Method for enhancing pathogenic bacterium resistance by activating plant immune gene

Abstract

The invention belongs to the technical field of biology, and particularly relates to a method for enhancing pathogenic bacterium resistance by activating plant immune genes. A method for activating a plant immune gene to enhance pathogenic bacteria resistance is characterized by comprising the step of applying nano-silica particles to a plant to improve expression of a plant gene PR1 and a gene PR1A1. After the plant is treated by the SiO2NPs, the SAR-related immune genes PR1 and PR1A1 in the plant are highly expressed, so that the SAR of the plant is activated, and the pathogenic bacterium resistance of the plant is improved.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a method for activating plant immune genes to enhance pathogenic bacteria resistance. BACKGROUND

[0002] Pathogenic bacteria will have a serious impact on the growth and development of tomatoes. The disease caused by pathogenic bacteria affects leaf photosynthesis, leading to yellowing and early shedding of leaves, thereby affecting the yield and quality of tomatoes. In severe cases, it can reduce tomato yield by 30-50%, or even cause absolute yield, causing significant economic losses to farmers. The existing technology related to plant disease prevention and control is mainly based on chemical pesticides, supplemented by physical and biological control. The disadvantages of biological control technology include slow effect, long cycle, passivity to sudden diseases, and greater influence by environmental factors, and the control effect is not stable enough. In addition, the research time of biological control technology is relatively short, and there are problems such as weak efforts, poor publicity, and failure to implement control measures in the process of achievement transformation. Chemical control technology has a quick effect and low cost, but it will cause obvious pollution to the environment, and chemical pesticides will spread to the soil, water and air; pesticide residues on tomatoes will harm human health when eaten; long-term use of chemical pesticides will make the bacteria resistant, making the pesticide lose its effect; chemical pesticides will harm some beneficial insects and destroy the ecological balance. At present, immunity induction technology is also used, but its shortcomings are that the plant immune inducer may have unstable effect and limited application range in actual application. The four induction technologies (light induction, color induction, sex induction and food induction) have the defects of single target, poor environmental adaptability, high labor cost and low efficiency. Although gene editing technology (such as CRISPR / Cas9) has the advantage of one-time effort, when using CRISPR / Cas9 tools to resist exogenous virus infection, geminiviruses can escape CRISPR / Cas9-mediated resistance, and whether CRISPR / Cas9 can accelerate the evolution of geminiviruses is still a question to be explored. In addition, the delivery of CRISPR elements by viruses is limited by the capacity of viruses to package exogenous proteins, and only a part of viruses can express Cas protein, limiting its application. Based on the advantages and disadvantages of the above existing technologies, it is necessary to explore a high-efficiency and safe alternative. Among them, nanomaterials are used more and more in plant protection, and they have many advantages compared with traditional products and methods, including improving plant disease resistance, improving efficiency and reducing ecological toxicity.

[0003] The innate immune system in plant immunity consists of immune responses induced by pathogen pattern molecules (PTI) and immune responses triggered by pathogen effectors (ETI). At the same time, plants have evolved a set of induced immune mechanisms, including systemic acquired resistance (SAR). SAR is activated by local infection of pathogens, and a systemic signal is generated at the infected site, which is transported to the uninfected site to activate the defense response and produce a broad-spectrum resistance to various pathogens, i.e. broad-spectrum resistance. Salicylic acid, jasmonic acid and ethylene, as endogenous signal molecules, play a key role in plant immunity by inducing systemic acquired resistance (SAR). SUMMARY

[0004] The purpose of the present application is to provide a method for activating plant immune genes to enhance pathogenic resistance. The nano-silicon dioxide particles (SiO2NPs) used in the method for enhancing pathogenic resistance provided by the present application are a kind of nano-sized inorganic materials with various morphologies, which have the characteristics of multiple micropores, large specific surface area, strong chemical stability, non-toxicity and non-pollution. The diameter of the SiO2NPs used in the present application ranges from 40 to 80 nm, which enables them to completely enter the leaf through the stomata and then enter the plant cells. The high surface-to-volume ratio of SiO2NPs improves their reactivity and biochemical activity.

[0005] In order to achieve the above-mentioned purpose, the present application provides the following technical solutions.

[0006] The present application provides a method for activating plant immune genes to enhance pathogenic resistance, which comprises: improving the expression of plant genes PR1 and PR1A1 by applying nano-silicon dioxide particles to plants.

[0007] In the present application, the plants include tomatoes.

[0008] In the present application, the application concentration of the nano-silicon dioxide particles is 100 mg / L; and the particle size of the nano-silicon dioxide particles is 40-80 nm.

