Transgenic salvia miltiorrhiza tissue culture breeding method
By using specially formulated T1, T2, and T3 culture media and recombinant Agrobacterium infection during the Salvia miltiorrhiza tissue culture process, the Salvia miltiorrhiza tissue culture process is simplified, and transgenic Salvia miltiorrhiza plants are obtained quickly and efficiently, solving the problem of low efficiency in existing technologies.
Patent Information
- Application Number
- CN202410991992.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-23
- Publication Date
- 2025-10-17
AI Technical Summary
In existing Salvia miltiorrhiza genetic engineering research, the Agrobacterium-mediated genetic transformation method has low efficiency, complex and time-consuming operations, and it is difficult to quickly obtain transgenic Salvia miltiorrhiza plants.
By using specially formulated T1, T2, and T3 culture media combined with recombinant Agrobacterium infection and controlling the ratio of plant growth hormones and antibiotics at different stages, the Salvia miltiorrhiza tissue culture process is simplified, allowing roots to grow directly in sterile soil, eliminating the seedling hardening step.
The rapid and efficient tissue culture process of Salvia miltiorrhiza was achieved, with a short germination time and a positive transgenic plant rate of up to 90%, reducing operational complexity and costs.
Smart Images

Figure CN120787809A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a kind of transgenic salvia miltiorrhiza tissue culture breeding method. BACKGROUND
[0002] Salvia miltiorrhiza is the dried root and rhizome of the Labiatae plant, has a wide range of pharmacological activities and is complex, has the effects of protecting myocardium, anti-atherosclerosis, reducing blood pressure and anti-inflammatory, and is often used for treating angina pectoris, coronary heart disease, hypertension and inflammation and other diseases. Through transgenic technology, the genetic characteristics of salvia miltiorrhiza can be improved, the content or activity of its medicinal ingredients can be improved, and its therapeutic effect can be enhanced. At the same time, the genome of salvia miltiorrhiza is small, and the chromosome is less, and the generation cycle is shorter when regenerating transgenic plants, so it has a high research value as a medicinal model plant.
[0003] At present, Agrobacterium-mediated method is the most common and effective means for genetic engineering research of salvia miltiorrhiza, but this method often requires delicate and time-consuming tissue culture, and the genetic transformation efficiency is low. Patent CN 116875615A discloses a salvia miltiorrhiza genetic transformation system mediated by Agrobacterium tumefaciens GV3101, although transgenic salvia miltiorrhiza is successfully obtained, the explant material needs to be cultured in multiple media, and the tender buds need to be cut and cultured again after sprouting to finally obtain transgenic salvia miltiorrhiza, which is complex and time-consuming, and the transformation efficiency is not guaranteed. SUMMARY
[0004] To solve the above problems, the present application provides a transgenic salvia miltiorrhiza tissue culture breeding method, which comprises the following steps:
[0005] 1) Take the leaves or petioles of salvia miltiorrhiza and place them in T1 medium for culture to obtain explant material;
[0006] 2) Take the explant material obtained in step 1) and infect it with recombinant Agrobacterium, then sequentially culture it in T1 medium for 1-3 days, T2 medium for 5-10 days, and T3 medium until it sprouts;
[0007] 3) Take the tissue culture seedlings obtained in step 2) and plant them in sterile soil containing rooting powder, then culture them in a sterile environment and in a non-sterile environment to obtain transgenic salvia miltiorrhiza;
[0008] The T1 medium is prepared from the following raw materials with the following final concentrations:
[0009] 4-6 g / L MS, 10-30 g / L sucrose, 1-2 mg / L 6-BA, 0.05-0.15 mg / L NAA, 6-10 g / L agar, and the rest is water;
[0010] The T2 medium is prepared from the following raw materials with the following final concentrations:
[0011] 4-6 g / L MS, 10-30 g / L sucrose, 1-2 mg / L 6-BA, 0.05-0.15 mg / L NAA, 6-10 g / L agar, 200-400 mg / L cefotaxime sodium, and the rest is water;
[0012] The T3 medium is prepared from raw materials with the following final concentrations:
[0013] 4-6 g / L MS, 0.2-0.5 mg / L 6-BA, 0.05-0.15 mg / L NAA, 0.05-0.15 mg / L GA3, 20-40 g / L sucrose, 8-10 g / L agar, 200-400 mg / L cefotaxime sodium, 40-50 mg / L hygromycin, and the rest is water.
