Nucleic acid vaccine adjuvant based on tRNALeu and / or tRNAGln as well as preparation method and application of nucleic acid vaccine adjuvant

By constructing a nucleic acid vaccine adjuvant based on tRNALeu and tRNAGln and activating TLR3, the problem of poor immune response activation of existing porcine reproductive and respiratory syndrome vaccine adjuvants was solved, and efficient cellular immune response and antibody level enhancement were achieved with low toxicity and low immunogenicity.

CN120789232APending Publication Date: 2025-10-17RNALINK BIOLOGICAL TECHNOLOGY CO LTD (XIAN CHINA)
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510943543.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-09
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

Existing porcine reproductive and respiratory syndrome vaccine adjuvants are not effective in activating the body's immune response, especially aluminum preparations are unable to participate in cellular immune responses, and local reactions are severe, resulting in high morbidity rates in pig herds and prominent issues with vaccine safety and effectiveness.

Method used

A nucleic acid vaccine adjuvant based on tRNALeu and/or tRNAGln is used, and recombinant sequences tRNALeu-SA and tRNAGln-SA are constructed through chimeric glucan nucleic acid aptamers. The expression vector is constructed using pBSMrna plasmid, and efficient delivery is achieved through lipid nanoparticle encapsulation to activate TLR3 and activate cellular immune response.

Benefits of technology

It significantly improves the protective effect of the vaccine, enhances antibody levels, activates TLR3 and greatly enhances cellular immune response. It also has low toxicity and low immunogenicity, reducing damage to organisms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120789232A_ABST
    Figure CN120789232A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of immunology and vaccinology, and particularly relates to a nucleic acid vaccine adjuvant based on tRNALeu and / or tRNAGln as well as a preparation method and application of the nucleic acid vaccine adjuvant. The nucleic acid vaccine adjuvant contains a recombinant sequence tRNALeu-SA of a chimeric nucleic acid aptamer, wherein the recombinant sequence tRNALeu-SA takes human active tRNALeu as a bracket; and / or a recombinant sequence tRNAGln-SA of the nucleic acid aptamer, which takes human-derived active tRNAGln as a bracket, is embedded into the human-derived active tRNAGln; the sequence of the human-derived active tRNALeu is a sequence with the similarity of more than 90% with SEQ ID NO.1; the sequence of the human-derived active tRNAGln is a sequence of which the similarity with SEQ ID NO.2 reaches 90% or above. The nucleic acid vaccine adjuvant obtained by the preparation method has low toxicity and low immunogenicity, can activate TLR3 and induce high-level antibody and cellular immune response, and significantly improves the immune effect of vaccines.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of immunology and vaccinology, and particularly relates to a tRNA Leu and / or tRNA Gln based nucleic acid vaccine adjuvant, and a preparation method and application thereof. BACKGROUND

[0002] Porcine reproductive and respiratory syndrome, commonly known as blue ear disease, is an acute infectious disease with high contact characteristics, and its pathogen is porcine reproductive and respiratory syndrome virus (PRRSV). Porcine reproductive and respiratory syndrome first broke out in California, USA in 1987, and was characterized by a large increase in weak and dead piglets, a large increase in the mortality rate of newborn and lactation piglets, severe pneumonia in piglets, and a sharp decline in growth rate. PRRSV is an enveloped positive-strand RNA virus that is released into the cytoplasm after endosomal acidification and membrane fusion through standard grid protein-mediated endocytosis. In 2006, highly pathogenic PRRSV broke out in China, resulting in the disposal of more than 20 million pigs in China, causing significant economic losses to China's pig industry.

[0003] Vaccines are one of the most important measures to prevent porcine reproductive and respiratory syndrome, and there are currently a variety of types of vaccines on the market, including traditional inactivated vaccines and attenuated vaccines, as well as some new vaccines being developed for the prevention of blue ear disease. However, the prevalence rate in pig populations is still high, and the control effect of vaccination is limited. Current strategies for controlling PRRSV virus infection are largely inadequate, and licensed vaccines also have many safety and effectiveness issues. Vaccine adjuvants are substances that can non-specifically enhance or change the specific immune response of the body to matching antigens, enhance the immunogenicity of antigens, or change the type of immune response, but they are not antigenic in themselves. Adjuvants can activate the body's innate immune system and help antigens to be better taken up and presented by antigen-presenting cells. For vaccines, adjuvants have become the key to success. After nearly a century of research, vaccine adjuvants have developed from the original aluminum salt adjuvants to a variety of new adjuvants, such as oil-water emulsions, liposomes, proteins, and nucleic acids. Various types of vaccine adjuvants are widely used in clinical practice. However, the adjuvant currently used in blue ear disease vaccines is still an aluminum preparation, which produces a weaker immune response compared to other adjuvants used, and cannot participate in cellular immune responses, resulting in a heavy local reaction.

