Burkholderia gladioli bacteriophage and application thereof

Abstract

The invention relates to the technical field of microorganisms, and discloses a burkholderia gladioli bacteriophage and application thereof. Wherein the preservation number of the burkholderia gladioli bacteriophage is CGMCC (China General Microbiological Culture Collection Center) No.45883. The bacteriophage provided by the invention has a very strong lysis effect on burkholderia gladioli, can be used for preventing and controlling burkholderia gladioli, such as corn diseases caused by burkholderia gladioli, and has a good application prospect. Meanwhile, the bacteriophage provided by the invention can enlarge a bacteriophage resource library of burkholderia gladioli, so that diseases caused by burkholderia gladioli can be more comprehensively prevented and treated.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, in particular to a Burkholderia gladioli phage and application thereof. BACKGROUND

[0002] Burkholderia gladioli is a gram-negative bacterium, belonging to Burkholderia gladioli, Burkholderia, and widely exists in nature. Various pathogenic varieties have been found. Burkholderia gladioli was first isolated and identified from gladiolus plants, and then it was found that the bacterium could infect various economic crops such as onions, tulips, rice, and mushrooms. The plant stem base soft rot and leaf spot caused by Burkholderia gladioli have the symptoms of brown lesions on the leaves, followed by ulceration and scabbing, which seriously affects the growth and development of the plants. Recent research has found that the pathogenic variety of the bacterium can also infect humans and cause pulmonary fibrosis. At present, the prevention and control methods for plant diseases are mainly chemical pesticides, but pesticide residues, pathogen resistance, and environmental pollution cannot be ignored. With the implementation of the "antibiotic reduction and pesticide reduction" policy in China, it is urgent to develop a green control method to replace antibiotics, therefore, the phage control method has attracted people's attention again.

[0003] The phage has been discovered for more than a hundred years. As a virus widely existing in nature, the phage can infect bacteria, fungi, actinomycetes, or spirochetes, lyse host cells, and has the characteristics of environmental friendliness and no pollution, and can be used for the prevention and control of bacterial diseases. The phage has the characteristics of strong specificity to bacterial hosts, high lysis efficiency, and high safety. Therefore, it is of great significance to provide a phage that can specifically lyse Burkholderia gladioli for preventing and controlling the diseases caused by Burkholderia gladioli. SUMMARY

[0004] The purpose of the present application is to overcome the problems existing in the prior art, and to provide a Burkholderia gladioli phage and application thereof. The phage can specifically recognize and lyse Burkholderia gladioli, and can effectively prevent and control the diseases caused by Burkholderia gladioli infection.

[0005] In order to achieve the above purpose, the present application provides a Burkholderia gladioli phage in one aspect. The preservation number of the phage is CGMCC No. 45883.

[0006] The second aspect of the present application provides the application of the Burkholderia gladioli phage as described above in inhibiting Burkholderia gladioli.

[0007] The third aspect of the present application provides application of the Burkholderia gladioli phage as described above in preventing and treating plant diseases caused by Burkholderia gladioli.

[0008] Preferably, the plant disease is a corn bacterial disease.

[0009] The fourth aspect of the present application provides application of the Burkholderia gladioli phage as described above in preparing a medicine for preventing and treating diseases caused by Burkholderia gladioli.

[0010] The fifth aspect of the present application provides a lysate of the Burkholderia gladioli phage as described above.

[0011] The sixth aspect of the present application provides a phage preparation containing the Burkholderia gladioli phage as described above or the lysate as described above.

[0012] Preferably, the dosage form of the phage preparation is a liquid preparation, a freeze-dried preparation or a solid preparation.

[0013] The seventh aspect of the present application provides application of the lysate as described above or the phage preparation as described above in inhibiting Burkholderia gladioli.

[0014] The eighth aspect of the present application provides application of the lysate as described above or the phage preparation as described above in preventing and treating plant diseases caused by Burkholderia gladioli.