[0014] Further, the T1 medium is prepared from raw materials with the following final concentrations:
[0015] 4.74 g / L MS, 20 g / L sucrose, 1.0 mg / L 6-BA, 0.1 mg / L NAA, 8.0 g / L agar, and the rest is water;
[0016] The T2 medium is prepared from raw materials with the following final concentrations:
[0017] 4.74 g / L MS, 20 g / L sucrose, 1.0 mg / L 6-BA, 0.1 mg / L NAA, 8 g / L agar, 400 mg / L cefotaxime sodium, and the rest is water;
[0018] The T3 medium is prepared from raw materials with the following final concentrations:
[0019] 4.74 g / L MS, 0.25 mg / L 6-BA, 0.1 mg / L NAA, 0.1 mg / L GA3, 30 g / L sucrose, 8.5 g / L agar, 300 mg / L cefotaxime sodium, 50 mg / L hygromycin, and the rest is water.
[0020] Further, the culturing in step 1) is carried out at 22-28°C in the dark for 2-3 days, preferably at 25°C for 2 days.
[0021] Further, the culturing of the explant material in step 2) is carried out in the T1 medium at 22-28°C in the dark for 2-3 days, preferably at 25°C in the dark for 2 days.
[0022] The culturing in the T2 medium is carried out at 22-28°C with 16h light / 8h dark for 6-10 days, preferably at 25°C with 16h light / 8h dark for 8 days.
[0023] The culture condition of T3 medium is: 25℃, 16h light / 8h dark culture; the medium is replaced every 10-14 days.
[0024] Further, the sterile soil in step 3) contains 0.5g rooting powder per 1kg; the culture condition of the sterile culture is: 25℃, 16h light / 8h dark culture, for 3-7 days, preferably 5 days.
[0025] Further, the method of the infection in step 2) is: centrifuging the recombinant Agrobacterium strain, resuspending the solid with 1 / 2MS of 2.37g / L to obtain a bacterial solution; submerging the explant material in the bacterial solution, and then sucking the surface bacterial solution after taking out, and then the operation is completed.
[0026] Further, the volume ratio of the recombinant Agrobacterium strain to 1 / 2MS is 2:40; the centrifugation speed is 4000r / min, and the time is 10min.
[0027] Further, the submerging time is 10min.
[0028] Further, the recombinant Agrobacterium strain is Agrobacterium tumefaciens GV3101 integrated with an exogenous gene;
[0029] Further, the exogenous gene includes SmPYL4 gene or SmSUS1 gene; the CDS sequence of the SmPYL4 gene is shown as SEQ ID NO.1; the CDS sequence of the SmSUS1 gene is shown as SEQ ID NO.4.
[0030] The transgenic Salvia miltiorrhiza tissue culture breeding method has the advantages that: specific plant growth hormones and antibiotics are used in the culture medium at different stages, and their proportions are accurately controlled, so that the budding time is short during the whole Salvia miltiorrhiza tissue culture breeding, and the tissue culture seedlings can be directly transplanted to the sterile soil for rooting 10-15 days after the budding, without the need of seedling raising, which is convenient, fast and low in cost. Compared with the conventional method, the seedling raising step before transplanting is omitted, positive transgenic Salvia miltiorrhiza plants are quickly and efficiently obtained, and the positive rate of the plants is extremely high, close to 90%.
[0031] Obviously, according to the above content of the present application, according to the ordinary technical knowledge and conventional means in the art, other various forms of modifications, replacements or changes can be made without departing from the above basic technical idea of the present application.