[0004] tRNA is closely related to immune activation and plays an important role in the activation and expansion of T cells. In particular, m1A modification promotes the synthesis of key proteins by enhancing translation efficiency, thereby ensuring rapid immune response of T cells. Studies have found that Asp-tRNA, Gln-tRNA, Glu-tRNA and Leu-tRNA are related to the immune process of host macrophage uptake, so two adjuvant sequences can be designed as new immune adjuvants to activate TLR and applied in porcine reproductive and respiratory syndrome vaccines with poor efficacy, which breaks through the defects of traditional vaccine adjuvants such as safety and mechanism, activates pattern recognition receptors to continuously produce high levels of antibodies, and becomes a new direction of porcine reproductive and respiratory syndrome vaccine adjuvant research. At present, there is no nucleic acid agonist of TLR receptor as a vaccine adjuvant applied in porcine reproductive and respiratory syndrome. SUMMARY

[0005] The first object of the present application is to provide a tRNA Leu and / or tRNA Gln based nucleic acid vaccine adjuvant.

[0006] The second object of the present application is to provide a preparation method of the nucleic acid vaccine adjuvant.

[0007] The third object of the present application is to provide application of the nucleic acid vaccine adjuvant in preparation of porcine reproductive and respiratory syndrome vaccine.

[0008] In order to achieve the above objects, the technical scheme adopted by the present application is:

[0009] A tRNA Leu and / or tRNA Gln based nucleic acid vaccine adjuvant, the nucleic acid vaccine adjuvant contains a recombinant sequence tRNA Leu -SA of chimeric Sephadex aptamer (SA) taking human active tRNA Leu as a scaffold; and / or a recombinant sequence tRNA Gln -SA of chimeric Sephadex aptamer taking human active tRNA Gln as a scaffold.

[0010] The sequence of the human active tRNA Leu is a sequence with a similarity of more than 90% to SEQ ID NO. 1; the sequence of the human active tRNA Gln is a sequence with a similarity of more than 90% to SEQ ID NO. 2; the sequence of the tRNA Leu is shown in SEQ ID NO. 1; and the sequence of the tRNAGln The sequence of the tRNA-SA is shown as SEQ ID NO. 3; and the sequence of the tRNA-SC is shown as SEQ ID NO. 4.

[0011] SEQ ID NO. 1:

[0012] ACCAGGAUGGCCGAGUGGUUAAGGCGUUGGACUUAAGAUCCAAUGGACAUAUGUCCGCGUGGGUUCGAACCCCACUCCUGGUACCA;

[0013] SEQ ID NO. 2:

[0014] GGUCCCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGGACCUCCA.

[0015] Preferably, the recombinant sequence tRNA-SA Leu -SA is a sequence with similarity of 90% or more to SEQ ID NO. 3; and the recombinant sequence tRNA-SC Gln -SA is a sequence with similarity of 90% or more to SEQ ID NO. 4;

[0016] The recombinant sequence tRNA-SA Leu -SA is shown as SEQ ID NO. 3; and the sequence of the tRNA-SC is shown as SEQ ID NO. 4. Gln -SA is shown as SEQ ID NO. 3; and the sequence of the tRNA-SC is shown as SEQ ID NO. 4.

[0017] SEQ ID NO. 3:

[0018] ACCAGGAUGGCCGAGUGGUUAAGGCGUUGGACUAGUAAUUUACGUCGACGGUG ACGUCGAUGGUUGCGGGAUCCAAUGGACAUAUGUCCGCGUGGGUUCGAACCCCACU CCUGGUACCA;

[0019] SEQ ID NO. 4:

[0020] GGUCCCAUGGUGUAAUGGUUAGCACUCUGGACUAGUAAUUUACGUCGACGGUG ACGUCGAUGGUUGCGGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGGACCUCCA.