[0009] In the present application, the pathogenic bacteria include Pseudomonas syringae and powdery mildew.

[0010] The present application also provides the application of nano-silicon dioxide particles in enhancing the resistance of tomatoes to pathogenic bacteria.

[0011] The present application also provides the application of nano-silicon dioxide particles in enhancing the expression of genes PR1 and PR1A1 in tomatoes.

[0012] The present application also provides the application of nano-silicon dioxide particles in enhancing the resistance of tomatoes to Pseudomonas syringae.

[0013] The application also provides application of the nano-silicon dioxide particles in enhancing resistance of tomatoes to powdery mildew.

[0014] It is found by the application that after the tomato is treated by the SiO2 NPs, the SAR-related immune genes PR1 and PR1A1 in the tomato are highly expressed, so that the SAR of the tomato is activated, and the ability of the tomato to resist pathogenic bacteria is improved. The tomato resistance induced by the SiO2 NPs is mainly caused by the plant immune response, and the SiO2 NPs have no plant toxicity and no environmental pollution, and are a new method for the tomato to resist pathogenic bacteria. In the application, the PR1 gene is used as a marker gene of the SAR, the SiO2 NPs activate the expression of the PR1 gene, induce the SAR to protect the tomato from the pathogenic bacteria, improve the quality and yield of the tomato, and have great application potential in the prevention of tomato diseases. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 Fig. 1 is a plant phenotype and number of flora of three groups of Arabidopsis seedlings in Example 1; from left to right in the figure are Group A, Group B, and Group C;

[0016] Figure 2 Fig. 2 is expression of plant immune (SAR)-related genes PR1 and PR1A1 in Example 2; WT in the figure is a control group, SiO2 NPs in the figure is an experimental group. s represent an experimental group;

[0017] Figure 3 Fig. 3 is a situation of infection of tomato seedlings with powdery mildew in Example 3; the left graph in the figure is a control group, and the right graph in the figure is an experimental group. DETAILED DESCRIPTION

[0018] In the following, if a specific technique or condition is not specified for the reagent or instrument used, the conventional experimental condition is used, and if the reagent company instruction is not specified, the condition suggested in the instruction is used. If the manufacturer of the reagent or instrument used is not specified, it is a conventional product that can be obtained by purchase.

[0019] Example 1

[0020] Arabidopsis seedlings with a growth cycle of four weeks and similar growth conditions are selected, and are divided into three groups, and each group has several seedlings. The same position and same size of leaves of the Arabidopsis seedlings are selected for treatment and are well marked. The experiment is performed at 11 o'clock in the morning when the stomata of the leaves are fully open.

[0021] Group A: by using a disposable sterile syringe (1 mL) without a needle, sterile water is injected on the abaxial surface of the leaves, the whole leaf is injected, and the injection amount is 100 μL.

[0022] Group B: Pseudomonas syringae (model pathogen, commonly used in plant immune pathogen experiments) was cultured in LM medium with rifampicin antibiotic, single colonies were picked and expanded, centrifuged, and diluted with sterile water to OD 600 = 0.002, the bacterial solution was injected into the leaves, and the operation method and dosage were consistent with group A.

[0023] Group C: One day before the bacterial solution treatment, 100 mg / L of SiO2NPs was sprayed on the abaxial surface of the leaves using a watering can, with a spraying amount of 100 μL. One day later, the same operation of group B was performed again.

[0024] After three days, it was observed that the leaves in group A showed no obvious changes, the leaves in group B showed severe chlorosis and necrosis, and part of the leaves in group C showed lesions. Details can be referred to Figure 1 .

[0025] The leaves were removed from the sterile 1.5 mL centrifuge tube using a puncher with a size of 0.6 cm, 1 mL of sterile water was added, and the leaves were ground into a water slurry. 5 μL was spotted on a rifampicin KB medium with a final concentration of 100 μg / mL, and the medium was inverted in a 28°C incubator for culture. After two days, the bacterial growth in the medium was observed. Details can be referred to Figure 1 .

[0026] Results: The leaves in group A showed no bacterial infection, the leaves in group B showed severe bacterial infection, and the leaves in group C showed significantly less bacterial infection than group B. Through phenotype and bacterial population experiments, it can be proved that SiO2NPs enhances the resistance of Arabidopsis to Pseudomonas syringae and has the ability to increase plant immunity.