[0032] The above content of the present application will be further illustrated in detail through the following embodiment form. However, it should not be understood that the above subject matter of the present application is limited to the following examples. Any technology realized based on the above content of the present application belongs to the scope of the present application. BRIEF DESCRIPTION OF DRAWINGS
[0033] Figure 1 PCR map (A: DL2000 Maker; B: positive control (GV3101: pCAMBIA1305-SmPYL4-GFP); C-H: OE1-OE6 (SmPYL4 overexpression transgenic lines); I: (negative control) wild type plant) DETAILED DESCRIPTION
[0034] The raw materials, reagents and equipment used in the specific embodiments of the present application are known products, which can be obtained by commercial purchase, wherein the recombinant Agrobacterium is prepared by the following method:
[0035] Based on the genome of Salvia miltiorrhiza, specific primers SmPYL4-F / R were designed for PCR amplification, and the band size was identified by agarose gel electrophoresis after amplification. After confirming the correctness, the obtained sequence was named SmPYL4, and the band was recovered and the concentration was determined.
[0036] The pCAMBIA1305-GFP plasmid was extracted, and double digestion was performed using BamH I and Sal I. After digestion, the vector was recovered and the concentration was determined.
[0037] The SmPYL4 was constructed into the digested pCAMBIA1305-GFP plant expression vector by homologous recombination method, and the recombinant plasmid pCAMBIA1305-SmPYL4-GFP was obtained. The plasmid was transformed into DH5α E. coli competent cells, and the next day, PCR was used for positive selection and sequencing. The strains with correct sequencing were expanded, and the plasmid was extracted. Then the recombinant plasmid was transformed into Agrobacterium GV3101 competent cells, and PCR was used for positive selection and storage. It is used for subsequent co-culture step of Agrobacterium infection.
[0038] Nucleotide sequence of SmPYL4-F (SEQ ID NO. 2):
[0039] GGGTACCCGGGGATCCATGCCTTCTGATCATCCCAAATCC
[0040] Nucleotide sequence of SmPYL4-R (SEQ ID NO. 3):
[0041] CTTGCTCACCATGTCGACTTGTCGTCTGGCTATATTCTC
[0042] CDS sequence of SmPYL4 (SEQ ID NO. 1):
[0043] ATGCCTTCTGATCATCCCAAATCCTCCCTCCTCCTCCAACGGATCAACGGCACCCCCTCCACCACCGCGTGCAAGCAGTCGTACCGCCTCCCCACGGCGGCGGCGCAGGTCCCCGAGCACGTGGCGCGGTACCACGCCCACGCGGTGGGCCCGAACCAGTGCTTCTCCGCCGTGAGCCAGCACATCGCCGCCCCCGTGGGCGCCGTGTGGTCCGTGGTCCGGCGCTTCGACAACCCACAGGCGTACAAGCACTTCGTGAAGAGCTGCCACGTGGTGGGCGGCAACGGCGATGTCGGCACGCTGCGGGAGGTGCGTGTCATCTCTGGGCTGCCCGCGGTCAGCAGCACCGAGCGCCTCGAGATCCTTGACGACGAGCGCCACGTCATGAGCTTTAGCGTCGTCGGCGGGGACCACCGCCTCGCCAACTACCGCTCCGTCACCACCCTCCACGCAGCCGGCGCCGGCTCCGTTGTTGTCGAGAGCTACGTCGTCGACGTGCCGCAAGGTAACACTAAGGAAGAAACCTGCGTTTTTGTCGACACCATTGTCAAATGCAATCTGCAGTCGTTAGCTCAGATCGCTGAGAATATAGCCAGACGACAATAA
[0044] Transgenic Salvia miltiorrhiza tissue culture breeding method
[0045] 1) Take the leaves of Salvia miltiorrhiza, cut into 0.5 cm square, placed in T1 medium dark culture for 2 days, temperature 25℃, get explant material;
[0046] 2) Take 2mL OD=0.4 of recombinant Agrobacterium strain, centrifuge at 4000r / min for 10min, take the solid with 40mL 1 / 2MS liquid resuspended, get bacterial solution;
[0047] 3) Take the bacterial solution obtained in step 2) to infect the explant material obtained in step 1) for 10 minutes, then use filter paper to absorb the bacterial solution on the surface of the explant material, and place it in new T1 medium, and culture it in dark at 25°C for 2 days, then change the explant material to T2 medium, and culture it at 25°C under the condition of 16h light / 8h dark for 8 days, finally change the explant material to T3 medium, and culture it at 25°C under the condition of 16h light / 8h dark, change the medium every 10-14 days, and no more than 8 calluses per bottle, until germination;
[0048] 4) Take the tissue culture seedlings with a length of more than 1.5cm cultured in T3 medium for 25-35 days in step 3), and plant them in sterile nutrient soil containing rooting powder (mix 1L of 0.5g / L rooting powder solution with every 1kg of sterile soil), and culture them in sterile for 5 days, then open the bottle cap and continue to culture them under the condition of 16h light / 8h dark at 25°C for 10 days, to obtain the transgenic Salvia miltiorrhiza plants;
[0049] The formula of T1 medium is: 4.74g / L MS, 20g / L sucrose, 1.0mg / L 6-BA, 0.1mg / L NAA, 8.0g / L agar, and the rest is water;
[0050] The formula of T2 medium is: 4.74g / L MS, 20g / L sucrose, 1.0mg / L 6-BA, 0.1mg / L NAA, 8g / L agar, 400mg / L cefotaxime sodium, and the rest is water;
[0051] The formula of T3 medium is: 4.74g / L MS, 0.25mg / L 6-BA, 0.1mg / L NAA, 0.1mg / L GA3, 30g / L sucrose, 8.5g / L agar, 300mg / L cefotaxime sodium, 50mg / L hygromycin, and the rest is water.
