Functional molecular marker of white seed coat regulatory gene AhbHLH-2A / 2B of peanut powder and application of functional molecular marker

Abstract

The invention relates to a functional molecular marker for white seed coat characters of peanut powder and application, and belongs to the field of molecular biology. The method comprises the following steps: carrying out BSA (Bovine Serum Albumin) analysis on a recombinant inbred line group taking far hybrid 9102 and Tifrunner as parents by constructing a mixed pool, and positioning two major QTLs linked with the character of the pink white seed coat; two candidate genes AhbHLH-2A and AhbHLH-2B are screened by analyzing a family genotype recombination unit of an RIL group, and the genes are knocked out from peanuts, so that the functions of the genes are verified. According to the present invention, two groups of KASP primers (A02.97750456 and A12.113996432) are developed according to the difference of the genome sequence for regulating the white seed coat of the peanut powder, and the authenticity and the linkage of the InDel site of the A02.97750456 and the SNP site of the A12.113996432 are verified in the "far hybrid 9102 * Tifrunner" RIL population and the germplasm resource material, and the molecular marker can rapidly and accurately obtain the white seed coat character of the peanut powder, and can be used in the peanut molecule-assisted marker breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to a functional molecular marker of peanut pink seed coat regulating gene AhbHLH-2A / 2B and application thereof, and belongs to the field of molecular biology. BACKGROUND

[0002] Cultivated peanuts are important oil crops. Peanut seed coat covers the kernel, protecting it from physical damage and microbial invasion. Seed coat color is a key agronomic trait affecting the nutritional quality and market value of peanuts. Peanut seed coat color usually has five main types: white, brown (yellow-brown), pink, red, and purple (black). Compared with colored seed coat peanuts, white seed coat peanuts lack flavor but have obvious advantages in certain uses, such as use in food and beverages. In addition, white seed coat varieties can also improve processing efficiency and reduce peeling (bleaching) costs. Therefore, cultivating white seed coat peanuts has important economic value and market potential.

[0003] Since peanut seed coat is developed from the endodermis cells of the maternal plant, its genotype is the same as that of the maternal plant, but it may be different from the genotype of the peanut kernel. In peanut hybridization breeding and DUS (Distinctness, Uniformity, and Stability) testing, the segregation of seed coat color is a common challenge. Therefore, understanding the genetic mechanism of seed coat color is crucial in peanut breeding and production.

[0004] In terms of genetic research, some studies have obtained QTL sites related to the white peanut seed coat phenotype. For example, by analyzing differentially expressed genes (DEGs), some genes such as Araip.M7RY3 (COP9 signal complex subunit 1), Aradu.R8PMF (MYB transcription factor), and Araip.MHR6K (bHLH transcription factor) are considered to be related to the characteristics of white seed coat. However, current research has not yet obtained genes or functional molecular markers that regulate white seed coat, and further in-depth research is still needed.

[0005] Competitive allele-specific PCR (KASP) is a new genotyping technology based on single nucleotide polymorphism (SNP), which can accurately genotype SNP and insertion-deletion (InDel) polymorphisms at the genomic level, and is widely used in plant, animal, and human medical research. Therefore, developing KASP molecular markers based on the QTL or mutation site of the target gene of peanut pink seed coat can be applied in peanut breeding. SUMMARY

[0006] In view of the deficiencies of the prior art, the present application provides a functional molecular marker of peanut pink seed coat regulating gene AhbHLH-2A / 2B and application thereof.

[0007] To achieve the above object, the technical scheme adopted by the present application is:

[0008] The functional molecular marker A02.97750456 and A12.113996432 of the white seed coat trait of peanut powder, the molecular marker site is an SNP / InDel insertion and deletion marker, and the sequence in the square brackets is the sequence of the site;

[0009] A02.97750456 is an InDel insertion and deletion marker, located at 97,750,456 bp of peanut chromosome 2, and the 100 bp sequences before and after the site are SEQ ID NO. 1 or SEQ ID NO. 2;

[0010] A12.113996432 is an SNP marker, located at 113,996,432 bp of peanut chromosome 12, and the 100 bp sequences before and after the site are SEQ ID NO. 6 or SEQ ID NO. 7.