[0021] Preferably, the nucleic aptamer is an inactive aptamer; the sequence of the inactive aptamer is shown as SEQ ID NO. 5;

[0022] SEQ ID NO.5:

[0023] AGTAATTTACGTCGACGGTGACGTCGATGGTTGCGG.

[0024] The preparation method of the nucleic acid vaccine adjuvant described above is as follows:

[0025] S1: The nucleic acid aptamer is respectively chimeric to the anticodon loop of the human active tRNA Leu and tRNA Gln described above, and the recombinant sequence tRNA Leu -SA, the recombinant sequence tRNA Gln -SA is synthesized; Leu -SA, the recombinant sequence tRNA Gln -SA is inserted into the pBSMrna plasmid by using the enzyme cutting site on the pBSMrna plasmid, and the expression vector of the recombinant tRNA Leu -SA, the expression vector of the recombinant tRNA Gln -SA is constructed;

[0026] S2: The expression vector of the recombinant tRNA Leu -SA, the expression vector of the recombinant tRNA Gln -SA is respectively transformed into the E. coli competent cell, and the recombinant strain is obtained, which is amplified and cultured in the culture medium, and the bacterial liquid tRNA Leu -SA, the bacterial liquid tRNA Gln -SA is obtained respectively;

[0027] S3: The total RNA of the bacterial liquid tRNA Leu -SA, the bacterial liquid tRNA Gln -SA in step S2 is respectively extracted and purified by FPLC, and the recombinant tRNA Leu -SA, the recombinant tRNA Gln -SA is obtained respectively.

[0028] Preferably, the enzyme cutting site of the pBSKrna plasmid in step S1 is Eag I and Sac II.

[0029] Preferably, the E. coli competent cell in step S2 is HST08 or DH5α competent cell; and the culture medium is LB culture medium or TB culture medium.

[0030] Preferably, the following steps are further included: the recombinant tRNA Leu -SA, the recombinant tRNAGln -SA.

[0031] The nucleic acid vaccine adjuvant described above is applied in the preparation of a porcine reproductive and respiratory syndrome vaccine.

[0032] The beneficial technical effects of the present application are that:

[0033] The nucleic acid vaccine adjuvant of the present application contains a recombinant sequence tRNA Leu -SA as a scaffold, and a chimeric nucleic acid aptamer. Leu -SA; and / or a recombinant sequence tRNA Gln -SA as a scaffold, and a chimeric nucleic acid aptamer. Gln -SA, respectively. Leu -SA, respectively. Gln -SA, respectively. Leu -SA expression vector, and the recombinant tRNA Gln -SA expression vector; efficient delivery of the recombinant RNA can be achieved by encapsulation with lipid nanoparticles. The nucleic acid vaccine adjuvant of the present application has good biological activity and adjuvant effect, and can greatly improve the protective effect of the vaccine by activating TLR3 at the molecular, cellular and animal levels, while also improving the antibody level and enhancing cellular immunity. In addition, the adjuvant of the present application has low toxicity and low immunogenicity, and reduces damage to organisms. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 Denaturing polyacrylamide gel electrophoresis for identification of recombinant tRNA Leu -SA and tRNA Gln -SA expression results;

[0035] Figure 2 Chromatogram for purification of recombinant tRNA Leu -SA by PFLC and purity chart for identification of collected components by denaturing polyacrylamide gel electrophoresis;

[0036] Figure 3 Chromatogram for purification of recombinant tRNA Gln -SA by PFLC and purity chart for identification of collected components by denaturing polyacrylamide gel electrophoresis;

[0037] Figure 4 Chart of changes in the content of cytokine TNF-α in Marc-145 cells after transfection with tRNA Leu -SA adjuvant and infection with virus;

[0038] Figure 5For tRNA transfection Leu Figure of the results of the changes in the content of the cytokine IFN-β in Marc-145 cells after transfection with -SA adjuvant and infection with virus

[0039] Figure 6 For tRNA transfection Leu Figure of the results of the changes in the content of the cytokine IL-6 in Marc-145 cells after transfection with -SA adjuvant and infection with virus

[0040] Figure 7 For tRNA transfection Leu Figure of the results of the changes in the content of the cytokine IFN-γ in Marc-145 cells after transfection with -SA adjuvant and infection with virus

[0041] Figure 8 For tRNA transfection Gln Figure of the results of the changes in the content of the cytokine TNF-α in Marc-145 cells after transfection with -SA adjuvant and infection with virus