[0052] Example 2: Transgenic Salvia miltiorrhiza tissue culture breeding method
[0053] 1) Take the petiole of Salvia miltiorrhiza, cut it into 0.8cm long, and place it in T1 medium for dark culture for 2 days at 25°C to obtain explant material;
[0054] 2) Take 2mL of recombinant Agrobacterium strain with OD=0.4, centrifuge it at 4000r / min for 10 minutes, take the solid and resuspend it with 40mL of 1 / 2MS liquid to obtain a bacterial solution;
[0055] 3) Take the bacteria solution obtained in step 2) to infect the explant material obtained in step 1) for 10 minutes, then use filter paper to absorb the bacteria solution on the surface of the explant material, and place the explant material into new T1 medium, and culture at 25°C in dark for 2 days, then change the explant material into T2 medium, and culture at 25°C under the condition of 16h light / 8h dark for 8 days, finally change the explant material into T3 medium, and culture at 25°C under the condition of 16h light / 8h dark, change the medium every 10-14 days, and no more than 8 calluses per bottle, until germination;
[0056] 4) Take the tissue culture seedlings with a length of more than 1.5 cm cultured in T3 medium for 25-35 days in step 3), and plant them in sterile nutrient soil containing rooting powder (1 L of 0.5 g / L rooting powder solution is uniformly mixed per 1 kg of sterile soil), and culture in sterile for 5 days, then open the bottle cap and continue to culture at 25°C under the condition of 16h light / 8h dark for 10 days, to obtain the transgenic Salvia miltiorrhiza plants;
[0057] The formula of T1 medium is: 4.74 g / L MS, 20 g / L sucrose, 1.0 mg / L 6-BA, 0.1 mg / L NAA, 8.0 g / L agar, and the rest is water;
[0058] The formula of T2 medium is: 4.74 g / L MS, 20 g / L sucrose, 1.0 mg / L 6-BA, 0.1 mg / L NAA, 8 g / L agar, and the rest is water;
[0059] The formula of T3 medium is: 4.74 g / L MS, 0.25 mg / L 6-BA, 0.1 mg / L NAA, 0.1 mg / L GA3, 30 g / L sucrose, 8.5 g / L agar, 300 mg / L cefotaxime sodium, 50 mg / L hygromycin, and the rest is water.
[0060] The DNA of the leaves of the transgenic Salvia miltiorrhiza plants obtained in Examples 1 and 2 was extracted and subjected to PCR identification. The transgenic plants amplified a band of the same size as the positive (GV3101: pCAMBIA1305-SmPYL4-GFP), while the wild-type plants did not amplify a band of the same size, indicating that the SmPYL4 gene was integrated into the Salvia miltiorrhiza plants. Figure 1 )
[0061] The data of the tissue culture seedlings obtained by breeding according to the methods of Examples 1 and 2 are shown in Table 1.