[0011] The KASP primer set for amplifying the functional molecular marker comprises:

[0012] The KASP primer set for amplifying the A02.97750456 molecular marker site comprises:

[0013] Pinkish-whiteA02_F1: 5'-AGACGAGCTGAGTGCAAACCAA-3'(SEQ ID NO. 3),

[0014] Pinkish-whiteA02_F2: 5'-GACGAGCTGAGTGCAAACCAC-3'(SEQ ID NO. 4),

[0015] Pinkish-whiteA02_com: 5'-GGACAAGTGATCTTAGGATGATGAA-3'(SEQ ID NO. 5);

[0016] The KASP primer set for amplifying the A12.113996432 molecular marker site comprises:

[0017] Pinkish-whiteA12_F1: 5'-TACCTGGTAGTTGAACTTGGAGTTG-3' (SEQ ID NO. 8), Pinkish-whiteA12_F2: 5'-TACCTGGTAGTTGAACTTGGAGTTA-3' (SEQ ID NO. 9), Pinkish-whiteA12_com: 5'-CCGTTACCGAAGCAGATAATCAT-3' (SEQ ID NO. 10).

[0018] The method for identifying the color of peanut seed coat by using the functional molecular marker comprises the following steps:

[0019] (1) Extracting the DNA of the peanut sample to be identified, using the KASP primer set to detect the genotype data of the peanut sample to be identified, and performing genotyping on the InDel site of A02.97750456 and the SNP site of A12.113996432 of the peanut sample to be identified by the SNPLine genotyping platform;

[0020] (2) If the genotyping result of the InDel site of A02.97750456 is the mutant type Del:Del, and the SNP site of A12.113996432 is the mutant type T:T, then the color of the seed coat of the peanut sample is pink white;

[0021] If only the genotyping result of the InDel site of A02.97750456 is the mutant type Del:Del, or only the SNP site of A12.113996432 is the mutant type T:T, then the color of the seed coat of the peanut sample is pink or red.

[0022] The application of the molecular marker of the peanut pink white seed coat trait in the identification of the color of peanut seed coat.

[0023] The application of the molecular marker of the peanut pink white seed coat trait in peanut molecular breeding.

[0024] Advantages of the present application

[0025] (1) The application utilizes the recombinant inbred line population with Farjia 9102 and Tifrunner as parents, selects the pinkish-white seed coat family and the red seed coat family to construct a pool, and obtains the QTL interval linked to the pinkish-white seed coat trait on chromosomes 2 and 12 through BSA analysis. Based on the difference sites of the two parents in the preliminary positioning interval, KASP molecular markers are developed for fine mapping, and two major QTLs are located, which are qPinkish-whiteA02 and qPinkish-whiteA12. The marker most linked to qPinkish-whiteA02 is A02.97750456, with a LOD value of 12.77, and the phenotype variation explanation rate is 19.2%; the marker most linked to qPinkish-whiteA12 is A12.113996432, with a LOD value of 11.94, and the phenotype variation explanation rate is 18.1%.

[0026] (2) The genotypes of 276 families of the RIL population are analyzed by recombination unit, and it is found that the pinkish-white seed coat trait is simultaneously regulated by two QTLs qPinkish-whiteA02 and qPinkish-whiteA12, and the probability of the candidate genes of the two QTLs being homologous genes is higher because peanuts are allogeneic tetraploid crops. Based on the condition that the homologous genes in the recombination unit of the two QTLs simultaneously have a sense mutation site on the exon, the candidate genes are finally determined as arahy.MP3D3D (AhbHLH-2A) and arahy.26781N (AhbHLH-2B), and the two genes are bHLH transcription factors.

[0027] (3) By constructing a CRISPR-Cas9 gene editing vector to transform peanuts Yuhua 9326, the seed coat color of the transgenic strain with simultaneous mutation of AhbHLH-2A and AhbHLH-2B changes from pink to pinkish-white, which further proves that the two genes regulate the pinkish-white seed coat trait.

[0028] (4) Experiments prove that the two markers A02.97750456 and A12.113996432 are located on the exons of the two candidate genes, and the two markers are functional molecular markers for the pinkish-white seed coat trait of peanuts, which can quickly and accurately obtain the pinkish-white seed coat trait of peanuts and can be applied to peanut molecular assisted marker breeding. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 QTL positioning results of the pinkish-white seed coat trait on linkage groups LG02 and LG12;

[0030] Figure 2 Recombination unit analysis of qPinkish-whiteA02 and qPinkish-whiteA12 in the RIL population;

[0031] Figure 3 Mutant type and location information of AhbHLH-2A / 2B gene of two parents;

[0032] Figure 4 Genotype mutation information and seed coat phenotype of CRISPR / Cas9 gene editing positive plants;

[0033] Figure 5 KASP genotyping results of InDel site of A02.97750456 and SNP site of A12.113996432. DETAILED DESCRIPTION

[0034] The specific embodiments of the present application are further described in detail below in conjunction with the examples. Unless otherwise specified, the instruments and equipment in the examples are conventional instruments and equipment, the reagents are commercially available conventional reagents, and the test methods are conventional methods.

