Establishment method of genetic transformation system of Cordyceps snowfeng

Through lytic enzyme treatment and PEG-CaCl2-mediated genetic transformation methods, combined with hygromycin B screening, a genetic transformation system of Xuefeng Cordyceps was successfully established, which solved the problem of molecular breeding of Xuefeng Cordyceps and realized gene function research and efficient directional breeding.

CN120775892AActive Publication Date: 2025-10-14HUNAN ACAD OF CHINESE MEDICINE
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510992184.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-18
Publication Date
2025-10-14
Estimated Expiration
2045-07-18

AI Technical Summary

Technical Problem

It is difficult to establish a stable and efficient genetic transformation system for Xuefeng Cordyceps with existing technology, mainly because Xuefeng Cordyceps is difficult to produce spores on artificial culture medium, which makes Agrobacterium-mediated spore transformation difficult, and PEG-mediated protoplast transformation method fails in Xuefeng Cordyceps.

Method used

The bioplasts of Cordyceps sinensis were treated with lytic enzyme solution, combined with the PEG-CaCl2-mediated genetic transformation system, and hygromycin B was used as a resistance marker for screening to establish the genetic transformation system of Cordyceps sinensis.

Benefits of technology

A genetic transformation system for Xuefeng Cordyceps was successfully constructed, gene knockout or overexpression experiments were realized, the functions of specific genes in the development of fruiting bodies were explored, and the bottleneck problem of molecular breeding of Xuefeng Cordyceps was solved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120775892A_ABST
    Figure CN120775892A_ABST
Patent Text Reader

Abstract

The invention discloses a method for establishing a genetic transformation system of Cordyceps snowpeak. Belongs to the technical field of microbial genetic transformation. The invention provides a construction method of a PEG-CaCl2 mediated genetic transformation system for preparation of Cordyceps snowpeak protoplast and a screening system with hygromycin B as a resistance marker. The hph gene of the hygromycin B is successfully transformed into the Cordyceps snowpeak fungus by PEG mediation, and the target gene can still be detected after transformants are transferred for four generations, which indicates that a genetic transformation system is successfully constructed. Through genetic transformation, the specific function and mechanism of the specific gene in the development process of the sporocarp of the Cordyceps snowfeng can be explored through gene knockout or overexpression experiments.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial genetic transformation, and more particularly to a method for establishing a genetic transformation system of Ophiocordyceps xuefengensis. BACKGROUND

[0002] Ophiocordyceps xuefengensis is a new Cordyceps medicinal resource discovered in the fourth national survey of traditional Chinese medicine resources in Hunan Province, China, and is also a new species of Cordyceps fungi. It has antioxidant and antitumor activities and is the most promising Cordyceps resource with high research value. Ophiocordyceps xuefengensis uses fruiting bodies as the harvested product, and the formation and development of the fruiting bodies directly determine the yield and quality. At present, Ophiocordyceps xuefengensis has been artificially cultivated, but it still faces problems such as low yield and long cultivation period. Molecular improvement is an effective way to directionally breed Ophiocordyceps xuefengensis varieties with high yield and high quality fruiting bodies. In recent years, the rapid development of gene editing technology has provided strong technical support for the research on gene function and efficient directional genetic breeding of Cordyceps fungi.

[0003] Molecular breeding of Cordyceps usually takes the establishment of a stable and efficient genetic transformation system as a prerequisite. Since the discovery of Ophiocordyceps xuefengensis, research has mainly focused on active ingredients, and molecular research has been slow. The lack of understanding of the regulatory mechanisms of Ophiocordyceps xuefengensis fruiting body development has limited the progress of molecular genetic breeding of fruiting body yield. Current mechanism research mainly involves editing functional genes for observation, and the most commonly used methods are Agrobacterium-mediated transformation and protoplast-mediated transformation. However, Ophiocordyceps xuefengensis has difficulty producing spores on artificial media, making it difficult to use Agrobacterium-mediated spore transformation. PEG-mediated protoplast transformation has become a major method for microbial genetic transformation due to its simple operation. Patent CN114958898B discloses a method for preparing and genetically transforming C. cajanum protoplasts, but the inventors found that genetic transformation of Ophiocordyceps xuefengensis using this method did not successfully obtain transformants. On the one hand, Ophiocordyceps xuefengensis has difficulty producing spores on plates, and liquid culture forms large mycelial balls, making it difficult to prepare protoplasts. On the other hand, antibiotic selection during the later transformation process cannot obtain transformants. Therefore, researchers in the field have not been able to successfully establish a genetic transformation method for Ophiocordyceps xuefengensis.