[0027] Example 2

[0028] Tomato seedlings with a growth cycle of four weeks and similar growth conditions were selected and divided into two groups, with several seedlings in each group. The same size leaves at the same position of the tomato were treated and labeled. The experiment was conducted at 11 o'clock in the morning when the leaf stomata were most open. According to the operation method of experiment one, the tomato was infected with Pseudomonas syringae.

[0029] Control group: One day before the experiment, 100 μL of sterile water was sprayed on the abaxial surface of the leaves using a watering can. One day later, a sterile disposable syringe (1 mL) without a needle was used to inject Pseudomonas syringae solution with a concentration of OD 600 = 0.002 into the abaxial surface of the leaves, filling the entire leaf, with an injection amount of 100 μL.

[0030] Experimental group: One day before the experiment, 100 mg / L of SiO2NPs was sprayed on the abaxial surface of the leaves in the SiO2 group using a watering can, with a spraying amount of 100 μL. One day later, a sterile disposable syringe (1 mL) without a needle was used to inject Pseudomonas syringae solution with a concentration of OD 600Pseudomonas syringae liquid injection into the leaf distal surface, injection of the entire leaf, injection volume of 100 μL.

[0031] Three days later, the purpose of the gene for PR1, PR1A1 qPCR gene expression analysis.

[0032] The following methods used without special instructions are conventional methods, primers are completed by Shanghai Shengong Company. RNA extraction kit, reverse transcription kit, PCR kit, Taq DNA polymerase are purchased from Beijing Solabio Technology Co., Ltd.

[0033] (a) Extract the RNA of the leaf, take the whole leaf after infection into a 1.5 mL centrifuge tube, put it into liquid nitrogen to prevent RNA degradation, use the RNA extraction kit to extract the RNA of the leaf; use the Nano Dorp spectrophotometer to determine the RNA concentration and purity, ensure the integrity and purity of the RNA; (b) use the reverse transcription kit to reverse transcribe the extracted RNA into cDNA as the template for qPCR reaction; (c) configure the qPCR reaction solution, add the forward and reverse primers and cDNA template and Taq DNA polymerase, perform qPCR amplification and real-time monitoring of the fluorescence signal.

[0034] The primer sequences required for qPCR are as follows:

[0035] qSlPR1-F 5'-GCCTTTGCCCAAAATTACGC-3', SEQ ID No. 1;

[0036] qSlPR1-R 5'-ACAACCAAGACGTACCGAGT-3', SEQ ID No. 2;

[0037] qSlPR1A1-F 5'-TCTCAACGCTCACAATGCAG-3', SEQ ID No 3;

[0038] qSlPR1A1-R 5'-TGCTTCTCATCGTCCCACAT-3', SEQ ID No. 4;

[0039] Reaction procedure: 95℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds; 55℃ annealing for 30 seconds; 72℃ extension for 1 minute; 35 cycles; 72℃ extension for 10 minutes. After the reaction is completed, analyze the data.

[0040] (b) Through the data analysis of qPCR, the expression amount of the target gene relative to the internal reference gene of each sample is calculated as Δct.

[0041] (c) Calculate the mean of the expression quantity of the control group △ct, and then subtract the mean of the control group △ct from each △ct of the experimental group to obtain the △△ct value (the expression quantity of the experimental group relative to the control).

[0042] (d) Calculate the expression quantity of each sample of the experimental group relative to the control group by using Formula 2 -△△Ct Then calculate the mean of the experimental group.

[0043] (e) Generate a column chart to compare the relative expression quantities of the target genes of the experimental group and the control group by using Excel software. The column chart is shown in Figure 2 .

[0044] The nucleotide sequence of the gene PR1 is shown in

[0045] SEQ ID No. 5.