[0035] Example 1, Obtaining of major QTL of peanut powder white seed coat trait

[0036] 1.1 BSA analysis of peanut seed coat trait

[0037] The "Yuzacai 9102 x Tifrunner" recombinant inbred line (RIL) population has 276 families, of which 35 families are powder white seed coat, 50 families are red seed coat, and the remaining 191 families are pink seed coat. The mixed pool is constructed for the powder white seed coat families and the red seed coat families, respectively, and the whole genome resequencing is performed on the mixed pool and the parents, with a sequencing depth of more than 20x. With the cultivated peanut genome information (Arachis hypogaea.cv.Tifrunner V2.0) as the reference, the mixed pool separation analysis (BSA analysis) is performed on the genotyping data of the parents and the mixed pool.

[0038] Using four algorithms of Δ(SNP-index), G-statistic, Euclidean Distance, and Fisher-exact test, the high-quality SNP and InDel sites detected are subjected to association analysis, and a confidence level of 99% is taken as the screening threshold. The confidence intervals associated with the seed coat trait are obtained on chromosomes 2, 3, and 12 (Table 1). Combining the results obtained by the four algorithms, the intervals of 96.3Mb-99.2Mb (2.9Mb) on chromosome 2, 124.7Mb-129.3Mb (4.6Mb) on chromosome 3, and 96.5Mb-120.2Mb (23.7Mb) on chromosome 12 are finally determined as the candidate QTL intervals.

[0039] Table 1. Candidate intervals related to peanut seed coat traits obtained by four BSA analysis methods

[0040]

[0041] 1.2 QTL mapping of pinkish-white seed coat trait

[0042] KASP primers were designed based on the different loci between the two parents in the initial positioning interval, a total of 28 loci primers were designed, and the genotypes of 276 families of the "Yuanza 9102 x Tifrunner" F9 RIL population and parents were detected by SNPLine genotyping platform.

[0043] The genotyping results were used to construct a genetic linkage map using JoinMap software, 26 of the 28 markers were linked to 3 linkage groups (LG02, LG03, LG12). The total length of linkage group LG02 was 13.5 cM, with a total of 7 markers; the total length of linkage group LG03 was 5.5 cM, with a total of 7 markers; the total length of linkage group LG12 was 30.0 cM, with a total of 12 markers.

[0044] The pinkish-white seed coat trait was marked as 2, and the red and pink seed coat was marked as 1. MapQTL software was used to map the QTL of the pinkish-white seed coat trait of the "Yuanza 9102 x Tifrunner" RIL population.

[0045] The results are shown in Figure 1 Two major QTLs were obtained on linkage maps LG02 and LG12, respectively, qPinkish-whiteA02 and qPinkish-whiteA12. The marker most linked to qPinkish-whiteA02 was A02.97750456, with a LOD value of 12.77 and a phenotypic variation explanation rate of 19.2%; the marker most linked to qPinkish-whiteA12 was A12.113996432, with a LOD value of 11.94 and a phenotypic variation explanation rate of 18.1%.

[0046] 1.3 Recombination unit analysis

[0047] Recombination unit analysis was performed on the genotypes of the 276 families of the RIL population, and the results are shown in Figure 2As shown, when the interval of 97.66Mb-98.28Mb of chromosome 2 (618.0Kb) is the paternal genotype and the interval of 113.05Mb-114.43Mb of chromosome 12 (1371.7Kb) is the maternal genotype, the family shows the trait of pink seed coat. When the interval of 97.66Mb-98.28Mb of chromosome 2 is the maternal genotype and the interval of 113.05Mb-114.43Mb of chromosome 12 is also the maternal genotype, the family shows the trait of pink or red seed coat. When the interval of 97.66Mb-98.28Mb of chromosome 2 is the paternal genotype and the interval of 113.05Mb-114.43Mb of chromosome 12 is also the paternal genotype, the family shows the trait of pink or red seed coat.

[0048] 1. Genes and mutation sites annotated in the QTL interval

[0049] Based on the information of the cultivated peanut genome (Arachis hypogaea. cv. Tifrunner V2.0) as a reference, the SNP and InDel markers different between the two parents Yuanza 9102 and Tifrunner in the interval of 97.66Mb-98.28Mb of chromosome 2 (618.0Kb) and in the interval of 113.05Mb-114.43Mb of chromosome 12 (1371.7Kb) were screened.