[0004] In summary, how to provide a method for establishing a genetic transformation system of Ophiocordyceps xuefengensis is a problem that needs to be solved by those skilled in the art. SUMMARY

[0005] Therefore, the present application provides a method for establishing a genetic transformation system of Ophiocordyceps xuefengensis.

[0006] To achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0007] A method for establishing a genetic transformation system of Ophiocordyceps chui, comprising the following steps:

[0008] (1) Preparation of protoplasts: After activation and culture of Ophiocordyceps chui, the protoplasts are treated with lytic enzyme solution, then rinsed, filtered and centrifuged;

[0009] The culture medium used in the culture is PDP liquid culture or PY liquid culture medium;

[0010] The lytic enzyme solution comprises lysozyme and snailase;

[0011] (2) Protoplast transformation: PEG-CaCl2 mediated genetic transformation system is used for transformation.

[0012] Further, the specific operation of step (1) is:

[0013] (11) After activation, Ophiocordyceps chui is inoculated into PDP liquid culture or PY liquid culture medium, and cultured at 20-30℃, 100-150rpm for 3-7 days;

[0014] (12) Ophiocordyceps chui is mixed with lytic enzyme solution, and the mass / volume ratio of the two is (450-550):(4-6) mg / mL, then enzymolysis at 32-35℃ for 3-5h;

[0015] (13) After enzymolysis, S1 buffer solution is used for rinsing, then filtering and centrifuging.

[0016] Further,

[0017] The components of the PDP liquid culture medium include: potato 200g / L, glucose 20g / L, peptone 3g / L and KH2PO41g / L;

[0018] The components of the PY liquid culture medium include: glucose 15g / L, peptone 5g / L, yeast powder 2g / L, KH2PO41g / L and MgSO4·7H2O 0.5g / L.

[0019] Further, the lytic enzyme solution comprises lysozyme, snailase and S1 buffer solution, and the mass / volume ratio of the three is 0.1g:0.1g:10mL;

[0020] The components of the S1 buffer solution include mannitol 145.72g / L.

[0021] Further, the specific operation of step (2) is:

[0022] (21) Dilute the Ophiocordyceps chui protoplasts to obtain a protoplast suspension solution;

[0023] (22) adding the hygromycin expression cassette to the protoplast suspension solution, and placing on ice for 5 min to obtain a first transformation solution;

[0024] (23) slowly adding the S3 buffer drop by drop, mixing, and placing on ice for 30 min to obtain a second transformation solution;

[0025] (24) continuously adding the S3 buffer, placing at room temperature for 5 min, continuously adding the S2 buffer, and mixing to obtain a third transformation solution;

[0026] (25) adding the TB3 liquid medium to the third transformation solution for overnight recovery culture, centrifuging, and resuspending to obtain a recovery transformation solution;

[0027] (26) culturing the recovery transformation solution in a screening medium, and the content of hygromycin B in the screening medium is 150 μg / mL.

[0028] Further,

[0029] In the step (21), the protoplasts of the O. xuei are diluted to 10 7 cells / mL;

[0030] In the step (22), the volume ratio of the protoplast suspension solution of the O. xuei to the hygromycin expression cassette is 20:1;

[0031] The volume ratio of the protoplast suspension solution of the O. xuei, the S3 buffer of the step (25), and the TB3 liquid medium of the step (26) is 1:5:25;

[0032] In the step (26), the volume ratio of the recovery transformation solution to the screening medium is (1-2):30.