[0042] Figure 9 For tRNA transfection Gln Figure of the results of the changes in the content of the cytokine IFN-β in Marc-145 cells after transfection with -SA adjuvant and infection with virus

[0043] Figure 10 For tRNA transfection Gln Figure of the results of the changes in the content of the cytokine IL-6 in Marc-145 cells after transfection with -SA adjuvant and infection with virus

[0044] Figure 11 For tRNA transfection Gln Figure of the results of the changes in the content of the cytokine IRF-3 in Marc-145 cells after transfection with -SA adjuvant and infection with virus

[0045] Figure 12 For transfection of recombinant tRNA Leu -SA and tRNA Gln Figure of the results of the expression and distribution of NF-κB in Marc-145 cells after transfection with -SA adjuvant and infection with virus

[0046] Figure 13 For transfection of recombinant tRNA Leu -SA and tRNA Gln Figure of the results of the activation of the IRF-3 signaling pathway in Marc-145 cells after transfection with -SA adjuvant and infection with virus

[0047] Figure 14 For transfection of recombinant tRNA Leu -SA and tRNA GlnFigure 2 shows the viral titer curve of PRRSV in the presence of Sephadex aptamer (SA) and after infection.

[0048] Figure 15 Figure 3 shows the results of PEG-LNP encapsulation of tRNA Leu -SA or tRNA Gln Figure 4 shows the results of encapsulation of Sephadex aptamer (SA) in tRNA

[0049] Figure 16 Figure 5 shows the results of PEG-LNP encapsulation of tRNA Leu -SA and tRNA Gln Figure 6 shows the results of the zeta particle size range of Sephadex aptamer (SA) in tRNA

[0050] Figure 17 Figure 7 shows the results of inactivated vaccine infection with recombinant tRNA Leu -SA and tRNA Gln Figure 8 shows the concentration change of PRRSV specific IgG antibody in rat serum after Sephadex aptamer (SA) adjuvant. DETAILED DESCRIPTION

[0051] The technical solutions of the present application are further described below in conjunction with the specific embodiments. However, those skilled in the art should understand that the following examples are only used to illustrate the present application, and should not be regarded as limiting the present application. The specific conditions not mentioned in the examples are carried out according to the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used, if not specifically mentioned, are conventional products obtained through normal channels.

[0052] Example 1

[0053] A nucleic acid vaccine adjuvant based on tRNA Leu and tRNA Gln scaffold

[0054] (1) Retrieve tRNA Leu and tRNA Gln genomic sequences in the gene database of NBCI website (https: / / www.ncbi.nlm.nih.gov / ).

[0055] The sequence of the inactivated aptamer Sephadex aptamer (SA) (SEQ ID NO. 5) was respectively chimeric to the tRNA Leu (SEQ ID NO. 1) and tRNA Gln (SEQ ID NO. 2) scaffold anticodon loop (Table 1), and the recombinant tRNA Leu -Sephadex aptamer (recombinant tRNA Leu -SA) and tRNA GlnSephadex aptamer sequence (recombinant tRNA Gln -SA).

[0056] (2) Using CentroidFold (http: / / www.ncrna.org / centroidfold) online prediction tool to predict the secondary structure of designed recombinant tRNA Leu -SA and tRNA Gln -SA sequence, by adjusting the position of Sephadex aptamer chimeric, the resulting chimeric sequence is similar to SEQ ID NO. 3 more than 90% sequence, similar to SEQ ID NO. 4 more than 90% sequence. Select the sequence with the optimal secondary structure tRNA Leu -SA (SEQ ID NO. 3) and tRNA Gln -SA (SEQ ID NO. 4) to construct the recombinant expression plasmid. Using the Eag I, Sac II restriction endonuclease cleavage site of pBSKrna plasmid, respectively, the recombinant sequence tRNA Leu -SA and the recombinant sequence tRNA Gln -SA into pBSKrna plasmid, construct the expression vector of recombinant tRNA Leu -SA, the expression vector of recombinant tRNA Gln -SA.

