. The vector was constructed using the pEASY-Uni Seamless Cloning and Assembly Kit from Quanshijin Company. Finally, the construction of the pGmSCAMP3-GUS vector was finally completed by transformation into Escherichia coli.

[0051] Hairy root transformation experiments: Toth, K., Batek, J., and Stacey, G. (2016). Generation of soybean (Glycine max) transient transgenic roots. Curr ProtocPlant Biol 1, 1-13. 10.1002 / cppb.20017.

[0052] Example 4 Verification of GmSCAMP3A's involvement in intracellular membrane transport

[0053] To clarify the involvement of GmSCAMP3 in intracellular endomembrane trafficking, we constructed an expression vector, GFP-GmSCAMP3, containing the N-segment fused to green fluorescent protein (GFP). We co-expressed the vector with an RFP-tagged endosomal marker protein vector (Yu, F., Lou, L., Tian, ​​M., Li, Q., Ding, Y., Cao, X., Wu, Y., Belda-Palazon, B., Rodriguez, PL, Yang, S., et al. (2016a). ESCRT-I component VPS23A affects ABA signaling by recognizing ABA receptors for endosomal degradation. Mol. Plant 9:1570–1582.) in Nicotiana benthamiana leaves using an Agrobacterium-mediated transient transformation system. Three days later, fluorescence signals in the leaves were observed using confocal laser scanning microscopy (CLSM). We found that the green fluorescence signal of the GFP-GmSCAMP3 fusion protein was mainly concentrated on the cell membrane and cytoplasmic punctate structures of leaf cells, which is very similar to the red fluorescence signal of plant endosomal marker proteins ( Figure 1 C). We then superimposed the two fluorescence signals, revealing that the green fluorescence signal from GmSCAMP3 overlapped well with the red fluorescence signal from the plant endosomal marker protein. Based on the localization characteristics of endosomal proteins, the punctate structures indicated by arrows in the image are cytoplasmic endosomal structures. This result suggests that GmSCAMP3A participates in intracellular endomembrane transport, indicating that it is a key endomembrane transport component specific for soybean symbiotic nitrogen fixation.

[0054] The vector was constructed as follows:

[0055] Wild-type Williamas 82 cDNA was used as a template to amplify the GmSCAMP3 CDS sequence. Simultaneously, the pCambia1300-221-GFP.3 plasmid (Yu, F., Lou, L., Tian, ​​M., Li, Q., Ding, Y., Cao, X., Wu, Y., Belda-Palazon, B., Rodriguez, PL, Yang, S., et al. (2016a). ESCRT-I component VPS23A affects ABA signaling by recognizing ABA receptors for endosomal degradation. Mol. Plant 9:1570–1582) was removed from -20°C and thawed on ice. A linearized plasmid was then obtained using a double enzyme digestion system. Following the reaction, the amplified and digested products were subjected to agarose gel electrophoresis. The gel containing the target band was excised under UV light and placed in a 2 mL centrifuge tube. The PCR-amplified DNA fragments and digested products were recovered using a Promega agarose gel extraction kit. The pEASY-Uni Seamless Cloning and Assembly Kit was used for vector construction. Finally, the pCambia1300-221-GFP-GmSCAMP3 vector was constructed by transformation of E. coli.

[0056] Tobacco co-expression experiment reference: Yu, F., Lou, L., Tian, ​​M., Li, Q., Ding, Y., Cao, 9:1570–1582.

[0057] Example 5 Verification of GmSCAMP3 regulation of soybean nodule symbiotic nitrogen fixation