[0033] Further, each 50 mL of the S3 buffer includes:

[0034] 12.5 g of PEG 4000, 0.5 mL of 1M Tirs-HCl (pH 7.5), and 1.25 mL of 1M CaCl2.

[0035] Further, each 100 mL of the S2 buffer includes:

[0036] 10.93 g of mannitol, 1 mL of 1M Tirs-HCl (pH 7.5), and 2.5 mL of 1M CaCl2.

[0037] Further, the components of the TB3 liquid medium include: 109.3 g / L of mannitol, 3 g / L of yeast powder, 3 g / L of acid hydrolyzed casein, and 20 g / L of sucrose.

[0038] Via the technical solution, compared with the prior art, the present application has the beneficial effects of:

[0039] The present application provides a method for preparing protoplasts of O. fimbriatum and constructing a PEG-CaCl2 mediated genetic transformation system, and a screening system using hygromycin B as a resistance marker; the hph gene of hygromycin B is successfully transformed into O. fimbriatum by PEG mediation, and the transformant can still detect the target gene after 4 generations of transfer, indicating that the genetic transformation system has been successfully constructed. Through genetic transformation, the specific function of specific genes in the development process of O. fimbriatum fruiting body and the development mechanism of fruiting body can be explored through gene knockout or overexpression experiments. BRIEF DESCRIPTION OF DRAWINGS

[0040] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are only embodiments of the present application, and those skilled in the art can obtain other drawings according to the provided drawings without creative labor.

[0041] Figure 1 The growth of O. fimbriatum in PDP liquid medium in Example 1 of the present application;

[0042] Figure 2 The preparation of O. fimbriatum protoplasts in Example 1 of the present application;

[0043] Figure 3 The growth of O. fimbriatum in PY liquid medium in Example 2 of the present application;

[0044] Figure 4 The preparation of O. fimbriatum protoplasts in Example 2 of the present application;

[0045] Figure 5 The growth of O. fimbriatum transformants in Example 3 of the present application;

[0046] Figure 6 The growth of O. fimbriatum transformants in Example 4 of the present application;

[0047] Figure 7 The electrophoresis result chart of the hph gene of hygromycin B in the PCR detection of O. fimbriatum transformants in Example 5 of the present application, wherein 1 represents the hph positive control, 2-7 represent the transformed strains, and 8 represents the O. fimbriatum negative control;

[0048] Figure 8Growth of wild strain (1) and transformed strains (2, 5) after four generations of continuous dark culture of X. chongii transformed with the hph gene fragment in Example 5 of the present application on a selection medium containing 150 μg / mL hygromycin B;

[0049] Figure 9 Growth of X. chongii in PDA liquid medium (A) and preparation of protoplasts (B) in Comparative Example 1 of the present application;

[0050] Figure 10 Growth of X. chongii mycelium in Comparative Example 2 of the present application, wherein A represents the result of changing the composition of PDP liquid medium, and B represents the result of changing the composition of PY liquid medium;

[0051] Figure 11 Preparation of X. chongii protoplasts in Comparative Example 3 of the present application, wherein A represents the result of changing the amount of enzyme, B represents the result of not adding lywallase, and C represents the result of adding lyticase;

[0052] Figure 12 Preparation of X. chongii protoplasts in Comparative Example 4 of the present application, wherein A represents the result of omitting the rinsing step, and B represents the result of changing the centrifugation parameters;

[0053] Figure 13 Failure of transformation of X. chongii in Comparative Example 5 of the present application, wherein A represents the result of changing the amount, B represents the result of omitting the step of adding 50 μL of S3 buffer, C represents the result of changing the operation temperature, and D represents the result of omitting the resuscitation culture step;

[0054] Figure 14 Failure of transformation of X. chongii in Comparative Example 6 of the present application;

[0055] Figure 15 Failure of transformation of X. chongii in Comparative Example 7 of the present application;

[0056] Figure 16 Failure of transformation of X. chongii in Comparative Example 8 of the present application, wherein A represents the result of plate screening, B represents the result of electrophoresis of the hph gene of hygromycin B detected by PCR, 1 represents a hph positive control, 2-11 represent transformed strains, and 12 represents a X. chongii negative control. DETAILED DESCRIPTION

[0057] The technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of the present application.