[0015] In the present application, a new Burkholderia gladioli phage (the preservation number is CGMCC No.45883) is provided, which has strong lytic effect on Burkholderia gladioli and can be used for preventing and controlling Burkholderia gladioli, for example, preventing and controlling corn diseases caused by Burkholderia gladioli, and has good application prospect. Meanwhile, the phage provided in the present application can expand the phage resource library of Burkholderia gladioli, so that the diseases caused by Burkholderia gladioli can be prevented and treated more comprehensively and more efficiently.

[0016] Biological preservation

[0017] The phage provided in the present application is preserved on March 18, 2024, the preservation number is CGMCC No.45883, the classification and naming is Burkholderia gladioli phage (Burkholderia gladioli phage) ph4, the preservation unit is China General Microbiological Culture Collection Center (CGMCC), the preservation address is No.3, Yuanmingyuan Road West, Beijing, China, and the postcode is 100101. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 This is the pathogenicity test result of host bacteria CTH1;

[0019] Figure 2 This is a microscopic observation of the host bacteria CTH1;

[0020] Figure 3 This is the complete genome map of the host strain CTH1;

[0021] Figure 4 The plaque morphology and electron microscope images of the bacteriophage provided by the present invention;

[0022] Figure 5 The genome sequencing results of the bacteriophage provided by the present invention;

[0023] Figure 6 The optimal multiplicity of infection of the bacteriophage provided by the present invention;

[0024] Figure 7 A one-step growth curve of the bacteriophage provided by the present invention;

[0025] Figure 8 The effects of different temperatures on the bacteriophage provided by the present invention;

[0026] Figure 9 The effect of different pH values ​​on the bacteriophage provided by the present invention;

[0027] Figure 10 This is the clearance efficiency of the bacteriophage provided by the present invention on host bacteria CTH1. DETAILED DESCRIPTION

[0028] The following describes the specific embodiments of the present invention in detail with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the present invention.

[0029] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0030] The invention provides a gladiolus Burkholderia phage, and the preservation number of the phage is CGMCC No.45883.

[0031] It is found through research that Burkholderia glumae can cause corn bacterial diseases. The bacteriophage provided by the application has strong lysis effect on Burkholderia glumae and can be used for preventing and controlling corn diseases caused by Burkholderia glumae, and has good application prospect. Meanwhile, the bacteriophage provided by the application can further expand the bacteriophage strain resource library of Burkholderia glumae, and has important significance for the prevention and control strategy of Burkholderia glumae.

[0032] The bacteriophage provided by the application is isolated from domestic sewage of a farm produce market in Beijing, and has been preserved in the China General Microbiological Culture Collection Center on March 18, 2024.

[0033] The bacteriophage provided by the application forms a plaque with transparent middle and clear edge, and the size is about 0.7 mm. The electron microscope observation result is myovirus. The optimal multiplicity of infection (MOI) of the bacteriophage is 1, the latent period is 20 min, and one lysis cycle is 110 min. In addition, the titer of the bacteriophage is relatively stable between pH 3 and 11, and the highest tolerance temperature is 60 DEG C.

[0034] The application also provides application of the Burkholderia glumae bacteriophage in inhibiting Burkholderia glumae.

[0035] The application also provides application of the Burkholderia glumae bacteriophage in preventing and treating plant diseases caused by Burkholderia glumae.

[0036] The application is not limited to specific types of plant diseases, as long as the plant diseases are caused by Burkholderia glumae infection. For example, the plant diseases can be onion diseases, tulip diseases, rice diseases or mushroom diseases. In a specific embodiment, the plant disease is a corn bacterial disease.

[0037] The application also provides application of the Burkholderia glumae bacteriophage in preparing a medicine for preventing and treating diseases caused by Burkholderia glumae. Specifically, the diseases can be pulmonary fibrosis caused by Burkholderia glumae infection.

[0038] The application also provides a lysis solution, which is a lysis solution of the Burkholderia glumae bacteriophage. In a specific embodiment, the preparation method of the lysis solution comprises: culturing the bacteriophage in a culture medium containing host bacteria (Burkholderia glumae), and removing the host bacteria to obtain a bacteriophage lysis solution. The removal method of the host bacteria can be filtration sterilization or centrifugal sterilization.