[0057] Table 1 Sequence Listing

[0058]

[0059]

[0060] (3) The expression vector of recombinant tRNA Leu -SA constructed in step (2), the expression vector of recombinant tRNA Gln -SA, respectively, into E. coli HST08 competent cells, obtain recombinant strains, add 8 mL LB medium, 37℃, 200 rpm shaking culture overnight amplification culture, respectively, obtain tRNA Leu -SA, tRNA Gln-SA; collect the bacterial slurry; resuspend the bacterial slurry with 180 μL of 10 mM magnesium acetate-Tris-HCl solution, add 200 μL of saturated phenol, shake at room temperature for 40 min, centrifuge at 10,000 g for 10 min; collect the water phase, add 0.1 times the volume of the water phase of 5 M NaCl solution to precipitate the macromolecular impurities; after collecting the supernatant again, add 2 times the volume of anhydrous ethanol, centrifuge at 10,000 g for 10 min, and discard the supernatant; remove the residual ethanol with water paper, dissolve the RNA in DEPC water after the RNA is dried, determine the concentration, and store the recombinant tRNA in a refrigerator at -80 °C Leu -SA and tRNA Gln -RNA sample of -SA.

[0061] Test Example 1

[0062] Denaturing polyacrylamide gel electrophoresis for identifying recombinant tRNA Leu -SA and tRNA Gln -Expression of -SA

[0063] The RNA sample prepared in Example 1 was mixed with the RNA loading buffer, and was added to the denaturing gel sample well. After electrophoresis at 100 V for 60 min, the sample was placed in a solution containing 0.5 μg / mL GelRed and was shaken gently for 20 min. The sample was observed under a gel imaging system and was photographed for preservation. The results are shown in Figure 1 .

[0064] The results are shown in Figure 1 , which are the results of denaturing polyacrylamide gel electrophoresis for identifying recombinant tRNA Leu -SA and tRNA Gln -Expression results of -SA. The thickness of the bands indicates the amount of expression, which shows that the recombinant tRNA Leu -SA and tRNA Gln -SA can be expressed in large amounts in E. coli.

[0065] Test Example 2

[0066] PFLC purification of recombinant tRNA Leu -SA and tRNA Gln -SA and denaturing polyacrylamide gel electrophoresis for identifying purity

[0067] (1) PFLC purification of recombinant tRNA Leu -SA and tRNA Gln -SA

[0068] Bio-Rad NGC TM Chromatography System was used, and an ion exchange column (ENrich TMQ10) Purification of recombinant tRNA Leu -SA and tRNA Gln -SA.

[0069] Mobile phase A: 10 mM NaH2PO4solution, pH 7.0.

[0070] Mobile phase B: 10 mM NaH2PO4solution, 1 M NaCl solution, pH 7.0.

[0071] The flow rate was 2.0 mL / min. The column was washed with DEPC water, mobile phase A, and mobile phase B, respectively, for about 1 h. Each time, 5 column volumes were used.

[0072] The following program was run for the separation of total RNA: 0-8 min (0% B), 8-13 min (55% B), 13-50 min (55-75% B), 50-70 min (100% B), 70-80 min (0% B). The RNA was detected by absorbance at 260 nm, and the recombinant tRNA Leu -SA and tRNA Gln -SA. The results are shown in Figure 2 A and Figure 3 A.

[0073] (2) RNA sample processing method

[0074] The total RNA extraction step was the same as in Example 1. After the extracted total RNA was centrifuged at 13000 rpm for 10 min at 4°C, the supernatant was filtered through a 0.45 μm microporous filter, and 7 mg was injected each time.

[0075] The RNA sample prepared in Example 1 was mixed with the RNA loading buffer and added to the denaturing gel sample well. After electrophoresis at 100 V for 60 min, it was placed in a solution containing 0.5 μg / mL GelRed and shaken gently for 20 min. It was observed under a gel imaging system and photographed for preservation. The results are shown in Figure 1 .

[0076] (3) FPLC component collection and concentration desalination

[0077] The purified recombinant tRNA collected was identified by denaturing polyacrylamide gel electrophoresis Leu -SA and tRNA GlnSA purity. The components were precipitated with 2 volumes of absolute ethanol, and the RNA was stored in a -80°C refrigerator for 0.5 h. The RNA was collected by centrifugation at 10,000 g, 4°C for 10 min. The resulting RNA precipitate was dissolved in DEPC water and centrifuged at 7,500 g, 4°C for 10 min using an ultrafiltration column. The filtrate was discarded, and the procedure was repeated until all the solution was centrifuged. The ultrafiltration column was then inverted and centrifuged at 2,000 g for 2 min, and the resulting solution was collected. The purity of the collected components was identified by denaturing polyacrylamide gel electrophoresis, and the results are shown in Figures 1-4. Figure 2 B and Figure 3 B.