[0058] To clarify whether GmSCAMP3 regulates the symbiotic nitrogen fixation process in soybean nodules, we used the CRISPR-Cas9 gene editing system to edit the GmSCAMP3 gene coding sequence (sgRNA: GGACGCAAAAGCAAAGGAGAAGG, SEQ ID NO: 8) and obtained the soybean W82 mutant Gmscamp3 plants in which GmSCAMP3 protein translation was prematurely terminated ( Figure 1 D). Seeds of the wild-type W82 and the Gmscamp3 mutant were sown in vermiculite-based pots in a greenhouse and watered with nitrogen-deficient culture medium (1 / 2 Hoagland solution (nitrogen-free)). Three days after germination, they were inoculated with the rhizobium USDA110. Compared to the wild-type W82 plants, the mutant plants showed a general yellowish coloration of their leaves 14 days after inoculation, especially in the first three-leaf compound leaf. Figure 1 E and 1F), the mutant SPAD value was 19.56 / the wild type SPAD value was 30.3867 = 64.37%. When the plants were watered with complete nutrient medium (1 / 2 Hoagland solution (nitrogen-free) supplemented with 2.5 mM KNO3), the mutant leaves were similar to the wild type and did not show a yellowing phenotype. The results showed that the yellowing of leaves in Gmscamp3 plants is caused by nitrogen deficiency in the plants, suggesting that the Gmscamp3 root nodule symbiotic nitrogen fixation ability is defective compared to the wild type. Subsequently, we used acetylene reduction to confirm that the Gmscamp3 mutant root nodule symbiotic nitrogen fixation ability is significantly defective compared to the wild type ( Figure 1 First, we collected nodules of wild-type and Gmscamp3 mutant plants inoculated with rhizobia for 21 days. The nodules were placed in 20 mL sample vials, and an equal volume of air was replaced with 2 mL of acetylene. The samples were allowed to stand at room temperature for 1 hour before being analyzed by gas chromatography. The results showed that the nitrogenase activity in Gmscamp3 mutant nodules was only 65.79% of that in wild-type nodules, indicating that the GmSCAMP3 protein plays a key role in regulating the symbiotic nitrogen fixation ability of soybean nodules.

[0059] We subsequently used cytological experiments to elucidate the mechanism of the reduced symbiotic nitrogen fixation ability of Gmscamp3 nodules. We used microscopy to observe semi-thin sections of nodules from W82 wild-type soybeans and Gmscamp3 mutants. Compared with wild-type nodules, Gmscamp3 mutant nodules showed a significant increase in vesicular structures in infected cells ( Figure 1H and 1I), the mutant had 17.4 bleb structures per infected cell / the wild type had 5.2 bleb structures per infected cell = 334.6%. Through observation, we found that nearly half of the volume of the infected cells in the mutant nodules was occupied by bleb structures, while the infected cells in the control nodules had only a small number of bleb structures. The results showed that the infected cells of the Gmscamp3 mutant nodules had obvious developmental defects compared with the wild-type W82 nodule-infected cells. At the same time, compared with the wild-type W82 nodule-infected cells, the number of rhizobia colonized in the nodule-infected cells of the Gmscamp3 mutant was significantly reduced ( Figure 1 H and 1J), the mutant had 12.9 rhizobia per infected cell / the wild-type had 51.1 rhizobia per infected cell = 25.2%. These results indicate that the reduced symbiotic nitrogen fixation capacity of Gmscamp3 nodules is due to defects in the development of infected cells and rhizobium colonization in the mutant nodules. In summary, the soybean nodule-specific inner membrane transport component GmSCAMP3 regulates symbiotic nitrogen fixation in soybean nodules. This research provides a new perspective for improving soybean symbiotic nitrogen fixation, enhancing soybean yield and quality, and can also be used to develop novel bio-nitrogen fixation efficiency technologies through genetic engineering, providing support for achieving efficient nitrogen fixation in non-legumes.

[0060] 1 / 2 Hoagland solution formula (nitrogen-free)

[0061]

[0062]