[0062] Table 1 Growth and identification of transgenic Salvia miltiorrhiza plants
[0063] petiole number of seedlings rooted seedlings positive seedlings 12 24 16 14 15 28 14 12 16 25 12 9 leaf blade number of seedlings rooted seedlings positive seedlings 12 16 12 11 13 20 18 16 14 18 12 10
[0064] From the above results, it can be seen that the budding time is short during the whole tissue culture breeding period, the explant material is changed to T3 medium, and the budding starts at 15-20 days, and the budding lasts for 10-15 days. The tissue culture seedlings can be directly transplanted to sterile soil for rooting in 25-35 days, without the need for acclimatization, which is convenient, fast and low in cost. Compared with the conventional method, the acclimatization step before transplanting is saved, not only the positive transgenic Salvia miltiorrhiza plants are obtained quickly and efficiently, but also the plant positive rate is very high. According to the calculation method of the number of positive seedlings / the number of rooted seedlings, it is close to 90%.
[0065] The beneficial effects of the present application are illustrated by the following test examples:
[0066] Test Example 1: Study on the medium for transgenic Salvia miltiorrhiza tissue culture breeding
[0067] 1. Screening of callus culture medium
[0068] 1.1 Method
[0069] 1) Take the leaves of Salvia miltiorrhiza and cut them into squares with a side length of 0.5 cm. Cut the Salvia miltiorrhiza petioles into lengths of 0.6-0.8 cm and place them in different T1 media for dark culture for 2 days at a temperature of 25°C.
[0070] 2) Take 2 mL of recombinant Agrobacterium strain with OD = 0.4, centrifuge at 4000 r / min for 10 min, take the solid and resuspend it in 40 mL of 1 / 2MS liquid to obtain a bacterial solution.
[0071] 3) Take the bacterial solution obtained in step 2) to infect the explant material obtained in step 1) for 10 min, then use filter paper to absorb the bacterial solution on the surface of the explant material, and place it in a new T1 medium at 25°C in the dark for 2 days.
[0072] The T1-A medium formula is: 4.74 g / L MS + 20 g / L sucrose + 1.0 mg / L 6-BA + 0.1 mg / L NAA + 8.0 g / L agar.
[0073] The T1-B medium formula is: 4.74 g / L MS + 20 g / L sucrose + 1.0 mg / L 6-BA + 0.5 mg / L NAA + 8.0 g / L agar.
[0074] The T1-C medium formula is: 4.74 g / L MS + 30 g / L sucrose + 1.0 mg / L 6-BA + 0.5 mg / L NAA + 8.0 g / L agar.
[0075] The T1-D medium formula is: 4.74 g / L MS + 30 g / L sucrose + 0.5 mg / L 6-BA + 0.5 mg / L NAA + 8.0 g / L agar.
[0076] 2.2 Results
[0077] petiole death effect T1-A 12 0 emerald green, no browning and no contamination T1-B 12 0 emerald green, no browning and no contamination T1-C 12 0 emerald green, no browning and no contamination T1-D 12 0 emerald green, no browning and no contamination leaf blade death effect T1-A 10 0 emerald green, no browning and no contamination T1-B 10 0 emerald green, no browning and no contamination T1-C 10 0 emerald green, no browning and no contamination T1-D 10 0 emerald green, no browning and no contamination
[0078] From the above results, it can be seen that the culture effects of T1-A, T1-B, T1-C and T1-D media have no obvious difference, and all can keep the petiole and leaf in a green state. It is possible that the culture time is relatively short in T1 medium, so there is no obvious difference. According to the principle of saving and environmental protection, the medium "T1-A" with the lowest concentration of sucrose and hormones is selected as the final T1 medium.
[0079] 2. Screening of proliferation medium
[0080] 2.1 Method
[0081] The explant material obtained by using T1-A medium under the item of "1. Screening of callus medium" is changed to T2 medium, and cultured at 25°C under the condition of 16h light / 8h dark for 8 days;
[0082] The T2-A medium formula is: 4.74g / L MS+20g / L sucrose+1.0mg / L 6-BA+0.1mg / L NAA+8g agar+400mg / L cefotaxime sodium.
[0083] The T2-B medium formula is: 4.74g / L MS+20g / L sucrose+1.0mg / L 6-BA+0.5mg / L NAA+7g agar+400mg / L cefotaxime sodium.