[0050] The results are shown in Table 2. There are 166 SNP and InDel markers different between the two parents Yuanza 9102 and Tifrunner in the interval of 97.66Mb-98.28Mb of chromosome 2 (618.0Kb), of which 6 sense mutation markers are located on the exons of 5 genes. There are 424 SNP and InDel markers different between the two parents Yuanza 9102 and Tifrunner in the interval of 113.05Mb-114.43Mb of chromosome 12 (1371.7Kb), of which 28 sense mutation markers are located on the exons of 10 genes.

[0051] Table 2. Genes and sense mutation sites annotated in the QTL interval

[0052]

[0053]

[0054] qPinkish-whiteA02 and qPinkish-whiteA12 were in epistasis, and the epistatic contribution rate was 95.91%, that is, the pinkish-white seed coat trait was simultaneously regulated by the two QTLs. Peanut is an allopolyploid crop, so the probability of the candidate genes of the two QTLs being homologous genes is relatively high. Based on the existence of a sense mutation site in the exon of the homologous gene in the recombination unit of the two QTLs as the screening condition, the candidate genes were finally determined to be arahy.MP3D3D (AhbHLH-2A) and arahy.26781N (AhbHLH-2B), both of which are bHLH transcription factors.

[0055] The transcript sequences of AhbHLH-2A (arahy.MP3D3D) and AhbHLH-2B (arahy.26781N) were amplified from the cDNA of the seed coat of the two parents and analyzed. As shown in Figure 3

[0056] The detection amplification primers of the AhbHLH-2A gene are as follows:

[0057] bHLH.A02.CDs-F: 5'-TTATTATTATCATCTCATCTCACAA-3' (SEQ ID NO. 11);

[0058] bHLH.A02.CDs-R: 5'-TAGTAATTCACATTAAGGAAAAAAT-3' (SEQ ID NO. 12).

[0059] The detection amplification primers of the AhbHLH-2B gene are as follows:

[0060] bHLH.A12.CDs-F: 5'-TATTATCATCTCATCTCATCTCACA-3' (SEQ ID NO. 13);

[0061] bHLH.A12.CDs-R: 5'-AAGGTCTTAAACATCAACTTATACA-3' (SEQ ID NO. 14).

[0062] Example 2, Functional verification of peanut pinkish-white seed coat regulation gene

[0063] ​The AhbHLH-2A and AhbHLH-2B genes of peanuts are edited by using the CRISPR-Cas9 gene editing technology, and the gene editing vector is constructed based on the pCSGAP01 vector and contains a 35S driven hygromycin resistance gene, an AtU6 driven sgRNA, and a 35S driven Cas9 protein.

[0064] 2.1 Determination of sgRNA target points and preparation of oligo dimers:

[0065] The target point sequence is 5'-CTGCAGTTCAATCTGTTCAATGG-3'(SEQ ID NO. 15) and is located at positions 47-69 of the first exon based on the homologous sequences of the first exon of the AhbHLH-2A gene and the AhbHLH-2B gene.

[0066] According to the CRISPR-Cas9 gene editing target point design rules, the base sequence of 18-20 bp upstream of the protospacer-associated motif (PAM) is selected as the target sequence, 5'-N18-20NGG-3', NGG is the PAM conservative sequence, and N18-20 is the 18-20 bp base recognition sequence;

[0067] According to the target sequence, primers Target-Sense and Target-Antisense are designed to prepare oligo dimers;

[0068] Target-Sense: 5'-TGATTGCTGCAGTTCAATCTGTTCA-3'(SEQ ID NO. 16);

[0069] Target-Antisense: 5'-AAACTGAACAGATTGAACTGCAGCA-3'(SEQ ID NO. 17).

[0070] Oligo dimer preparation: centrifuge the Target-Sense and Target-Antisense primers at a speed of 5000 rpm for 1 min, dilute the primers to a final concentration of 10 μM with ddH2O, respectively, take 1 μL of each, add 18 μL of annealing buffer, mix well; keep at 95℃ for 3 min, then slowly cool to 20℃ at a rate of 0.2℃ / sec, keep for 5 min, dilute with water to 100 μL, and complete the preparation of the oligo dimer.

[0071] 2.2 Construction of CRISPR-Cas9 recombinant vector:

[0072] Select pCSGAP01 vector (Univivo Biotech (Jiangsu) Co., Ltd.) 10-30 μL, add bsal endonuclease 1 μL, bsal endonuclease buffer 5 μL, add water to 50 μL, 37°C for 1 h; recover the linearized vector after enzyme digestion 2 μL, add infusion Enzyme Mix 1 μL, synthetic oligo dimer 1 μL, 25°C for 1 h, to obtain the ligated vector.

[0073] Take the ligated vector 2 μL to transform E. coli competent DH5a, plate at 37°C overnight, pick single colonies and shake bacteria, extract plasmid, then perform plasmid sequencing. Save the positive colonies with correct sequencing to obtain the CRISPR-Cas9 recombinant vector plasmid.

