Method for high-efficiency direct seeding and seedling raising of paphiopedilum leucopeniculatum seeds by using colacia fungi

Abstract

The invention discloses a method for high-efficiency direct seeding and seedling raising of paphiopedilum leucopeniculatum seeds by using Lagilawood fungi. The bacterial strain is Tulasnella sp. PC02, and the preservation number of the bacterial strain is GDMCC No: 64259. In a soil culture environment, the strain PC02 and paphiopedilum glaucum seeds are subjected to symbiotic germination, and the seedling rate of the paphiopedilum glaucum can reach 42.46% within 90 days. The method has the advantages of being simple in experimental step, low in cost, high in field cultivation survival rate, free of tissue degeneration and the like, and technical support is provided for carrying out imitated ecological cultivation, species regression and population reconstruction of paphiopedilum leucopeniculatum.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of Paphiopedilum breeding, and particularly relates to a method for seed high-efficiency direct sowing and seedling of Paphiopedilum spicerianum by using a Sebacina fungi. BACKGROUND

[0002] Paphiopedilum spicerianum is the most distinctive species of Paphiopedilum, in which the sepals are white, the base is light green, the inner surface of the midrib is purple red, like a white flag, the degenerated stamens are nearly rhombic, the middle part is light purple, the edge is white, the base edge is shrunk and slightly ear-shaped, and the flowering period is from October to December. In 2006, China first discovered Paphiopedilum spicerianum in Pu'er City, Yunnan Province, which grows on steep river banks. In addition, the river water is seriously polluted, and the growth environment is very poor. The biological population only has more than 20 plants, and has high conservation and research value. In view of the current distribution status, the most effective way is to carry out ex situ conservation on the basis of artificially expanding seedlings, and then to return to the wild and meet market demand.

[0003] The seeds of Paphiopedilum are small and lack endosperm. Under natural conditions, the seeds of orchid plants need to establish a symbiotic relationship with certain fungi to germinate, and in the subsequent plant vegetative growth and reproductive growth processes, the orchid plants also need to symbiotically grow with mycorrhizal fungi. At present, the germination of orchid seeds is mostly carried out in a sterile environment by using artificial culture medium for non-symbiotic germination. However, it is found that part of the protocorms stop developing during non-symbiotic germination, and the non-symbiotic germination seedlings have problems such as slow growth, poor disease resistance and high mortality rate after transplanting and returning to the wild. Compared with non-symbiotic germination, the seedlings obtained by symbiotic germination of fungi and Paphiopedilum seeds have better environmental adaptability in natural habitats. At present, symbiotic germination is carried out in a sterile environment by using tissue culture technology, and there is no method for directly carrying out symbiotic germination of mycorrhizal fungi and orchid plants in a soil culture environment. Obtaining effective symbiotic fungi for seed germination of Paphiopedilum spicerianum is a key link for returning to the wild of rare and endangered orchid plants. The screening and separation of seed germination effective fungi have been one of the difficulties. It is also one of the hot spots of orchid plant technology to directly carry out symbiotic germination of mycorrhizal fungi and orchid plants in a soil culture environment to simplify the experimental steps and save costs. SUMMARY

[0004] In order to solve the above problems in the prior art, the application provides a method for symbiotic germination of Sebacina fungi and Paphiopedilum spicerianum seeds in a soil culture environment and application. The method has the advantages of simple operation, low cost and high efficiency.

[0005] To achieve the above object, the application adopts the following technical scheme:

[0006] A kind of Tulasnella sp. PC02, on January 10, 2024, is preserved in Guangdong Microbial Culture Collection Center, and the preservation number is GDMCC No:64259.