[0078] Figure 2 and Figure 3 are the recombinant tRNA Leu -SA and tRNA Gln -SA, and the purity of the collected components was identified by denaturing polyacrylamide gel electrophoresis. Figure 2 A and Figure 3 A. The chromatograms show the positions of the target peaks and the collected components, and the results show that the recombinant tRNA Leu -SA and tRNA Gln -SA was well separated from other endogenous RNAs in E. coli, and further urea denaturing polyacrylamide gel electrophoresis identification showed that the recombinant tRNA Figure 2 B and Figure 3 B) was well purified. Leu -SA and tRNA Gln -SA, the band was single, and there was no impurity band or tailing phenomenon, indicating that the recombinant tRNA Leu -SA and tRNA Gln -SA was well purified, i.e., after FPLC purification, pure recombinant tRNA Leu -SA and tRNA Gln -SA.

[0079] Test Example 3

[0080] Transfection of tRNA Leu -SA and tRNA Gln -EFFECT OF tRNA-SA ADJUVANT ON THE CONTENT OF CYTOKINES AFTER PRRSV INFECTION OF MARC-145 CELLS

[0081] Total RNA was extracted from Marc-145 cells transfected with the adjuvant and inactivated virus for real-time fluorescent quantitative PCR analysis. The expression levels of cytokines TNF-α, IFN-β, IFN-γ, and IL-6 were detected, and the specific steps were as follows:

[0082] (1) Cell transfection

[0083] Marc-145 cells were seeded at 5 x 105cells / well in 6-well plates. Cells were divided into Blank, tRNA 4 -SA and tRNA Leu -SA groups, and cell transfection was performed according to the Pvam instruction manual. The transfection concentration of tRNA Gln -SA and tRNA Leu -SA was 20 nM, and 24 h after transfection, both groups were infected with PRRSV (3 x 105PFU / mL, TCID50method). Gln 6 PFU / mL, TCID50method).

[0084] (2) RNA extraction

[0085] According to the E.Z.N.A. Total RNA Kit I kit instructions, the RNA of the transfected Marc-145 cells was extracted, the concentration was determined, and it was stored in a refrigerator at -80°C for standby use.

[0086] (3) qPCR detection of cytokine content

[0087] The extracted mRNA was reverse transcribed into cDNA using the TAKARA reverse transcription kit. The reverse transcription conditions were: 37°C / 15 min; 80°C / 15 s. The qPCR was used to detect the changes in the contents of the cytokines TNF-a, IFN-b, IFN-g, IL-6, and IRF-3 in each group. The qPCR running program is shown in Table 2; and the primer sequences for the cytokine content detection are shown in Table 3.

[0088] Table 2 qPCR running program

[0089] Pre-denaturation Denaturation Annealing / extension 95℃,30s 95℃,10s 60℃,30s

[0090] Table 3 Primer sequences for cytokine content detection

[0091]

[0092] The results are shown in Figure 4 , Figure 5 , Figure 6 , Figure 7 , Figures 4-7 The changes in the contents of the cytokines TNF-a, IFN-b, IL-6, and IFN-g in Marc-145 cells after transfection with tRNA Leu -SA adjuvant and virus infection. The results showed that, compared with the Blank group, the expression levels of the classical pro-inflammatory cytokines TNF-a, IFN-b, and IL-6 in the tRNA Leu -SA group were significantly increased, and the expression level of the interferon IFN-g in the tRNA Leu -SA group was also significantly increased.​

[0093] Results as shown in Figure 8 , Figure 9 , Figure 10 , Figure 11 , Figures 8-11 The contents of TNF-α, IFN-β, IL-6 and IRF-3 in Marc-145 cells after transfection and infection of viruses with tRNA Gln -SA adjuvant. The results showed that the expression levels of the classical pro-inflammatory cytokines TNF-α, IFN-β and IL6 and the expression level of the transcription factor IRF-3 were significantly increased in the tRNA Leu -SA and tRNA Gln -SA groups compared with the Blank group.

[0094] In summary, tRNA Leu -SA and tRNA Gln -SA adjuvants may activate the downstream signaling pathway by activating TLR3, thereby enhancing the pro-inflammatory response of Marc-145 cells and improving the immune cell function activity of the cells.