[0084] The T2-C medium formula is: 4.74g / L MS+20g / L sucrose+1.0mg / L 6-BA+0.1mg / L NAA+8g agar+300mg / L cefotaxime sodium.
[0085] The T2-D medium formula is: 4.74g / L MS+20g / L sucrose+1.0mg / L 6-BA+0.5mg / L NAA+7g agar+300mg / L cefotaxime sodium.
[0086] 2.2 Results
[0087]
[0088]
[0089] From the results, it can be seen that in T2-A medium: the two ends of the petiole swell in about 10 days, and the middle part of the petiole also swells, and the petiole becomes yellow-green; the edge of the leaf thickens obviously in about 12 days, the leaf green color weakens, and becomes yellow-green.
[0090] In T2-B medium: the petiole did not swell and did not form callus after 20-30 days of culture; the leaf edge appeared brown and finally died.
[0091] In T2-C and T2-D medium: nearly half of the medium appeared growth of Agrobacterium which could not be inhibited, which affected the callus formation of explants and resulted in yellowing of explants and finally death of explants.
[0092] From the comparison of the medium components and the growth of transgenic Salvia miltiorrhiza, it can be seen that: in T2-B medium, the concentration of NAA is too high to affect the regeneration of transgenic Salvia miltiorrhiza; in T2-C and T2-D medium, the concentration of sodium cefotaxime cannot completely inhibit the growth of Agrobacterium, thus cannot provide a safe and controllable growth environment for transgenic Salvia miltiorrhiza. In T2-A medium, the appropriate concentration of plant growth hormones 6-BA and NAA and antibiotic sodium cefotaxime provide a suitable growth environment for transgenic Salvia miltiorrhiza callus, which has the best culture effect, and the petiole and leaf can swell, and the excellent growth is suitable for the next step of rooting.
[0093] 3. Selection of germination medium
[0094] 3.1 Method
[0095] Take the material on T2-A medium and culture it on T3 medium for 25-35 days, wherein the T3-A medium formula is: 4.74 g / L MS + 0.25 mg / L 6-BA + 0.1 mg / L NAA + 0.1 mg / L GA3 + 30 g / L sucrose + 8.5 g / L agar + 300 mg / L sodium cefotaxime
[0096] T3-B medium formula: 4.74 g / L MS + 0.25 mg / L 6-BA + 0.1 mg / L NAA + 0.1 mg / L GA3 + 30 g / L sucrose + 8.5 g / L agar + 300 mg / L sodium cefotaxime + 200 mg / L kanamycin sulfate
[0097] T3-C medium formula: 4.74 g / L MS + 0.25 mg / L 6-BA + 0.1 mg / L NAA + 0.1 mg / L GA3 + 30 g / L sucrose + 8.5 g / L agar + 300 mg / L sodium cefotaxime + 50 mg / L hygromycin
[0098] T3-D medium formula: 4.74 g / L MS + 0.25 mg / L 6-BA + 0.1 mg / L NAA + 0.1 mg / L GA3 + 30 g / L sucrose + 8.5 g / L agar + 300 mg / L sodium cefotaxime + 50 mg / L kanamycin sulfate + 50 mg / L hygromycin
[0099] 3.2 Results
[0100]
[0101] From the results, it can be seen that in T3-A medium: all the sprouts grown from the edges of the leaf blades can grow normally; in T3-B medium: a small amount of sprouts cannot grow normally, and after budding, they do not grow for a long time or even die, with a mortality rate of about 28%; in T3-C medium: a small amount of sprouts cannot grow normally, and after budding, they do not grow for a long time or even die, with a mortality rate of about 20%; in T3-D medium: a large amount of sprouts cannot grow normally, and after budding, they do not grow for a long time or even die, with a mortality rate of about 55%.