[0039] The present application also provides a bacteriophage preparation, which contains the B. glumae bacteriophage as described above or the lysate as described above.

[0040] In the present application, the bacteriophage preparation can also contain other active ingredients having inhibitory or killing effects on B. glumae, including but not limited to microorganisms, important extracts or compositions, natural compounds, chemically synthesized compounds, or combinations thereof.

[0041] The present application does not make special limitations on the dosage form of the bacteriophage preparation. In a specific embodiment, the bacteriophage preparation is a liquid preparation, a lyophilized preparation, or a solid preparation.

[0042] The present application also provides the use of the lysate as described above or the bacteriophage preparation as described above in inhibiting B. glumae.

[0043] The present application also provides the use of the lysate as described above or the bacteriophage preparation as described above in preventing and treating plant diseases caused by B. glumae. The plant can be corn, onion, tulip, rice, or mushroom.

[0044] The present application also provides the use of the lysate as described above or the bacteriophage preparation as described above in preparing a medicament for preventing and treating diseases caused by B. glumae.

[0045] The present application will be described in detail below through examples, but the scope of protection of the present application is not limited thereto. In the following examples, the experimental methods are conventional methods in the art unless otherwise specified. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0046] In the following examples, the culture media used include:

[0047] TSB medium: tryptone 17 g / L, soybean papain hydrolysate 3 g / L, NaCl 5 g / L, KH2PO4 2.5 g / L, glucose 2.5 g / L, agar 15 g / L;

[0048] R2A medium: acid hydrolyzed casein 0.5 g / L, yeast extract 0.5 g / L, peptone 0.5 g / L, glucose 0.5 g / L, starch 0.5 g / L, K2HPO4 0.3 g / L, MgSO4 0.024 g / L, sodium pyruvate 0.3 g / L, agar 15 g / L;

[0049] KB medium: peptone 20 g / L, MgSO4·7H2O 1.51 g / L, K2HPO4·3H2O 1.96 g / L, glycerol 10 g / L, agar 15 g / L;

[0050] TYG medium: peptone 1 g / L, yeast extract 1 g / L, glucose 0.5 g / L, KCl 6.34 g / L, NaCl 1.2 g / L, MgSO4·7H2O 0.25 g / L, K2HPO4 0.13 g / L, CaCl2·2H2O 0.22 g / L, K2SO4 0.17 g / L, Na2SO4 2.4 g / L, NaHCO3 0.5 g / L, Na2CO3 0.09 g / L, Fe-EDTA 0.07 g / L, agar 15 g / L;

[0051] NA medium: beef extract 3 g / L, peptone 10 g / L, NaCl 5 g / L, agar 15 g / L.

[0052] Example 1

[0053] This example is used to illustrate the isolation, screening and identification of host bacteria (i.e. corn pathogen).

[0054] 1. Isolation:

[0055] (1) Collect corn disease-affected leaves and stems in Northeast Black Land, rinse the surface with water, then disinfect with 1% sodium hypochlorite for 3 min, wash with sterile water three times, and dry the surface with filter paper.

[0056] (2) Take a typical sample, grind it in a mortar, add 5 mL of 0.001% (v / v) silwet L-77 solution, soak the sample liquid as the original solution, dilute it by gradient, and spread it on TSB, R2A, KB, TYG, NA and other five different culture medium plates, and incubate at 28°C.

[0057] (3) Select plates with 30-300 colonies, pick several single colonies from them to streak on the culture medium, and incubate in liquid medium at 28°C overnight, add bacteria preservation solution, store at -80°C, and save the streak plate for later use.