[0007] The biological morphological characteristics of the Tulasnella sp. PC02 are as follows:

[0008] After being cultured on PDA plates for 7 days, the colonies are white, the surface is covered with soft hair, there are many aerial hyphae, and they grow regularly in a circular shape; after being cultured in a fungal incubator at 28℃ for 7 days, the insert piece is sliced according to the conventional slicing method, and under the observation of an optical microscope, the bead-shaped hyphae are more, the hyphae have septa, the thickness is 3-5 μm, the branches are nearly at right angles, and there are septa near the branches; the hyphae are roughly divided into two types, one type is regular and slender, and the other type is slightly irregular and has many thick-walled chlamydospores.

[0009] The application also provides a microbial agent containing the Tulasnella sp. PC02 described above.

[0010] The application also provides the application of the Tulasnella sp. PC02 or the microbial agent described above in promoting the germination of orchid seeds to form seedlings.

[0011] Preferably, the formation of seedlings refers to the germination of orchid seeds to form at least one leaf.

[0012] Preferably, the orchid is Paphiopedilum spicerianum.

[0013] The application also provides a method for efficiently direct seeding and seedling raising of Paphiopedilum spicerianum seeds using Tulasnella sp., which comprises the following steps: mixing sterile Paphiopedilum spicerianum seeds with sterile water to prepare a seed suspension; inoculating an agar block containing a single-fungus PC02 pure culture in a culture medium, uniformly seeding the agar block with the seed suspension using a pipette gun, sealing the culture dish with a sealing film, and then culturing.

[0014] Preferably, the culture medium is prepared by mixing peat soil and vermiculite at a mass ratio of 3:1.

[0015] Preferably, the culture conditions are as follows: the culture medium is placed in a culture room, the temperature of the culture room is (25±2)℃, the light illumination time is 10-12 h per day, and the light intensity is 1600-2000 lx.

[0016] Preferably, the sterilization and disinfection step is as follows: the fruit pod is wiped clean, 70% alcohol is used for disinfection for 60 s, sterile water is used for washing for 30 s, 0.1% HgCl2 solution is used for disinfection for 7 min, sterile water is used for washing for 3 times, each time for 30 s, the fruit pod is cut open, and sterile Paphiopedilum spicerianum seeds are obtained.

[0017] The present application has the following beneficial effects:

[0018] (1) The Tulasnella sp. PC02 of the present application is isolated from the roots of Paphiopedilum callosum, and the isolation method is simple and convenient and has strong specificity.

[0019] (2) The Tulasnella sp. PC02 is used to obtain high-quality symbiotic seedlings by symbiosis with Paphiopedilum callosum seeds in soil culture environment, and the Paphiopedilum callosum seedlings are efficiently cultivated. Compared with tissue culture, the method has the advantages of low cost, high survival rate of seedlings transplanted in the wild, no tissue degradation problem, etc., and has application value for replacing tissue culture to obtain symbiotic seedlings.

[0020] (3) The present application is simple to operate, low in cost, and suitable for popularization and application, and has great popularization value in the restoration of rare and endangered orchid plants, the reconstruction of small populations, and the solution of the seedling source bottleneck problem of Paphiopedilum callosum cultivation industry.

[0021] The Tulasnella sp. PC02 was preserved in the Guangdong Microbial Culture Collection Center (GDMCC) on January 10, 2024, at 59 Building, 5th Floor, 100 Middle Xianlie Road, Guangzhou, Guangdong Province, China, with a postal code of 510070, and a preservation number of GDMCC No: 64259. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 It is the colony obtained by isolating and purifying from the roots of Paphiopedilum callosum in Example 1.

[0023] Figure 2 It is a strain morphology diagram of Tulasnella sp. PC02 cultured on a PDA plate. Among them, A represents the morphology of PC02 strain (scale 1000 μm); B represents the microscopic structure of PC02 mycelium (100X).