[0058] The required agents of the present application are conventional experimental agents, which are purchased from the market; the experimental methods not mentioned are conventional experimental methods, which are not described here.

[0059] The Xuefengchong used in the following examples is named X-1, which is classified as Ophiocordyceps xuefengensis, and was preserved in China General Microbiological Culture Collection Center on August 10, 2015, with the preservation number of CGMCC No. 11107 and the preservation address of No. 3, Beichen West Road, Chaoyang District, Beijing.

[0060] The PDA solid culture medium is composed of 200 g of potato, 20 g of glucose, 15 g of agar powder, and distilled water to 1000 mL, which is obtained by high pressure sterilization at 121 ℃;

[0061] The PDA liquid culture medium is composed of 200 g of potato and 20 g of glucose, and distilled water to 1000 mL, which is obtained by high pressure sterilization at 121 ℃;

[0062] The PDP liquid culture medium is composed of 200 g of potato, 20 g of glucose, 3 g of peptone, and 1 g of KH2PO4, and distilled water to 1000 mL, which is obtained by high pressure sterilization at 121 ℃;

[0063] The PY liquid culture medium is composed of 15 g of glucose, 5 g of peptone, 2 g of yeast powder, 1 g of KH2PO4, and 0.5 g of MgSO4·7H2O, and distilled water to 1000 mL, which is obtained by high pressure sterilization at 121 ℃;

[0064] The S1 buffer is composed of 36.43 g of mannitol and distilled water to 250 mL, and the pH is adjusted to 4.5, which is obtained by high pressure sterilization at 121 ℃;

[0065] The S2 buffer is composed of 10.93 g of mannitol, 1 mL of 1M Tirs-HCl, 2.5 mL of 1M CaCl2, and distilled water to 100 mL, and the pH is adjusted to 7.5, which is obtained by high pressure sterilization at 121 ℃;

[0066] The S3 buffer is composed of 12.5 g of PEG 4000, 0.5 mL of 1M Tirs-HCl, 1.25 mL of 1M CaCl2, and distilled water to 50 mL, and the pH is adjusted to 7.5, which is obtained by high pressure sterilization at 121 ℃;

[0067] The TB3 solid culture medium is composed of 109.3 g of mannitol, 3 g of yeast powder, 3 g of acid hydrolysis casein, 20 g of sucrose, and 8 g of agarose, and distilled water to 1000 mL, which is obtained by high pressure sterilization at 121 ℃;

[0068] TB3 liquid medium composition: mannitol 109.3 g, yeast powder 3 g, acid hydrolysis casein 3 g, sucrose 20 g, distilled water to 1000 mL, 121 ℃ high pressure sterilization to obtain.

[0069] Example 1

[0070] Preparation of Ophiocordyceps xuefengensis protoplasts

[0071] (1) Preparation of Ophiocordyceps xuefengensis mycelium: Ophiocordyceps xuefengensis was inoculated on PDA solid medium and dark incubated at 28℃ for 14 days; wild type Ophiocordyceps xuefengensis blocks (0.5 cm x 0.5 cm) with good growth on the PDA solid medium were inoculated into a flask containing PDP liquid medium, and incubated at 25℃, 130 rpm in a constant temperature dark incubator for 5 days to form mycelial pellets of similar size.

[0072] (2) Preparation of lytic enzyme solution: 0.1 g of lywallzyme and snailase were weighed and added to 10 mL of S1 buffer until completely dissolved, and then filtered with a 0.22 μm microporous water filter to remove bacteria for standby.

[0073] (3) The Ophiocordyceps xuefengensis mycelial pellets in step (1) were filtered with a sterile Buchner funnel, and 500 mg of Ophiocordyceps xuefengensis mycelial pellets were weighed into a 10 mL sterile centrifuge tube, and 5 mL of filtered lytic enzyme solution was added, and the mycelial pellets were enzymatically digested in a constant temperature water bath at 34℃ for 4 h to achieve most of the lysis of the mycelial pellets.