[0058] 2. Screening:

[0059] (1) Primary screening: inoculate with leaf cutting method, centrifuge to collect the bacteria liquid for detection, suspend the bacteria in ddH2O, wash twice, adjust OD 600 = 1, use sterile scissors to dip the bacteria liquid and cut the third leaf of three-leaf-stage corn, use ddH2O as negative control. Culture in a plastic cover at room temperature for 3 d, observe and take pictures. Select strains with lesion length greater than 0.5 cm after inoculation as candidate pathogens, one of which, CTH1, has obvious pathogenic phenotype, and then perform the next step of rescreening on the primary screening strains.

[0060] (2) Re-screening: injection and wound inoculation, collect the candidate pathogenic bacteria liquid in logarithmic growth phase, adjust OD after washing twice with ddH2O 600 = 1, inject 1 mL of bacterial solution to the base of the stem of three-leaf stage corn (about 5 cm from the corn root), and at the same time, wound the corn leaves, use a sterile cotton swab to apply the bacterial solution to the wound site, E. coli DH5a is used as a negative control, and a plastic cover is used to maintain moisture at room temperature for 3 days. Observe and take pictures. The strain causing stem depression wilting by injection and leaf lesion expansion of 0.5 cm by wound inoculation is judged as a corn pathogenic bacteria. The corn plants inoculated with strain CTH1 are shown in Figure 1 Figure 1 A is injection, the white arrow indicates the inoculation site, the upper side is the experimental group, and the lower side is the control group; Figure 1 B is wound inoculation, the left side is the control group, and the right side is the experimental group. As can be seen from Figure 1 , the control group has no obvious symptoms, and the corn plants inoculated with strain CTH1 show stem browning wilting and heart leaf curling necrosis phenotype.

[0061] At the same time, the Koch's postulates of the strain CTH1 were verified. The pathogenic bacteria were isolated from the corn tissue after re-screening, and the isolated pathogenic bacteria were re-inoculated onto healthy corn plants. The results showed that the healthy corn plants showed pathogenic phenotype, and the pathogenic bacteria isolated from the diseased part were consistent with the initially inoculated strain, indicating that the bacteria were pathogenic bacteria of corn.

[0062] 3. Identification:

[0063] Strain CTH1 was rod-shaped under light microscope (see Figure 2 ), 16S rDNA fragments were amplified using universal primers 27F / 1492R, and the PCR amplification products were sequenced. The sequencing results were subjected to BLAST comparison in NCBI. The results showed that the sequence had 100% identity with the 16S ribosomal RNA sequence of Burkholderia gladioli pv. gladioli strain FDAARGOS_188 chromosome 2, with a coverage of 100%. According to the principle that similarity greater than 98.7% is the same genus, strain CTH1 was preliminarily determined as Burkholderia, and was named as Tangsheng Burkholderia (Burkholderia gladioli) CTH1.

[0064] Further whole genome sequencing of strain CTH1 was performed, and the genome circle diagram is as follows Figure 3 ​The CTH1 genome consists of a circular DNA, with a total length of 849,985 bp and a GC content of 68.02%. There are 6,999 protein-coding regions (CDS), 2 rRNA and 74 tRNA and 1 tmRNA genes.

[0065] The universal primers 27F / 1492R are as follows:

[0066] 27F (5'-3'): AGAGTTTGATCCTGGCTCAG

[0067] 1492R (5'-3'): TACGGYTACCTTGTTACGACTT

[0068] The 16S rRNA full-length sequence of Burkholderia gladioli CTH1 is shown as SEQ ID NO: 1:

[0069]

[0070] Example 2

[0071] This example is used to illustrate the isolation, purification and expansion culture of the bacteriophage ph4 according to the present application.

[0072] 1. Isolation and purification of bacteriophage

[0073] (1) Add 10 mL of TSB liquid medium into a 50 mL sterile centrifuge tube, and pick a small amount of B. tectorum CTH1 obtained in Example 1 to culture overnight at 28°C with shaking. Then inoculate 100 μL of the bacterial solution into 10 mL of fresh liquid medium at a ratio of 1%, and culture to the logarithmic growth phase to obtain the host bacterial solution.