[0063] SEQ ID NO: 1 GmSCAMP3 CDS sequence

[0064] ATGAGTCGCTACGATCCCAATCCCTTCGACGAAGAACCGGTCGAGGTTAATCCCTTCGCGGATGGAGCAGCTAAAGGAAAAGGCTCAGGGCAATCAAGTTATAGTGGAGGTGCATTTTATACTACTAACACTGGAAGTGTTCCCTCCTCAAACTCAAGGCTCTCACCCCTTCCACCAGAGCCTTATGATCGTGGGGCAACTATTGACATCCCCCTAAATAATGCAAAGGACGCAAAAGCAAAGGAGAAGGAACTTCAAGCTAAAGAGGCTGAATTGAAAAGAAGGGAACAGGAACTAAAACGAAGGGAAGATGCTATAGCACGAGCTGGAATAGTTATAGAGGAGAAAAATTGGCCACCTTTTTTCCCCATCATTCATCATGACATTGCAAAGGAAATACCAGTACATCTTCAAAGGATCCAGTACATTGCATTTACAACATGGTTGGGTTTGGTTCTGTGTCTTTTGTGGAATATTGTGGCAGTTACTACTGCTTGGATCAAAGGAGAAGGTCCAACCATCTGGTTTCTTGCTATTATCTATTTTATTTCTGGTGCTCCAGGATCCTATGTGTTGTGGTATCGCCCTCTTTATCGTGCTATGAGGACTGACAGTGCTCTGAAATTTGGCTGGTTCTTCTTGCTTTACATGTTGCACATTGCCTTTTGCATTTTAGCTGCAGTTGCTCCACCAATTATCTTCAAAGGAAAATCTCTCACAGGCATTTTGGCTGCGATTGATGTGTTGGGAGACAATGCATTGGTTGGGATATTCTACTTCATTGGATTTGGCCTTTTCTGTCTCGAGTCAGTGCTGAGCATCTGGGTTATACAGCAAGTATATATGTACTTCCGTGGCAGTGGCAAGGCTGCAGTTTTAAAGCGTGAGGCTGCGAGAGGGACAATGATGGCAGCTCTATAA

[0065] SEQ ID NO:2 GmSCAMP3氨基酸序列

[0066] MSRYDPNPFDEEPVEVNPFADGAAKGKGSGQSSYSGGAFYTTNTGSVPSSNSRLSPLPPEPYDRGATIDIPLNNAKDAKAKEKELQAKEAELKRREQELKRREDAIARAGIVIEEKNWPPFFPIIHHDIAKEIPVHLQRIQYIAFTTWLGLVLCLLWNIVAVTTAWIKGEGPTIWFLAIIYFISGAPGSYVLWYRPLYRAMRTDSALKFGWFFLLYMLHIAFCILAAVAPPIIFKGKSLTGILAAIDVLGDNALVGIFYFIGFGLFCLESVLSIWVIQQVYMYFRGSGKAAVLKREAARGTMMAAL*

[0067] SEQ ID NO:3 GmSCAMP3基因启动子的核苷酸序列

[0068]

[0069] The specific embodiments described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A protein that regulates the symbiotic nitrogen fixation ability of soybean nodules, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO:

2.

2. A gene that regulates the symbiotic nitrogen fixation ability of soybean nodules, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

3. An expression vector, characterized in that The expression vector comprises the polynucleotide encoding the protein according to claim 1 or the gene according to claim 2.

4. The expression vector according to claim 3, characterized in that The expression vector comprises a marker, optionally, the marker is selected from a luminescent marker, an antibiotic marker and an anti-chemical marker, optionally, the luminescent marker is selected from a red fluorescent protein and a green fluorescent protein, the antibiotic marker is selected from an ampicillin marker, a chloramphenicol marker, a kanamycin marker, a neomycin marker, a rifampicin marker, a spectinomycin marker, a hygromycin marker, a streptomycin marker and a tetracycline marker, and the anti-chemical marker is a herbicide-resistant marker.

5. The expression vector according to claim 3 or 4, characterized in that The vector is a plant expression vector, including a binary Agrobacterium rhizogenes vector and / or a vector that can be used for plant microprojectile bombardment.

6. A host cell, characterized in that The host cell comprises the expression vector according to any one of claims 3 to 5.

7. The host cell according to claim 6, characterized in that The host cell is selected from Escherichia coli cells and Agrobacterium cells (eg, Agrobacterium rhizogenes cells).

8. The host cell according to claim 7, characterized in that The Agrobacterium rhizogenes is selected from K599, AR1193, C58cl, Arqual, MSU440, LBA9402 and R1601.

9. Use of a polynucleotide encoding the protein according to claim 1 or a gene according to claim 2 or an expression vector according to any one of claims 3 to 5 or a host cell according to any one of claims 6 to 8 in cultivating a legume plant, such as soybean, with improved yield or altered symbiotic nitrogen fixation ability.

10. A method for increasing soybean yield or changing the symbiotic nitrogen fixation ability of soybean root nodules, characterized in that: The method comprises the step of introducing a polynucleotide encoding the protein according to claim 1 or a gene according to claim 2, or an expression vector according to any one of claims 3 to 5, or a host cell according to any one of claims 6 to 8 into soybean cells or tissues to obtain transgenic soybeans.

Images