[0074] (4) A new 50 mL sterile centrifuge tube was taken, a small amount of S1 buffer was added, and the lysed mycelial pellets in step (3) were thoroughly rinsed in the S1 buffer with a 5 mL pipette, and the mycelial pellets were washed as much as possible to disperse, and then mixed by blowing with a gun, and then filtered with a sterile funnel wrapped with 4 layers of lens paper (on ice), and centrifuged at 4000 rpm for 10 min, and the supernatant was discarded to obtain Ophiocordyceps xuefengensis protoplasts.

[0075] (5) Pre-cooled S2 buffer was added for resuspension, centrifuged at 4000 rpm for 10 min, and the supernatant was discarded, and a hemocytometer was used for counting.

[0076] The growth of Ophiocordyceps xuefengensis in PDP liquid medium is shown in Figure 1 , and it was found that Ophiocordyceps xuefengensis grew well in PDP liquid medium without forming large mycelial pellets.

[0077] The hemocytometer was used for counting, and the preparation of protoplasts was observed, as shown in Figure 2 , the Ophiocordyceps xuefengensis mycelium prepared in PDP liquid medium can be used to successfully prepare Ophiocordyceps xuefengensis protoplasts.

[0078] Example 2

[0079] Preparation of Xuefengchungrhizopus Vagans Protoplasts

[0080] In step (1), the PDP liquid medium was replaced with PY liquid medium, and the rest of the operations were the same as in Example 1.

[0081] The growth of Xuefengchungrhizopus vagans under PY liquid medium was as shown in Figure 3 The results showed that the growth of Xuefengchungrhizopus vagans was better under PY liquid medium, and small regular-shaped pellets and part of mycelium were formed, rather than large pellets.

[0082] Counting was performed using a hemocytometer, and the preparation of protoplasts was observed, as shown in Figure 4 The mycelium of Xuefengchungrhizopus vagans prepared under PY liquid medium can be used to successfully prepare Xuefengchungrhizopus vagans protoplasts, and more protoplasts were prepared from Xuefengchungrhizopus vagans cultured under PY liquid medium compared to Example 1. This is mainly because it is easier to form mycelium rather than large pellets under PY liquid medium, which is more conducive to the release of protoplasts under the same enzymolysis conditions.

[0083] Example 3

[0084] Transformation of Xuefengchungrhizopus vagans Protoplasts

[0085] (1) Preparation of a hygromycin expression cassette: The hygromycin expression cassette used was obtained by amplification of k-hph-P15A plasmid. The construction of the k-hph-P15A plasmid is described in Efficient production and evaluation of lignocellulolytic enzymes using a constitutive protein expression system in Penicillium oxalicum.

[0086] (2) Dilute the Xuefengchungrhizopus vagans protoplasts prepared in Example 1 to 10 7 protoplasts / mL using S2 buffer to obtain a protoplast suspension solution.

[0087] (3) Dispense 200 μL of the protoplast suspension solution into a 50 mL sterile centrifuge tube, slowly add 10 μL of the hygromycin expression cassette (concentration > 150 ng / μL), mix gently, and place on ice for 5 min to obtain a first transformation solution.

[0088] (4) Slowly add 50 μL of S3 buffer dropwise, mix gently, and place on ice for 30 min to obtain a second transformation solution.

[0089] (5) Continue to add 1 mL of S3 buffer along the wall of the tube, and place at room temperature for 5 min. Continue to add 2 mL of S2 buffer, mix well, and obtain a third transformation solution.

[0090] (6) Add 5 mL of TB3 liquid culture medium to the third transformation solution, incubate at 28°C overnight for recovery, centrifuge, and resuspend in 1-2 mL of TB3 liquid culture medium to obtain a recovery transformation solution.