[0074] (2) Take 1 mL of sewage sample (collected from a certain farmers market in Beijing), filter the bacteria with a 0.22 μm microporous filter, and add 100 μL of the host bacterial solution in the logarithmic growth phase, and incubate at 28°C for 30 min; add 6 mL of TSB solid medium containing 0.75% agar at about 50°C, mix well, and pour onto the solid TSB medium (the amount of agar is 1.5%), to make a double-layer agar plate, and culture overnight at 28°C for about 48 h, and observe whether there is plaque formation.

[0075] (3) Place the upper medium containing a single plaque into 1 mL of SM buffer (50 mM Tris-HCl, 10 mM MgSO4, 10 mM NaCl), crush with a toothpick, and place at 4°C for 2 h or overnight; filter the bacteria with a 0.22 μm microporous filter to obtain the bacteriophage stock solution, and then dilute the bacteriophage stock solution with SM buffer to 10 -4 , add 100 μL of the host bacterial solution in the logarithmic growth phase, and plate the double-layer plate, and repeat the operation for about three times until the plaques of uniform size and shape are obtained, i.e., the purified bacteriophage is obtained, and the strain is named as ph4.

[0076] The plaque formed by the purified bacteriophage on the plate (as shown in Figure 4 A) is round, transparent in the middle, clear in the edge, uniform in size, and about 0.7 mm in diameter.

[0077] 2. Expansion culture of bacteriophage

[0078] Prepare 500 mL of liquid TSB medium, sterilize at 121°C for 20 min, and cool to room temperature, then add 1 mL of 10 8PFU / mL phage ph4, 1 mL of host bacteria liquid in logarithmic growth phase, 28°C overnight culture. The co-culture solution was centrifuged at 4°C, 8,000g for 10 min, and the supernatant was obtained, filtered with a 0.22 μm microporous filter to remove bacteria, and the phage amplification stock solution was obtained.

[0079] The phage amplification stock solution was gradient diluted, 100 μL of different gradient dilutions were taken, 100 μL of host bacteria liquid was added, and the number of plaques was counted by double-layer plate method, and the phage titer was calculated.

[0080] Example 3

[0081] This example is used to illustrate the identification of the phage ph4 according to the present application.

[0082] 1. Morphological observation

[0083] To the phage amplification stock solution obtained by the amplification culture in Example 2 above, NaCl was added to a final concentration of 1 mol / L, and after uniform dissolution, ice bath for 1 h, 8,000g centrifugation for 15 min, remove the cell debris, and collect the supernatant. Measure the volume of the supernatant, add PEG8000 to a final concentration of 100 g / L, mix gently, and place at 4°C for 24 h to form a precipitate of phage particles. The precipitated phage solution was centrifuged at 4°C, 10,000g for 20 min, and the supernatant was discarded, and the precipitate was recovered. The centrifuge tube was inverted for 5 min, the residual liquid was dried, and the precipitate was resuspended with SM buffer. Then an equal volume of chloroform was added for extraction, shaken for 30 s to remove polyethylene glycol and cell debris from the phage suspension, and the water phase containing phage was recovered to obtain phage liquid, which was placed at 4°C for standby.

[0084] Take 10 μL of the phage liquid and add it to a copper mesh for adsorption for 10 min, use filter paper to absorb the excess liquid, add 10 μL of 0.3% uranyl acetate and stain for 2 min, then remove the stain, air dry at room temperature, and observe the phage morphology under a transmission electron microscope.

[0085] The results are shown in Figure 4 B, the results show that the head of the phage obtained after separation and purification is a regular hexagon, with a diameter of about 65 nm; the tail length is about 110 nm, and the diameter is about 15 nm, which is a myovirus.