[0102] The medium without the addition of antibiotics "kanamycin sulfate and hygromycin" (T3-A) does not have the phenomenon of sprout death, but the positive rate is low, about 20%; the medium with the addition of kanamycin sulfate (T3-B) has an improved positive rate, about 50%; the medium with the addition of hygromycin (T3-C) has the highest positive rate, about 90%; the medium with the addition of antibiotics "kanamycin sulfate and hygromycin" (T3-D) has a large amount of sprouts that cannot grow normally or die, but has a higher positive rate, about 95%. It is also found in the early experiments that when only hygromycin is added without the addition of cefotaxime sodium, a large amount of Agrobacterium will grow uncontrollably within a few days, leading to the death of sprouts; on the basis of the T3-C medium with the best comprehensive performance of survival rate and positive rate, adjusting the proportions of plant growth hormones NAA, GA3, and antibiotics cefotaxime sodium and hygromycin cannot achieve similar excellent comprehensive performance of survival rate and positive rate. Therefore, the T3-C medium is used as the medium for the budding of transgenic salvia miltiorrhiza callus.
[0103] 3. Obtaining of transgenic salvia miltiorrhiza plants
[0104] The tissue culture seedlings with a length of more than 1.5 cm in the T3-C medium are transplanted into sterile nutrient soil containing rooting powder (1 L of 0.5 g / L rooting powder solution is mixed with 1 kg of sterile soil), sterile cultured for 5 days, the bottle cap is opened for continued culture for 10 days, and 25°C 16h light / 8h darkness is provided, to obtain transgenic salvia miltiorrhiza plant lines; leaf blades are taken for DNA extraction for PCR identification of positive plants.
[0105] The survival rate and positive rate of salvia miltiorrhiza plants obtained by cultivation according to the above method are as follows:
[0106] The seedlings with four leaves were transplanted into the sterile soil with the rooting powder, the number of seedlings was counted, the leaves were taken after 15 days of culture, the DNA was extracted for PCR identification of positive plants, and the number was counted to calculate the positive rate (positive rate = number of positive plants / number of seedlings). After 30 days of culture, the number of surviving positive plants and non-positive plants was counted, and the survival rate of seedlings in sterile soil was counted (survival rate = (number of positive plants + number of non-positive plants) / number of seedlings).
[0107] Positive rate = 32 (number of positive plants) / 43 (number of seedlings) ≈ 74.42%
[0108] Survival rate = 40 (number of positive plants + number of non-positive plants) / 43 (number of seedlings) ≈ 93.02%.
[0109] 4. Discussion
[0110] In the SmPYL4 transgenic salvia cultivation stage, the callus sprouted in a short time, and the transplanted seedlings did not need to be acclimated, which was convenient, fast, low-cost, and had high positive rate and survival rate. In order to investigate whether the culture medium and cultivation method of the transgenic salvia were applicable to other transgenic salvia, the recombinant agrobacterium with SmSUS1 gene was cultivated by the same method, and the positive rate and survival rate were counted. The effect was the same, the positive rate = 25 (number of positive plants) / 33 (number of seedlings) ≈ 75.76%; the survival rate = 29 (number of positive plants + number of non-positive plants) / 33 (number of seedlings) ≈ 87.88%.
[0111] CDS sequence of SmSUS1 (SEQ ID NO. 4):
[0112]
[0113] The tissue culture breeding method of the transgenic Danshen of the present application can make the whole tissue culture breeding period of Danshen short through specific culture medium and corresponding culture method, and can quickly and efficiently obtain positive transgenic Danshen plants without the seedling training step before transplanting, and the positive rate of the plants is extremely high, and the method has practical popularization and application value.
Claims
1. A method for propagating transgenic Salvia miltiorrhiza through tissue culture, characterized by: It includes the following steps: 1) Take leaves or petioles of Salvia miltiorrhiza and culture them in T1 medium to obtain explant material; 2) taking the explant material obtained in step 1), infecting it with recombinant Agrobacterium, and culturing it in T1 medium for 1-3 days, T2 medium for 5-10 days, and T3 medium until seedlings emerge; 3) Taking the tissue culture seedlings obtained in step 2), planting them in sterile soil containing rooting powder, culturing them aseptically and then culturing them in a non-sterile environment to obtain transgenic Salvia miltiorrhiza; The T1 medium was prepared from the following raw materials at the final concentration: 4-6 g / L MS, 10-30 g / L sucrose, 1-2 mg / L 6-BA, 0.05-0.15 mg / L NAA, 6-10 g / L agar, and the rest is water; The T2 medium is prepared from the following raw materials at the final concentration: 4-6 g / L MS, 10-30 g / L sucrose, 1-2 mg / L 6-BA, 0.05-0.15 mg / L NAA, 6-10 g / L agar, 200-400 mg / L cefotaxime sodium, and the rest is water; The T3 culture medium is prepared from the following raw materials at the final concentration: 4-6g / L MS, 0.2-0.5mg / L 6-BA, 0.05-0.15mg / L NAA, 0.05-0.15mg / L GA3, 20-40g / L sucrose, 8-10g / L agar, 200-400mg / L ceftriaxone sodium, 40-50mg / L hygromycin, and the rest is water.