[0046] The nucleotide sequence of the gene PR1A1 is shown in

[0047] GATAATTGTAGTAGTGTTCATCCATAATATTGTTTTTTTTAGTGGCGGCTTTTGCTCAAACGAATCATTCAATTCATTTCTTATTTTTATTTTTTACAACTTGCAAACTTTATAACTTCCTATTAAGACCCATCCATAACTATTCCTTTTTTCTCATAAAAATCCAAAATGAAATCCTCCATTTTCGTTGCTTGTTTCATTACCTTCATTATATTTCACTCATCACAAGCTCAAACTCCTCGAGAGAATTTTCTCAACGCTCACAATGCAGCTCGTAGACGAGTTGGCGTTGGCCCTATGACATGGGACGATGGTCTAGCAGCCTATGCCCAAAATTACGCCAATCAAAGAGCTGATGACTGTGGAATGATCCACTCTGATGGCCCTTACGGCGAAAACCTAGCCGCTGCTTTTCCACAGCTAAACGCTGCTGGTGCTGTGAAGATGTGGGACGATGAGAAGCAATGGTACGATTATAATTCGAATACGTGTGCTCCAGGTAAAGTCTGTGGACATTATACTCAAGTGGTATGGCGTAAGTCGGTACGTCTAGGTTGTGCTAGGGTTCGATGCAACAGTGGGTGGGTTTTTATAACGTGCAATTATGATCCACCCGGTAATTATATAGGACAACGTCCCTACGGTGATCTTGAAGAACAAAAACCGGACTTTGATTCCAAGTTGGAGCTTCCAAATTAATTTCATGATCATCAAGTCGATCATCATCGATGAATAAAGCTTTAATTGTTAATTAAGGCCAGTGCTGTATCTTATCTTAGTTGATTAATCATCAGTTCATGTATGAGTGTTTTGTTATTATGATATTCTTATTTTAAGTATTCATGTTGGTACTTTGGGTCTCTATATATATTAAAAAGAAAATGATTTAGTTTGATTTGA, set forth in SEQ ID No. 6.

[0048] The results show that the expression of the genes PR1 and PR1A1 in the plants of the control group and the experimental group has significant difference, wherein the expression of PR1 in the experimental group is 27 times higher than that in the control group, and the expression of PR1A1 is increased by about 34 times. It is shown that SiO2NPs affect the expression of the genes PR1 and PR1A1, and the regulation of the disease resistance is through the high expression of the plant immune (SAR) related genes PR1 and PR1A1, and the tomato SAR is activated.

[0049] Example 3

[0050] A number of tomato seedlings with similar growth conditions are selected and divided into two groups. One day before the experiment, the control group and the experimental group are respectively sprayed with 100 μL of sterile water and the same amount of 100 mg / L SiO2NPs on the abaxial surface of the leaves. One day later, 100 μL of P. syringae liquid with OD 600 = 0.002 is injected on the abaxial surface of the leaves, and the disease of the tomato leaves is observed.

[0051] A number of tomato seedlings with similar growth conditions are selected and divided into two groups, and the control group is sprayed with SiO2NPs on the abaxial surface of the leaves using a spray bottle, and the experimental group is sprayed with the same amount of sterile water in the same way. They are placed in the same greenhouse and naturally spread the powdery mildew fungus. After a period of time, the disease of the powdery mildew (such as Figure 3 shown) is observed. It is observed that the tomato leaves of the control group are infected with the powdery mildew, and no infection is found in the control group. It is shown that SiO2NPs can inhibit the development of the powdery mildew of the tomato.

[0052] The results show that SiO2NPs can inhibit the growth of P. syringae and the powdery mildew fungus in the tomato and help the tomato resist the pathogenic bacteria.

[0053] According to Example 2, it is known that SiO2NPs can trigger the expression of the plant immune (SAR) related genes PR1 and PR1A1 and enhance the resistance of the tomato. The expression of the PR1 and PR1A1 genes is induced by SiO2NPs treatment, wherein the expression of the PR1 gene in the SiO2NPs treated leaves is 27 times higher than that in the control group, and the expression of the PR1A1 gene is increased by about 34 times. It is known from Examples 1-3 that SiO2NPs can activate the expression of the plant immune (SAR) related genes PR1 and PR1A1, thereby inhibiting the growth of the pathogenic bacteria.

[0054] Although the above examples make a detailed description of the present application, it is only a part of the examples of the present application, but not all the examples, and other examples can be obtained from the present examples without creativity, which all belong to the protection scope of the present application.

Claims

1. A method for activating plant immune genes to enhance resistance to pathogens, characterized in that: The method comprises: applying nano-silica particles to plants to increase the expression of plant genes PR1 and PR1A1.

2. The method according to claim 1, characterized in that The plants include tomatoes.

3. The method according to claim 1, characterized in that The applied concentration of the nano-silicon dioxide particles is 100 mg / L; The particle size of the nano silicon dioxide particles is 40 to 80 nm.

4. The method according to claim 1, wherein The pathogens include Pseudomonas syringae and powdery mildew.

5. Application of nano-silica particles in enhancing the resistance of tomatoes to pathogens.

6. Application of nano-silica particles in enhancing the expression of genes PR1 and PR1A1 in tomatoes.

7. Application of nano-silica particles in enhancing the resistance of tomatoes to Pseudomonas syringae.

8. Application of nano-silica particles in enhancing the resistance of tomatoes to powdery mildew.

Images