[0024] Figure 3 It is the situation of seedling germination of Paphiopedilum callosum seeds and Tulasnella sp. PC02 symbiosis in soil culture environment in Example 2. Among them, A represents the growth of seeds after 30 days of sowing; B represents the growth of seeds after 45 days of sowing; C represents the growth of seeds after 60 days of sowing; D represents the growth of seeds after 90 days of sowing; E represents the growth of seeds after 120 days of sowing; F represents the growth of seeds after 360 days of sowing. DETAILED DESCRIPTION

[0025] In order to make the purposes, technical solutions and beneficial technical effects of the present application clearer, the present application will be further described in detail below in combination with embodiments. It should be understood that the embodiments described in the present specification are merely for explaining the present application, and are not intended to limit the present application.

[0026] Example 1: Isolation and identification of Tulasnella sp. PC02 strain

[0027] 1. Isolation of Tulasnella sp. PC02

[0028] (1) The source of Phalaenopsis amablis explants: The sterile sowing plant of Phalaenopsis amablis was obtained by sterile sowing and tissue culture, and was cultivated in the orchid greenhouse of the scientific research area of South China Botanical Garden in 2022. The plant had been cultivated for 3 years at the time of the experiment.

[0029] (2) Disinfection of root segments and induction, isolation and purification of endophytic fungi: The root segments of the sterile sowing plant were soaked in 75% alcohol for 30 seconds and 0.1% HgCl2 solution for 7 minutes, and then taken out with sterile forceps and washed with sterile water for 3 times. The Phalaenopsis roots after disinfection were cut into 1-2 mm root segments with a sterile scalpel, and the fungal hyphae were continuously cut from the tip of the hyphae to a new PDA medium for serial transfer. After 3 times of transfer, pure colonies were obtained. Figure 1 )。

[0030] (3) Fungal preservation: The purified fungus was preserved by the test tube slant method. The prepared PDA medium was poured into a glass test tube with a size of 18x20mm, and the medium was poured into the test tube at about 1 / 3 of the volume of the test tube. The test tube was placed in an autoclave (121℃, 7min) for sterilization. After sterilization, the test tube was placed in an ultra-clean bench and arranged into a slant for use. In the ultra-clean bench, the purified strain was inoculated on the PDA slant with a sterile inoculation needle, and the strain, number and date were noted. The inoculated test tube was placed in an artificial climate chamber at 25±2℃ for culture. When the hyphae grew over the PDA slant, the test tube was taken out and stored in a 4℃ refrigerator.

[0031] The isolated strain was preserved in the Guangdong Microbial Culture Collection Center and was alive.

[0032] 2. Identification of Tulasnella sp. PC02

[0033] (1) The total DNA of the fungus involved in molecular biology identification was extracted by the CTAB method; the primers used for PCR amplification were fungal universal primers ITS1 and ITS4; the PCR reaction system and conditions were referred to the corresponding product instructions; and the amplification product was sent to Kecheng Biotechnology Co., Ltd. for sequencing.

[0034] (2) The sequenced sequence is compared with the database of the National Center for Biotechnology Information in the United States: the strain identification result of the present application shows that the strain has a sequence similarity of 99.64% with Tulasnella sp. (OQ678369.1).

[0035] The fungus PC02 of the genus Corticium of the present application mainly has the following microbiological characteristics:

[0036] ① Morphological characteristics

[0037] The colony of the strain of the genus Corticium is white, covered with soft hair, with many aerial hyphae, and regularly round and grows in all directions on a PDA plate after being cultured for 7 days. Figure 2 ).

[0038] ② Physiological and biochemical characteristics

[0039] The microstructure of the strain is observed by using a cover glass insertion culture method, the fungus is cultured in a fungus incubator at 28°C for 7 days, the insertion piece is sliced according to a conventional slicing method, and the optical microscope is used for observation, the bead-shaped hyphae are more, the mycelium is 3-5 μm thick, the branches are nearly at right angles, and there are septa near the branches; the hyphae are roughly divided into two types, one type is regular and slender, and the other type is slightly irregular, and there are many thick-walled chlamydospores on the hyphae.