[0074] The sequencing primer is pCBSG-seq: 5'-TCCCAGTCACGACGTTGTAA-3' (SEQ ID NO. 18).

[0075] 2.3 Genetic transformation of peanuts

[0076] (1) Embryogenic callus induction of explants

[0077] Take mature pods of different backgrounds or target peanuts, remove the shell, and pick the seeds that are full, clean, and free of bacterial spots. The peanut seed disinfection operation is as follows: soak the seeds in 75% alcohol for about 1 min, transfer to 0.1% mercury chloride solution for 8 min, remove the mercury solution, and rinse the seeds thoroughly with sterile water 5-7 times to remove residual disinfectants. Soak the seeds in sterile water overnight to promote seed water absorption and embryo germination.

[0078] (2) Embryogenic callus induction

[0079] Take the surface-disinfected peanut seeds, remove the cotyledons, embryo lobes, and hypocotyls of the peanut seeds on the clean bench, take the epicotyls and place them on the prepared MS induction medium, and place the inoculated medium in a 28°C constant temperature incubator under dark or light conditions. Subculture every 3-4 weeks, and obtain embryogenic calli for subsequent use after 3-4 subcultures; select embryogenic calli 4-12 months old that grow well and are free of contamination for subsequent experiments. The MS induction medium formula is shown in Table 3.

[0080] Table 3 MS induction medium formula

[0081]

[0082] (3) Preparation of biolistic bombardment

[0083] Prepare the bullet according to the new zhe gene gun (GJ-1000) instruction book, including the following steps:

[0084] Weigh 60 mg of gold powder, add it to 1 mL of absolute ethanol in a 2 mL centrifuge tube, and use an ultrasonic device to disperse the gold powder to a slightly warm hand temperature. Ensure that the gold powder is evenly dispersed. Centrifuge to remove undispersed particles, and discard the supernatant; add 1 mL of absolute ethanol, vortex for 3-5 min, and let stand for 1 min; add 1 mL of sterile distilled water, vortex, and centrifuge to discard the supernatant; add 50% sterilized glycerol to prepare a 60 mg / mL gold powder suspension.

[0085] Extract the CRISPR-Cas9 recombinant vector plasmid DNA using the TIANGEN (TIANGEN) endotoxin-free plasmid small extraction kit (DP118) according to the product instruction book operation steps to extract the genomic DNA of the CRISPR-Cas9 recombinant vector plasmid. The DNA concentration is 1 μg / μL.

[0086] Take 50 μL of gold powder suspension, add 10 μL of CRISPR-Cas9 recombinant vector plasmid, and shake for 30 s; add 50 μL of 2.5 M calcium chloride, shake for 30 s; add 20 μL of 0.1 M spermidine, shake for 30 s, and centrifuge to remove the supernatant; add 150 μL of 70% ethanol, blow the precipitate to evenly disperse, centrifuge to remove the supernatant, and add 150 μL of absolute ethanol. Let stand for 1 min, remove the supernatant, add 60 μL of absolute ethanol, and blow to disperse for use.

[0087] (4) Genetic transformation of peanuts

[0088] Place the induced peanut embryogenic callus on MS medium and use the new zhe gene gun (GJ-1000) for callus bombardment. After bombardment, culture at 28°C for 3 d, then transfer to MS medium containing 20 mg / L hygromycin for selection, a total of 1 month, select new callus, transfer to MS containing 20 mg / L hygromycin for 2 times of subculture, to proliferate embryogenic callus for plant regeneration.

[0089] (5) Regeneration of peanut plants

[0090] Transfer the selected callus to MS medium and place it in a plant growth incubator at 30°C with 16 h light / 28°C with 8 h darkness to induce differentiation of peanut seedlings. After 1 month, cut about 2 cm of peanut seedlings and place them on rooting medium. After the seedlings have rooted, transfer the seedlings to flower soil as the experimental group. Use wild-type peanuts that have not been genetically transformed as the control group, and perform parallel culture and treatment to evaluate the effect of genetic transformation.

[0091] (6) Acquisition of white powder peanut seed coat new germplasm

[0092] The editing plants with homozygous mutation or double allelic mutation are selected for breeding, and the next generation seeds are harvested, that is, new germplasm peanuts with pink seed coat are obtained.

[0093] 2.4 Detection of gene editing mutation sites of regenerated plants

[0094] After successful grafting of the peanut T0 plants, the leaf DNA of the T0 peanut seedlings is extracted by using a TIANGEN plant DNA extraction kit (DP350) according to the operation steps of the product instruction manual, and the target sites of AhbHLH-2A and AhbHLH-2B are detected.