[0091] (7) Add the above-mentioned resuscitation transformation solution to 30 mL of TB3 solid medium (containing 150 μg / mL hygromycin B) preheated to about 50°C and gently shake to mix. After blowing for 2 hours, seal the plate with sealing film and place it in a constant temperature incubator at 28°C. Incubate in the dark for 6 to 7 days and observe the growth of the transformants.

[0092] like Figure 5 As shown, when the concentration of hygromycin B was 150 μg / mL, the transformants of Cordyceps sinensis were successfully obtained.

[0093] Example 4

[0094] Xuefeng Cordyceps bioplast transformation

[0095] In step (2), protoplast is the protoplast prepared in Example 2, and all the other operations are the same as in Example 3.

[0096] like Figure 6 As shown, the Xuefeng Cordyceps transformants were successfully obtained.

[0097] Example 5

[0098] PCR detection of transformants of Cordyceps sinensis and analysis of genetic stability of transformed strains

[0099] (1) The transformants of Cordyceps sinensis obtained in Example 4 were further screened by picking single colonies with an inoculation spatula on a TB3 solid culture medium plate containing hygromycin resistance (150 μg / mL hygromycin B) and culturing at 28° C. for 7 days until possible positive transformants grew.

[0100] (2) PCR amplification of the target gene (the hph gene of hygromycin B): Using the total genomic DNA of the transformant strain and the wild strain of Cordyceps sinensis in step (1) as templates, PCR amplification of the above genome was performed using the primer pair (Hph-YZ-PF: CGACGTTAACTGATATTGAAGGAGC, SEQ ID No. 1; Hph-YZ-PR: CAACCCAGGGGCTGGTGACGGAATTTTCAT, SEQ ID No. 2). The amplified fragment length was 2 kb. The PCR amplification system is shown in Table 1.

[0101] Table 1 PCR amplification system

[0102]

[0103] (3) The PCR amplification reaction procedure was as follows: preheating at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 2 min (extension rate: 1 kb / min), 32 cycles; and complete extension at 72°C for 5 min.

[0104] (4) After 1% agarose electrophoresis, it was found that the hph gene could be detected in all transformant strains, and the hph gene had been successfully transferred into the Xuefeng Cordyceps sinensis, indicating that the genetic transformation system was successfully constructed ( Figure 7 ).

[0105] (5) 1 cm × 1 cm bacterial blocks of transformants No. 2 and No. 5 with significant electrophoresis bands in step (4) were picked, rinsed with 0.9% saline, and evenly spread on a screening medium containing 150 μg / mL hygromycin B. The culture was carried out at 25°C for 7 to 15 days, and the cells were subcultured in the dark for 4 times to detect the genetic stability of the transformants.

[0106] like Figure 8 As shown in Figure 2, regenerated colonies can still be seen in the transformant after culturing for 4 generations ( Figure 8 2, 5), after the hph gene was inserted, the morphology of the hyphae did not change, while no fresh colonies grew on the control plate (wild Xuefeng Cordyceps strain block) ( Figure 8 Number 1).

[0107] Comparative Example 1

[0108] In step (1), the PDP liquid culture medium was replaced with the PDA liquid culture medium, and the remaining operations were the same as in Example 1.

[0109] like Figure 9 As shown, using PDA liquid culture medium, Xuefeng Cordyceps formed larger fungus balls ( Figure 9 A), only a very small amount of protoplast release can be seen in the microscope field ( Figure 9 B) This is because the bacterial pellet is difficult to lyse, resulting in low efficiency in preparing protoplasts.

[0110] Comparative Example 2

[0111] The preparation of Xuefeng Cordyceps mycelium was performed by omitting the addition of glucose to the PDP liquid culture medium in step (1) and replacing KH2PO4 with 0.5 g. The remaining operations were the same as those in Example 1.

[0112] The preparation of Xuefeng Cordyceps mycelium was carried out by replacing the glucose in the PY liquid culture medium components in step (1) with 10 g, KH2PO4 with 0.5 g, and MgSO4·7H2O with 0.3 g. The remaining operations were the same as those in Example 2.