[0040] The total DNA of the fungus involved in the molecular biological identification is extracted by using the CTAB method; the primers used for PCR amplification are the universal primers ITS1 and ITS4 for fungi; the PCR reaction system and conditions are referred to the corresponding product instructions; and the amplification product is sent to the Genesee Biotechnology Co., Ltd. for sequencing.

[0041] Specifically, CTAB method was used to extract fungal DNA, and PCR amplification was performed using primers ITS1 and ITS4. The PCR reaction system (20 μL) included 10 μL 2 × rTaq mix, 1.0 μL 10 mM ITS1, 1.0 μL 10 mM ITS4, 7 μL ddH2O, and 1 μL DNA template (150 ng / μL). The amplification reaction was as follows: 94°C pre-denaturation for 3 min, 1 cycle; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 30 sec, 30 cycles; and finally 72°C extension for 5 min.The PCR amplification product was sequenced by Genescript Biotech Co., Ltd., and the nrDNA ITS sequence of the strain PC02 is shown as SEQ ID NO: 1, specifically: CAGGGTGACTGCGGAGGTCATAGTAATCGTCTTTGACGTGCTGTTTCCGTCGTCCTCGGGACGTTAAGGCGCTCTGGTCGAGGATAAACGACCCCTCTGACAGAGGTAAAGCCGTCCTGTGTTACCTCTTTGCCGAGGCACACGTTAAAGATCGTTCCGCATTGTGAGTCTAACACCAGTTGTAACACTTTTACAACCGGTAGCGCTGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCACTGCACCGCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTATCCCTTCGGGAGTCTTTTCGTTAAGACCCGAGTTCGGAGTCCTCGGTCTTTGGATCGTGTTCTCTTAGATGCGTCGCGCCGATCGCCTGATGGGTCACTCTAATGCCTGAGCGTGGAGTCCCTCGGAGTCGAGACGCGCTTGACCGAGTGTTGAGCTCGCGTCGCCAAGTCCGCACGTCTTGGACGTCGGTACTACAACGCATGACCTCATTGGGGTAGGACAACCCGCTAGACTTAAGCATATTAATCAGCGGAGGAAAAGAAACTAACCAGGATTCCCTCAGTAACTGCGAGTGAAGCGGGATCAGCTCAATGTGTGAATCTGGCTTGGGGTAGTTCCCTGGGTCCGAGTTGTGACCTAATGGACGTTTCGCCCTGCGTTTGTAATGGGGGGGGGGAAAATCCGTTGAAACACGGCACCTCCGAAGGGGCACAGGCCTGGAACACCTGGCTGGACTCCCGGCAATGGAAAGGGTCTCAAGAAGGGGGAAAATTTTTTATGGTGGGCCCCCCGGGGGGGGAAAAAAACCCCCAAG.

[0042] The strain identification results of the present application show that the strain PC02 has a sequence similarity of 99.64% with the fungus Tulasnella sp. (OQ678369.1). According to the colony, morphological characteristics and molecular biology methods, the fungus involved in the present application is identified as Tulasnella sp. The strain PC02 is named Tulasnella sp. PC02, and was preserved in Guangdong Microbial Culture Collection Center (GDMCC) on January 10, 2024, located at No. 59 Building, 5th Floor, 100 Middle Martyrs Road, Guangzhou, Guangdong Province, China, with a postal code of 510070, and a preservation number of GDMCC No: 64259.