[0095] The detection amplification primers of the AhbHLH-2A gene target site are as follows:

[0096] bHLH.A02.CRISPR-F: 5'-GGAGTAATGATTAGTTATTTGGGTA-3' (SEQ ID NO. 19);

[0097] bHLH.A02.CRISPR-R: 5'-GAATGAGACACACATCAAATAGAAC-3' (SEQ ID NO. 20).

[0098] The detection amplification primers of the AhbHLH-2B gene target site are as follows:

[0099] bHLH.A12.CRISPR-F: 5'-AATGATTAGTTATTTGGGAATGTAG-3' (SEQ ID NO. 21);

[0100] bHLH.A12.CRISPR-R: 5'-TGAGACACACATCAAATAGAACC-3' (SEQ ID NO. 22).

[0101] The reaction system is as follows: 1 μL (about 50 ng) of genomic DNA template, 2 uL of 10×Taq enzyme reaction buffer, 1.2 μL of 25 mM MgCl2, 1.5 μL of 2 mM dNTP, 0.2 μL of 10 uM primer, 0.3 units of Taq enzyme, and sterile water to 20 μL.

[0102] The reaction procedure is as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 2 min, 30 cycles.

[0103] The length of the amplified fragment based on the above-mentioned arahy.MP3D3D gene and arahy.26781N gene target site is 1543 bp and 1532 bp, respectively. The PCR amplified product is detected by agarose electrophoresis to determine whether the band size is correct. The correct band is sequenced, and the sequencing primer sequence is as follows:

[0104] bHLH.A02.CRISPR-F: 5'-GGAGTAATGATTAGTTATTTGGGTA-3' (SEQ ID NO. 23);

[0105] bHLH.A12.CRISPR-F: 5'-AATGATTAGTTATTTGGGAATGTAG-3' (SEQ ID NO. 24).

[0106] The sequence of the above-mentioned sequencing product is compared with the sequence of AhbHLH-2A and AhbHLH-2B genes in the untransformed wild-type peanut (Yuhua 9326) to detect the mutation of the gene editing target sequence.

[0107] The results show that the AhbHLH-2A allele of No. G80#8 (1) inserts 1 T base, while the AhbHLH-2B allele has different mutations, respectively inserting 1 T base and deleting 1 C base; the AhbHLH-2A allele of No. G80#17 (2) has different mutations, respectively deleting 17 bp sequence (TGTTCAATGGACCTACA) and 10 bp sequence (TCAATGGACC); while the AhbHLH-2B allele has different mutation types, respectively deleting 1 C and 1 T base; the AhbHLH-2A allele of No. G80#54 (4) deletes 1 C base, while the AhbHLH-2B allele has different mutation types, respectively deleting 19 bp sequence (TTCAATCTGTTCAATGGAC) and 6 bp sequence (TCAATG). Figure 4 a is the genotype of 3 T0 peanut transgenic plants AhbHLH-2A / 2B.

[0108] 2.5 Seed testa color determination of gene editing plants

[0109] After the peanut T0 plants mature, T1 generation peanut seeds are obtained from each plant, and the testa color is scanned, and the results are shown in Figure 4 b, the testa color of wild-type peanut Yuhua 9326 is pink, while the testa color of AhbHLH-2A / 2B gene knockout lines G80#8 (1), G80#17 (2) and G80#54 (4) is pinkish white. Figure 4b is the phenotype of T1 generation seeds of T0 peanut peanut transgenic plants.

[0110] Example 3, Verification of peanut powder white seed coat trait functional molecular marker

[0111] (1) According to the positioning results of the powder white seed coat trait of the "Yuanza 9102 x Tifrunner" RIL population and the sequence differences of the regulatory gene bHLH transcription factor (AhbHLH-2A and AhbHLH-2B) (i.e. InDel site of A02.97750456 and SNP site of A12.113996432), two groups of KASP primers were developed.

[0112] The KASP primer combination of the InDel site of A02.97750456 includes:

[0113] Pinkish-whiteA02_F1: 5'-AGACGAGCTGAGTGCAAACCAA-3' (SEQ ID NO. 3),

[0114] Pinkish-whiteA02_F2: 5'-GACGAGCTGAGTGCAAACCAC-3' (SEQ ID NO. 4),

[0115] Pinkish-whiteA02_com: 5'-GGACAAGTGATCTTAGGATGATGAA-3' (SEQ ID NO. 5).