2. The tissue culture breeding method according to claim 1, wherein: The T1 medium was prepared from the following raw materials at the final concentration: 4.74 g / L MS, 20 g / L sucrose, 1.0 mg / L 6-BA, 0.1 mg / L NAA, 8.0 g / L agar, and the rest is water; The T2 medium is prepared from the following raw materials at the final concentration: 4.74 g / L MS, 20 g / L sucrose, 1.0 mg / L 6-BA, 0.1 mg / L NAA, 8 g / L agar, 400 mg / L cefotaxime sodium, and the rest is water; The T3 culture medium is prepared from the following raw materials at the final concentration: 4.74 g / L MS, 0.25 mg / L 6-BA, 0.1 mg / L NAA, 0.1 mg / L GA3, 30 g / L sucrose, 8.5 g / L agar, 300 mg / L ceftriaxone sodium, 50 mg / L hygromycin, and the rest is water.
3. The method for tissue culture propagation of transgenic Salvia miltiorrhiza according to claim 1, characterized in that: The culture in step 1) is carried out at 22-28° C. in the dark for 2-3 days, preferably at 25° C. for 2 days.
4. The method for tissue culture propagation of transgenic Salvia miltiorrhiza according to claim 1, characterized in that: Step 2) The explant material is cultured in T1 medium under the following conditions: 22-28° C. in the dark for 2-3 days, preferably 25° C. in the dark for 2 days; The culture conditions in T2 medium are: 22-28°C, 16h light / 8h dark for 6-10 days, preferably 25°C, 16h light / 8h dark for 8 days; The culture conditions in T3 medium were: 25°C, 16 h light / 8 h dark; the medium was changed every 10-14 days.
5. The method for tissue culture propagation of transgenic Salvia miltiorrhiza according to claim 1, characterized in that: Step 3) The sterile soil contains 0.5 g of rooting powder per kg; the sterile culture conditions are: 25° C., 16 h light / 8 h dark culture, and a culture time of 3 to 7 days, preferably 5 days.
6. The method for tissue culture propagation of transgenic Salvia miltiorrhiza according to claim 1, characterized in that: Step 2) The infection method is as follows: centrifuge the recombinant Agrobacterium strain, resuspend the solid in 1 / 2MS with a concentration of 2.37 g / L to obtain a bacterial solution; immerse the explant material in the bacterial solution, remove it, and then dry the surface bacterial solution.
7. The method for tissue culture propagation of transgenic Salvia miltiorrhiza according to claim 6, characterized in that: The volume ratio of the recombinant Agrobacterium strain to 1 / 2MS was 2:40; the centrifugation speed was 4000 r / min, and the time was 10 min.
8. The method for tissue culture propagation of transgenic Salvia miltiorrhiza according to claim 6, characterized in that: The immersion time is 10 minutes.
9. The method for tissue culture propagation of transgenic Salvia miltiorrhiza according to claim 1 or 8, characterized in that: The recombinant Agrobacterium strain is Agrobacterium tumefaciens GV3101 integrated with exogenous genes.
10. The method for tissue culture propagation of transgenic Salvia miltiorrhiza according to claim 9, characterized in that: The exogenous gene includes the SmPYL4 gene or the SmSUS1 gene; the CDS sequence of the SmPYL4 gene is shown in SEQ ID NO.1; the CDS sequence of the SmSUS1 gene is shown in SEQ ID NO.4.
Citation Information
Patent Citations
Gene SmPIN3 for controlling morphology of root system of salvia miltiorrhiza and application thereof
CN116875615A