[0043] Example 2: Effectiveness experiment of Tulasnella sp. PC02 on seed germination and seedling formation of Paphiopedilum eximium

[0044] 1. Experimental method

[0045] The live seedling experiment of Paphiopedilum eximium using endophytic fungi of Paphiopedilum eximium was used to detect whether the isolated fungi have a promoting effect on seed germination and seedling formation, and to compare the differences in promoting effects of different fungi on seed germination stage:

[0046] (1) Prepare the symbiotic germination medium: the symbiotic germination medium is oat agar medium, including 4 g / L oat and 7 g / L agar, and the solvent is water;

[0047] (2) Take out the Tulasnella sp. PC02 and inoculate it on the PDA medium, and place it in an artificial climate box for culture and activation until the fungal mycelium covers the culture dish to obtain the symbiotic germination strain;

[0048] (3) Add peat soil and vermiculite (peat soil: vermiculite = 3:1, mass ratio) in a 90 cm culture dish, and lay filter paper film on the surface (for subsequent photography). Mix the sterilized and pretreated Paphiopedilum eximium seeds in sterile water to obtain a seed suspension, and use a pipette to suck the seed suspension and evenly sow the seed suspension in the culture dish containing peat soil and vermiculite; the sterilization and pretreatment method is as follows: wipe the fruit pod clean, sterilize with 70% alcohol for 60 s, wash with sterile water for 30 s, sterilize with 0.1% HgCl2 solution for 7 min, and wash with sterile water for 3 times, each time for 30 s. Dry, cut open the fruit pod to obtain sterile Paphiopedilum eximium seeds.

[0049] (4) Sowing and culture: mix the sterile seeds with sterile water to make a sterile seed suspension; inoculate about 0.5 cm 3Agar blocks containing single fungal pure culture, 150 μL of seed suspension was evenly inoculated around the agar block with a pipette, and the Petri dish was sealed with parafilm; among them, 3 groups of Petri dishes were inoculated with strain PC02 (Tulasnella sp.) and strain QS02 (Epulorhiza sp.) isolated from the roots of Paphiopedilum callosum, and another group of medium without inoculation was set as a control treatment, and 0.5 cm 3 Sterile pure PDA agar blocks; each group of treatment was repeated 30 times, and placed in a culture room. The temperature of the culture room was (25±2) °C, and the light was on for 10-12 h per day, and the light intensity was 1600-2000 lx.

[0050] (5) The seed germination, protocorm formation and seedling differentiation were observed at 30 days, 60 days and 100 days after sowing, respectively. The seed germination was simplified into three stages, i.e. seed germination (embryo swelling and producing root-like structures), protocorm formation and development (embryo swelling breaking through the seed coat to appear protophloem), and seedling differentiation and development stage (the first leaf and subsequent growth). The number of seeds germinated (g), the number of protocorms (p) and the number of seedlings (s) of each treatment were counted according to the above classification standard, and the seed germination rate, protocorm formation rate and seedling rate of each group were calculated according to the total number of seeds sown (t). The average value of each group of data was taken. The non-parametric test method Kruskal-Wallis test (KW) and Mann-Whitney U-test (U) were used to test the significance of seed germination rate, protocorm formation rate and seedling rate of different treatments, α = 0.05.

[0051] 2. Experimental results

[0052] The growth results of Paphiopedilum callosum seeds and strain PC02 direct seeding and seedling culture are shown in Figure 3 , in which A represents the growth of seeds after 30 days of sowing; B represents the growth of seeds after 45 days of sowing; C represents the growth of seeds after 60 days of sowing; D represents the growth of seeds after 90 days of sowing; E represents the growth of seeds after 120 days of sowing; F represents the growth of seeds after 360 days of sowing.

[0053] The statistical results of different fungi on the seed germination and growth of Paphiopedilum callosum are shown in Table 1.

[0054] Table 1 Effect of different fungi on seed germination and growth of Paphiopedilum callosum (90 days)

[0055] Treatment group Strain Germination rate (%) Pro-embryo rate (%) Plantlet formation rate (%) PC02 Tulasnella sp. 60.19 ± 0.36 ** ]] 44.35 ± 0.68 ** ]] 42.46 ± 1.35 ** ]] QS02 Epulorhiza sp. 20.00±2.10 0 0 OMA Non-inoculation 0 0 0

[0056] As shown in Table 1, no seed germination, protocorm and seedling formation were observed in the OMA control group without inoculation at 90 days of sowing symbiotic culture; while the PC02 strain isolated from the roots of Paphiopedilum eximium plant could not only significantly promote seed germination (60.19±0.36%) but also significantly promote the subsequent development of protocorm into seedling (42.46±1.35%) at 90 days. It is shown that Tulasnella sp. PC02 can effectively promote seed germination and growth and development of Paphiopedilum eximium to the seedling stage.