[0116] The KASP primer combination of the SNP site of A12.113996432 includes:

[0117] Pinkish-whiteA12_F1: 5'-TACCTGGTAGTTGAACTTGGAGTTG-3' (SEQ ID NO. 8),

[0118] Pinkish-whiteA12_F2: 5'-TACCTGGTAGTTGAACTTGGAGTTA-3' (SEQ ID NO. 9),

[0119] Pinkish-whiteA12_com: 5'-CCGTTACCGAAGCAGATAATCAT-3' (SEQ ID NO. 10).

[0120] The PCR reaction system is 1 μL: 1 μL of template DNA (50-100 ng / μL), after drying, add 1 μL of 1 x Master Mix and KASP primer mixture, the volume of the primer is about 1.4% of the total reaction system.

[0121] PCR amplification procedure: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61℃-55℃ extension for 1 min, 10 cycles; 94℃ denaturation for 20 s, 55℃ extension for 1 min, 26 cycles; 10℃ storage.

[0122] (2) Extract the DNA of each family of the "Yuanza 9102 x Tifrunner" RIL population, and genotype the InDel site of A02.97750456 and the SNP site of A12.113996432 of each family by the SNPLine genotyping platform.

[0123] The authenticity of the InDel site of A02.97750456 and the SNP site of A12.113996432 in the "Yuanza 9102 x Tifrunner" RIL population was verified by the SNPLine genotyping platform (LGC), and the results are shown in Figure 5

[0124] The InDel site of A02.97750456 and the SNP site of A12.113996432 of the "Yuanza 9102 x Tifrunner" RIL population and 353 natural population materials were genotyped by the SNPLine genotyping platform (LGC).

[0125] The results are shown in Table 4. In the "Yuanza 9102 x Tifrunner" RIL population, if the genotyping result of the InDel site of A02.97750456 is mutant (Del:Del) and the SNP site of A12.113996432 is also mutant (T:T), then the testa color of the peanut sample is pink white; if only the genotyping result of the InDel site of A02.97750456 is mutant (Del:Del) or only the SNP site of A12.113996432 is mutant (T:T), then the testa color of the peanut sample is pink or red.

[0126] In the 353 germplasm resources materials, there is no material with the genotyping result of the InDel site of A02.97750456 being mutant (Del:Del) and the SNP site of A12.113996432 being also mutant (T:T), and only one of the above sites is mutant, then the testa color of the peanut material is pink, red, purple, white and mixed color.

[0127] Table 4 Genotyping and phenotype of testa functional molecular markers of "Yuanza 9102 x Tifrunner" RIL population and natural population

[0128] ​

[0129] The InDel site of A02.97750456 is located at 97,750,456 bp on chromosome 2 of peanut (reference genome Tifrunner V2.0), and the sequence of 100 bp before and after the site is as follows:

[0130] SEQ ID NO. 1:

[0131] CCAAATAACACAAACCCTACCAGCTCAGCCGGTCCGTCAGACCGGCTGCGCGGAGGGGG AAAAGGCAGTGGCACTCCGCAAGACGAGCTGAGTGCAAACC[ A ]AGAAGCTAAATGAGAGATTCATCATCCTAAGATCACTTGTCCCATTTGT TACCAAAATGGACAAAGCTTCAATTTTAGGTGACACAATTGAATATGTGAA.

[0132] or SEQ ID NO. 2:

[0133] CCAAATAACACAAACCCTACCAGCTCAGCCGGTCCGTCAGACCGGCTGCGCGGAGGGGG AAAAGGCAGTGGCACTCCGCAAGACGAGCTGAGTGCAAACC[ ACGTCCTGGCGGAGCG CCGCCGCCGTG ]AGAAGCTAAATGAGAGATTCATCATCCTAAGATCACTTGTCCCATTTGT TACCAAAATGGACAAAGCTTCAATTTTAGGTGACACAATTGAATATGTGAA.

[0134] The SNP site of A12.113996432 is located at 113,996,432 bp on chromosome 12 of peanut (reference genome Tifrunner V2.0), and the sequence of 100 bp before and after the site is as follows:

[0135] SEQ ID NO. 6:

[0136] TTTACTAGCCGTTACCGAAGCAGATAATCATTCGGGTCAAGTTGACTCTTATCGAGTTGAC CCGACCCAAAGATGGGATCCAATTCAAAGCCCTTTGGAT[C]AACTCCAAGTTCAACTACC AGGTAAAATCATAAATCATTTATTTAGTTTTTATTAAATATTTTTTATTTTAGTTGTTATAAAA TTATTAAAAATTAAAAA

[0137] or SEQ ID NO. 7:

[0138] TTTACTAGCCGTTACCGAAGCAGATAATCATTCGGGTCAAGTTGACTCTTATCGAGTTGAC CCGACCCAAAGATGGGATCCAATTCAAAGCCCTTTGGAT[T]AACTCCAAGTTCAACTACC AGGTAAAATCATAAATCATTTATTTAGTTTTTATTAAATATTTTTTATTTTAGTTGTTATAAAA TTATTAAAAATTAAAAA

Claims

1. A functional molecular marker for the white seed coat trait of peanut powder, characterized in that: The molecular markers are A02.97750456 and A12.113996432, and the molecular marker sites are SNP / InDel insertion / deletion markers, with the sequence of the site in square brackets; Among them, A02.97750456 is an InDel insertion-deletion marker located at 97,750,456 bp on peanut chromosome 2. The 100 bp sequence before and after the site is CCAAATAACACAAACCCTACCAGCTCAGCCGGTCCGTCAGACCGGCTGCG CGGAGGGGGAAAAGGCAGTGGCACTCCGCAAGACGAGCTGAGTGCAAAC C[ A ]AGAAGCTAAATGAGAGATTCATCATCCTAAGATCACTTGTCCCATTTGT TACCAAAATGGACAAAGCTTCAATTTTAGGTGACACAATTGAATATGTGAA; or CCAAATAACACAAACCCTACCAGCTCAGCCGGTCCGTCAGACCGGCTGCGCGGAGGGGGAAAAGGCAGTGGCACTCCGCAAGACGAGCTGAGTGCAAACC[ ACGTCCTGGCGGAGCGCCGCCGCCGTG ]AGAAGCTAAATGAGAGATTCA TCATCCTAAGATCACTTGTCCCATTTGTTACCAAAATGGACAAAGCTTCAATTTTAGGTGACACAATTGAATATGTGAA; A12.113996432 is a SNP marker located at 113,996,432 bp on peanut chromosome 12. The sequence of 100 bp before and after the site is TTTACTAGCCGTTACCGAAGCAGATAATCATTCGGGTCAAGTTGACTCTTAT CGAGTTGACCCGACCCAAAGATGGGATCCAATTCAAAGCCCTTTGGAT[ C ]AACTCCAAGTTCAACTACCAGGTAAAATCATAAATCATTTATTTAGTTTTTATTAAATATTTTTTATTTAAGTTGTTATAAAATTATTAAAAATTAAAAA or TTTACTAGCCGTTACCGAAGCAGATAATCATTCGGGTCAAGTTGACTCTTATCGAGTTGACCCGACCCAAAGATGGGATCCAATTCAAAGCCCTTTGGAT[ T ]AACTCCAAGTTCAACTACCAGGTAAAATCATAAATCATTTATTTAGTTTTTATT AAATATTTTTTATTTTAGTTGTTATAAAATTATTAAAAATTAAA。 2. A KASP primer set for amplifying the functional molecular marker according to claim 1, characterized in that: The KASP primer set includes KASP primer set for amplifying the A02.97750456 molecular marker locus: Pinkish-whiteA02_F1:5'-AGACGAGCTGAGTGCAAACCAA-3', Pinkish-whiteA02 F2:5'-GACGAGCTGAGTGCAAACCAC-3', Pinkish-whiteA02_com:5'-GGACAAGTGATCTTAGGATGATGAA-3'; KASP primer set for amplifying the A12.113996432 molecular marker locus Pinkish-whiteA12_F1:5'-TACCTGGTAGTTGAACTTGGAGTTG-3', Pinkish-whiteA12_F2:5'-TACCTGGTAGTTGAACTTGGAGTTA-3', Pinkish-whiteA12_com:5'-CCGTTACCGAAGCAGATAATCAT-3'.

3. The method for identifying peanut seed coat color using the functional molecular marker according to claim 1, characterized in that: The method comprises the following steps: (1) extracting DNA from a peanut sample to be identified, detecting the genotype data of the peanut sample to be identified using the KASP primer set described in claim 2, and genotyping the InDel site A02.97750456 and the SNP site A12.113996432 of the peanut sample to be identified using the SNPLine genotyping platform; (2) If the typing result of the InDel site A02.97750456 is the mutant type Del:Del, and the SNP site A12.113996432 is the mutant type T:T, the seed coat color of the peanut sample is pink-white; If only the typing result of the InDel site A02.97750456 is the mutant type Del:Del, or only the SNP site A12.113996432 is the mutant type T:T, the seed coat color of the peanut sample will appear pink or red.

4. Use of the molecular marker for the peanut powdery white seed coat trait as claimed in claim 1 in identifying the color of peanut seed coat.

5. Use of the molecular marker for the peanut powdery white seed coat trait as claimed in claim 1 in peanut molecular breeding.

Images