[0086] 2. Genome sequencing

[0087] To the phage stock solution obtained from the expansion of Example 2, DNase I and RNase A were added to 1 μg / μL, and incubated at 37℃ for 1 h to degrade the residual DNA and RNA of the host bacteria; EDTA (pH 8.0) was added to a final concentration of 20 mM / L to inactivate the DNase I; proteinase K was added to a final concentration of 50 ug / ml, and SDS was added to a final concentration of 0.5%, and incubated at 56℃ for 1 h to degrade the protein shell of the phage; after cooling to room temperature, an equal amount of saturated phenol was extracted, mixed and inverted for 30 s, then centrifuged at 5,000 g for 10 min at room temperature, and the upper aqueous phase was collected; then the same amount of saturated phenol and chloroform mixture (volume ratio 1:1) and chloroform were extracted once again, and the steps were the same as above, and chloroform was used to remove saturated phenol; the upper aqueous phase was removed, 1 volume of isopropanol was added, mixed evenly, and the phage nucleic acid was precipitated in an ice bath for 30 min; centrifuged at 12,000 g for 20 min at 4℃, the supernatant was discarded, the precipitate was washed twice with pre-cooled 70% ethanol, and dried at room temperature; the precipitate was dissolved in 50 μL of ddH2O, and stored at -20℃ for standby use.

[0088] The obtained phage genome was sequenced and analyzed, a library was constructed by using the Illumina TruSeqTM Nano DNA Sample Prep Kit method, and the sequence was predicted by using the GeneMarks software. The protein sequences of the predicted genes were respectively compared with the NR, Swiss-Prot, eggNOG, KEGG, GO and other databases, so as to obtain the annotation information of the predicted genes. The sequencing results show that the isolated phage genome is linear double-stranded DNA, the size is 67,899 bp, and the GC content is 59.97%. The genome circle diagram is shown in Figure 5 The phage genome sequence was subjected to sequence alignment by using BLASTn on NCBI, and the results show that the phage sequence has the highest similarity with Burkholderia phage Maja, the coverage is 5%, and the consistency is 76.78%; the coverage with Pseudomonas phage PSP3-DeSoir-2023 is 2%, and the consistency is 74.82%, so it can be known that the phage ph4 screened in Example 2 is a new phage, and it is judged to be a myovirus according to the morphological observation.

[0089] Example 4

[0090] This example is used to illustrate the optimal multiplicity of infection of the phage ph4 according to the application.

[0091] The phage titer was adjusted to 10 6 PFU / mL, 105 PFU / mL, host bacteria liquid was adjusted to 10 8 CFU / mL, 10 7 CFU / mL, 10 6 CFU / mL, 1:1 (10 6 PFU / mL:10 6 CFU / mL), 1:10 (10 6 PFU / mL:10 7 CFU / mL), 1:100 (10 6 PFU / mL:10 8 CFU / mL), 1:1000 (10 5 PFU / mL:10 8 CFU / mL) were added into 15 mL liquid LB medium, and the culture was obtained by overnight culture at 28°C and 220 rpm; 1 mL of the culture was centrifuged at 4°C and 8,000 g for 1 min, the supernatant was filtered with a 0.22 μm microporous filter to remove bacteria, gradient dilution was performed, and the phage titer at different MOI was detected by double-layer plate method, and the results are shown in Figure 6

[0092] As can be seen from Figure 6 , when the MOI is 1, the titer of the phage is the highest, about 10 8 PFU / mL.

[0093] Example 5

[0094] This example is used to illustrate the one-step growth curve of the phage ph4 according to the present application.

[0095] 1 mL of phage with a titer of 10 7 PFU / mL was mixed with 1 mL of host bacteria liquid with a titer of 10 9 CFU / mL, and after uniform mixing, the phage was allowed to adsorb to the surface of the bacteria at 28°C for 30 min; then, the supernatant was removed by centrifugation at 4°C and 8,000 g for 2 min, the bacteria were suspended with 10 mL of 28°C preheated TSB liquid medium, and the bacteria were cultured at 28°C and 220 rpm with three repeats; 300 μL of sample was taken every 10 min, the phage titer was detected after filtering to remove bacteria, and the results are shown in Figure 7

[0096] As can be seen from Figure 7 , the latent period of the phage infecting the host bacteria is about 5 min, and one lytic cycle is 110 min.