[0113] like Figure 10As shown, under the two conditions, the fungus hardly grows, and the Xuefeng Cordyceps fungus cannot be obtained, resulting in the inability to prepare the Xuefeng Cordyceps bioplast.

[0114] Comparative Example 3

[0115] The amounts of lytic enzyme and helicase in step (2) were both changed to 0.05 g, and the remaining operations were the same as in Example 2.

[0116] In step (2), no lytic enzyme was added, only 0.1 g of snail enzyme was added, and the rest of the operation was the same as in Example 2.

[0117] The enzyme in step (2) was replaced with Sigma-Aldrich lyase (Cat. No. L4025) to a final concentration of 25 U. The remaining operations were the same as in Example 2.

[0118] like Figure 11 As shown, under the above conditions, most of the cells are still in the bacterial state under the microscope, and the cell wall is not lysed. It is almost impossible to prepare protoplasts and cannot be used for subsequent transformation.

[0119] Comparative Example 4

[0120] The step of rinsing the mycelia with S1 buffer in step (4) was omitted, and the mixture was directly filtered with lens paper, centrifuged and the supernatant was discarded. The remaining operations were the same as those in Example 2.

[0121] The centrifugation conditions in steps (4) and (5) were changed to 2500 rpm for 5 min, and the remaining operations were the same as in Example 2.

[0122] like Figure 12 As shown, only a very small amount of protoplasts can be obtained and cannot be used for subsequent transformation.

[0123] Comparative Example 5

[0124] The amount of the protoplast suspension solution in step (3) was changed to 100 μL, the concentration of the hygromycin expression cassette was changed to 100 ng / μL, and the remaining operations were the same as in Example 4.

[0125] The step of adding 50 μL of S3 buffer in step (4) was omitted, and the mixture was directly ice-bathed for 30 min. The remaining operations were the same as those in Example 4.

[0126] In step (5), the room temperature for 5 min was replaced with an ice bath for 5 min, and the remaining operations were the same as in Example 4.

[0127] The step of adding TB3 liquid culture medium and overnight recovery culture at 28°C in step (6) was omitted, and the remaining operations were the same as in Example 4.

[0128] like Figure 13 As shown, no Xuefeng Cordyceps transformants were obtained.

[0129] Comparative Example 6

[0130] In step (7), the concentration of hygromycin B was changed to 600 μg / mL, and the remaining operations were the same as in Example 4.

[0131] like Figure 14 As shown in the figure, after 7 days of culture, there was no growth of transformants on the regeneration plate. The culture time was extended to 14 days, and there was still no growth of transformants. We speculated that at a concentration of 600 μg / mL hygromycin B, although the protoplasts recovered in the regeneration medium for one night, they were still in a fragile state and could not tolerate high antibiotic concentrations.

[0132] Comparative Example 7

[0133] In step (7), the concentration of hygromycin B was changed to 400 μg / mL, and the remaining operations were the same as in Example 4.

[0134] like Figure 15 As shown, there was still no growth of transformants.

[0135] Comparative Example 8

[0136] In step (7), the concentration of hygromycin B was changed to 100 μg / mL, and the remaining operations were the same as in Example 4 to obtain Xuefeng Cordyceps transformants.

[0137] The PCR detection steps for the Xuefeng Cordyceps transformants are the same as those in Example 5.

[0138] The results are as follows Figure 16 , different from Comparative Examples 6 and 7, more transformants grew in this comparative example ( Figure 16 A). However, the above transformants were selected for PCR verification, and the electrophoresis results did not detect the presence of the hph gene ( Figure 16 B, No. 2 to No. 11), the hph gene was not successfully transferred into the Xuefeng Cordyceps sinensis, indicating that a large number of false positive transformants would be obtained at a screening concentration of 100 μg / mL hygromycin B.