[0057] Seed germination of orchid plants can be achieved by non-symbiotic germination culture and symbiotic germination culture; although most orchid plants can be germinated by non-symbiotic germination culture, and have a high germination rate, the seedlings obtained by this method grow slowly in the natural environment, have poor resistance to pathogenic microorganisms, and have a low survival rate. At the same time, it is difficult to establish a symbiotic relationship with the fungus contacted later, which leads to serious hindrance to the subsequent growth. The present application further optimizes the symbiotic germination in the tissue culture environment, and uses Tulasnella sp. for Paphiopedilum eximium seedling cultivation, which can greatly simplify the breeding process, reduce the cost, and improve the seed germination rate, seedling growth rate and seedling survival rate after transplantation to the natural environment. The strain of the present application is cultured on a culture dish containing peat soil and vermiculite through symbiotic germination experiment of Paphiopedilum eximium seeds and different fungi and blank control group, and the effective strain for promoting Paphiopedilum eximium seed germination is successfully obtained by comparing the seed germination rate, which opens up a new way for efficient seedling cultivation, seedling return to the original habitat and population reconstruction by using Tulasnella sp. for Paphiopedilum eximium seedling cultivation.

[0058] The above are only preferred embodiments of the present application, and it should be pointed out that the above preferred embodiments should not be regarded as limitation of the present application, and the protection scope of the present application should be limited by the scope defined by the claims. For ordinary skilled in the art, several improvements and refinements can be made without departing from the spirit and scope of the present application, and these improvements and refinements should also be regarded as the protection scope of the present application.

Claims

1. A Tulasnella sp. PC02, deposited with GDMCC No: 64259.

2. A bacterial agent, characterized in that It comprises the Polyporus fungus PC02 according to claim 1.

3. Use of the fungus PC02 of the genus Coleocybe according to claim 1 or the bacterial agent according to claim 2 in promoting the germination of orchid seeds and the formation of seedlings.

4. The use according to claim 3, characterized in that The seedling formation refers to the germination of orchid seeds to form at least one leaf.

5. The use according to claim 3, characterized in that The orchid plant is Paphiopedilum leucoderma.

6. A method for efficiently direct seeding and raising white flag Paphiopedilum seeds using fungi of the genus Coleus, characterized in that: The following steps are involved: The sterilized Paphiopedilum leucoderma seeds are mixed with sterile water to prepare a seed suspension; an agar block containing a pure culture of the single fungus PC02 according to claim 1 is inoculated in the middle of the culture medium, the seed suspension is sucked with a pipette and evenly sown around the fungus block, and the culture dish is sealed with a sealing film and then cultured.

7. The method according to claim 6, characterized in that The culture medium is prepared by mixing peat soil and vermiculite in a mass ratio of 3:

1.

8. The method according to claim 6, characterized in that The culture conditions are as follows: the culture medium is placed in a culture room, the temperature of the culture room is (25±2)°C, the light is on for 10 to 12 hours per day, and the illumination is 1600 to 2000 lx.

9. The method according to claim 6, characterized in that The disinfection and sterilization steps are as follows: wiping the fruit pods clean, disinfecting with 70% alcohol for 60 seconds, washing with sterile water for 30 seconds, disinfecting with 0.1% HgCl2 solution for 7 minutes, washing with sterile water three times, each time for 30 seconds, drying, and cutting the fruit pods to obtain sterile seeds of Paphiopedilum leucoderma.

Images