[0097] Example 6

[0098] ​​This example is used to illustrate the effects of different temperatures and pH on bacteriophage pH4.

[0099] (1) Effects of different temperatures on phage pH4

[0100] The titer is about 10 8 The phages with the highest PFU / mL were placed in water baths at 40°C, 50°C, 60°C, 70°C, and 80°C, and samples were taken every 20 minutes to detect the phage titer until 1 hour. After the end, the samples were placed on ice to cool to room temperature. The double-layer plate method was used to determine the phage titer after the treatment at different temperatures. Three replicates were set for each treatment. The results are shown in the figure below. Figure 8 shown.

[0101] Depend on Figure 8 As can be seen, the phage titer remained unchanged after exposure to 40°C and 50°C for 1 hour, decreased slightly after exposure to 60°C for 30 minutes, and completely degraded after exposure to 70°C for 30 minutes. This suggests that the phage's maximum temperature tolerance is around 60°C.

[0102] (2) Effects of different pH on phage pH4

[0103] The pH value of SM buffer was adjusted to 3-11 with HCl and NaOH, and the phage was diluted to 10 8 PFU / mL, 37℃ constant temperature water bath for 30min, double-layer plate method was used to determine the titer of phage at different pH. The results are as follows Figure 9 shown.

[0104] Depend on Figure 9 It can be seen that the phage titer remains at a stable level at pH 3-11, indicating good activity.

[0105] Example 7

[0106] This example is used to illustrate the efficiency of the bacteriophage ph4 described in the present invention in clearing host bacteria.

[0107] In order to detect the ability of phage to eliminate host bacteria, the titer was 10 8 PFU / mL, 10 7 PFU / mL, 10 6 PFU / mL phage 100 μL in 48-well plates, add OD 600 0.7 host bacterial solution (about 10 8CFU / mL) was added to 100 μL of the culture medium. The negative control group was 100 μL of bacterial solution plus 100 μL of SM buffer. The blank control group was 200 μL of SM buffer. Each well was repeated three times. The cells were allowed to stand at room temperature for 20 minutes. After that, 500 μL of TSB liquid medium was added to each well and the cells were incubated overnight at 28°C for about 16 hours. The OD value was measured using a microplate reader. 600 The actual measured value of each well is obtained by subtracting the measured value of the blank control group from the measured value of the experimental group. Figure 10 shown.

[0108] Depend on Figure 10 It can be seen that in the above experiments, the phage clearance efficiency of host bacteria is about 70% to 82.5%.

[0109] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, various simple variations of the technical solution of the present invention may be made, including combining the various technical features in any other appropriate manner. These simple variations and combinations should also be regarded as disclosed in the present invention and fall within the scope of protection of the present invention.

Claims

1. A Burkholderia gladioli phage, characterized in that The deposit number of this phage is CGMCC No.45883.

2. Use of the gladiolus Burkholderia phage according to claim 1 in inhibiting gladiolus Burkholderia.

3. Use of the gladiolus Burkholderia phage according to claim 1 in preventing and controlling plant diseases caused by gladiolus Burkholderia.

4. The use according to claim 3, characterized in that The plant disease is a bacterial disease of corn.

5. Use of the gladiolus Burkholderia phage according to claim 1 in the preparation of a medicament for preventing and treating diseases caused by gladiolus Burkholderia.

6. A lysis solution, characterized in that The lysate is the lysate of the gladiolus Burkholderia phage according to claim 1.

7. A bacteriophage preparation, characterized in that: The phage preparation contains the Burkholderia gladiolus phage according to claim 1 or the lysate according to claim 6.

8. The phage preparation according to claim 7, characterized in that The phage preparation is in the form of a liquid preparation, a freeze-dried preparation or a solid preparation.

9. Use of the lysate according to claim 6 or the phage preparation according to any one of claims 7 to 8 in inhibiting Burkholderia gladiolus.

10. Use of the lysate according to claim 6 or the phage preparation according to any one of claims 7 to 8 for preventing and controlling plant diseases caused by Burkholderia gladiolus.

Images