[0139] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0140] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for establishing a genetic transformation system of Xuefeng Cordyceps sinensis, characterized in that: The steps include: (1) Preparation of protoplasts: After activation and culture, the Xuefeng Cordyceps sinensis is treated with a lytic enzyme solution, followed by rinsing, filtration, and centrifugation; The culture medium used is PDP liquid culture or PY liquid culture medium; The lytic enzyme solution includes wall lytic enzyme and snail enzyme; (2) Protoplast transformation: Transformation was performed using a PEG-CaCl2-mediated genetic transformation system.

2. The method according to claim 1, wherein The specific operations of step (1) are: (11) Activating the Xuefeng Cordyceps sinensis and inoculating it into PDP liquid culture medium or PY liquid culture medium, and culturing it at 20-30°C and 100-150 rpm for 3-7 days; (12) Mix the Xuefeng Cordyceps sinensis with the lytic enzyme solution at a mass volume ratio of (450-550): (4-6) mg / mL, and then enzymatically hydrolyze at 32-35°C for 3-5 h; (13) After enzymatic hydrolysis, rinse with S1 buffer, filter, and centrifuge.

3. The method according to claim 2, wherein The PDP liquid culture medium components include: 200 g / L potato, 20 g / L glucose, 3 g / L peptone and 1 g / L KH2PO4; The PY liquid culture medium components include: 15 g / L glucose, 5 g / L peptone, 2 g / L yeast powder, 1 g / L KH2PO4 and 0.5 g / L MgSO4·7H2O.

4. The method according to claim 2, wherein The lysing enzyme solution includes lytic enzyme, snail enzyme and S1 buffer, and the mass volume ratio of the three is 0.1g:0.1g:10mL; The components of the S1 buffer include 145.72 g / L of mannitol.

5. The method according to claim 1, wherein The specific operations of step (2) are: (21) diluting the Xuefeng Cordyceps protoplasts to obtain a protoplast suspension solution; (22) Add the hygromycin expression cassette to the protoplast suspension solution and place on ice for 5 min to obtain the first transformation solution; (23) S3 buffer was slowly added dropwise, mixed, and placed on ice for 30 min to obtain the second transformation solution; (24) Continue to add S3 buffer, let it stand at room temperature for 5 min, continue to add S2 buffer, mix well, and obtain the third transformation solution; (25) adding TB3 liquid medium to the third transformation solution for overnight recovery culture, centrifuging, and resuspending to obtain a recovery transformation solution; (26) The revived transformation solution is subjected to screening culture, and the content of hygromycin B in the screening culture medium is 150 μg / mL.

6. The method according to claim 5, wherein In the step (21), the Xuefeng Cordyceps bioplast is diluted to 10 7 / mL; In the step (22), the volume ratio of the Xuefeng Cordyceps bioplast suspension solution to the hygromycin expression cassette is 20:1; The volume ratio of the Xuefeng Cordyceps bioplast suspension solution, the S3 buffer of step (25) and the TB3 liquid culture medium of step (26) is 1:5:25; In the step (26), the volume ratio of the recovery transformation solution to the screening culture medium is (1-2):

30.

7. The method according to claim 5, wherein The S3 buffer comprises the following components in mass concentration: 25% PEG4000, 10 mM Tirs-HCl and 25 mM CaCl2, pH adjusted to 7.

5.

8. The method according to claim 5, wherein The S2 buffer comprises the following components in mass concentration: 0.6 M mannitol, 10 mM Tirs-HCl and 25 mM CaCl2, pH adjusted to 7.

5.

9. The method according to claim 5, wherein The TB3 liquid culture medium comprises: 109.3 g / L mannitol, 3 g / L yeast powder, 3 g / L acid hydrolyzed casein and 20 g / L sucrose.

Citation Information

Patent Citations

  • Method for artificially cultivating xuefengensis

    CN103340091A

  • Artificial cultivation of cordyceps militaris

    CN106818206A

  • Cordyceps guangdongensis protoplast preparation and recovery method

    CN109943490A

  • Application of artificially-cultivated Ophiocordyceps xuefengensis in preparation of antitumor drugs

    CN113143976A

  • PEG4000-mediated cordyceps guangdongensis protoplast transformation method and application

    CN115747245A