[0095] Test Example 4

[0096] Effect of tRNA Leu -SA and tRNA Gln -SA adjuvants on the activation of the downstream signal of TLR3 receptor after PRRSV infection of Marc-145 cells

[0097] The expression and distribution changes of two transcription factors NF-κB and IRF3, which are key molecules of the downstream signaling pathway of TLR3, were further detected by immunofluorescence experiment with tRNA Leu -SA and tRNA Gln -SA. The specific steps are as follows:

[0098] (1) Cell inoculation

[0099] On the first day, sterile 14mm cell slides were placed in a 24-well plate, 0.5mL of 0.1% polylysine was added to each well, and the plate was left to stand at room temperature overnight. On the second day, the polylysine in the well plate was discarded, and the cell slides were washed with sterile PBS three times. Cells were inoculated into the well plate at 1x10 4 cells / well, and the plate was incubated in a 37°C, 5% CO2 incubator.

[0100] (2) Adjuvant transfection and virus infection

[0101] The cells were divided into Blank, Al salt adjuvant positive control group, tRNA Leu -SA treatment group and tRNA GlnSA treatment group. Cell transfection was performed according to the operation manual of Pvam, tRNA Leu SA treatment group and tRNA Gln The transfection concentration of the SA treatment group was 20 nM. After 24 h of transfection, the four groups were respectively infected with PRRSV (3 x 10 6 PFU / mL, TCID50 method).

[0102] (3) Cell fixation

[0103] Discard the cell culture medium, wash with PBS for three times, add 500 μL 4% paraformaldehyde fixing solution to the culture plate, fix at room temperature for 30 min, discard the paraformaldehyde, and wash with PBS for three times.

[0104] (4) Membrane breaking and blocking

[0105] Remove the residual PBS in the culture plate, add 1 mL 0.5% Triton X-100, and place at room temperature for 20 min, wash with PBS for three times, each for 5 min, add 1 mL 3% BSA blocking solution to the culture plate, and block at room temperature for 1 h.

[0106] (5) Incubate the antibody

[0107] Discard the blocking solution, dilute the antibody according to the proportion according to the antibody instruction, add NF-κB or IRF-3 primary antibody to the 24-well plate, and incubate at 4°C overnight. Wash with PBS for three times, each for 5 min, add 1:500 fluorescent secondary antibody to the 24-well plate, wrap with tin foil to avoid light, and incubate at room temperature on a horizontal shaker for 1 h.

[0108] (6) Nucleus staining and mounting

[0109] Discard the fluorescent secondary antibody, wash with PBS for three times, each for 5 min, add 500 μL DAPI staining solution to each well, avoid light, and incubate at room temperature on a horizontal shaker for 10 min, discard the DAPI, and wash with PBS for three times, each for 5 min; perform mounting treatment; finally, observe and take pictures under a laser scanning confocal microscope.

[0110] The results are shown in the following table: Figure 12 The expression and distribution of NF-κB in Marc-145 cells after tRNA Leu -SA and tRNA Gln-SA adjuvant transfection and PRRSV infection were detected by immunofluorescence experiment. The results showed that the overall fluorescence intensity of NF-κB in the Al salt adjuvant positive control group, the tRNA Leu -SA treatment group and the tRNA Gln -SA treatment group was higher than that in the Blank group, indicating that the Al salt adjuvant, tRNA Leu -SA and tRNAGln -SA promoted the expression of NF-κB; it was shown that Al salt adjuvant, tRNA Leu -SA and tRNA Gln -SA could promote the nuclear entry of NF-κB; at the same time, tRNA Leu -SA group and tRNA Gln The fluorescence intensity of NF-κB in the nucleus in the tRNA Leu -SA and tRNA Gln -SA promoted the nuclear entry of NF-κB more obviously.

[0111] The results are shown in the following table: Figure 13 tRNA Leu -SA and tRNA Gln After transfection with tRNA Leu -SA and tRNA Gln -SA, the fluorescence intensity of IRF-3 in the two treatment groups was significantly enhanced; at the same time, tRNA Leu -SA group and tRNA Gln The fluorescence intensity of IRF-3 in the nucleus in the tRNA Leu -SA and tRNA Gln -SA promoted the expression of IRF-3 more obviously. It was shown that tRNA Leu -SA and tRNA Gln -SA activated IRF3 and promoted its dimerization into the nucleus.

[0112] In summary, in Marc-145 cells, tRNA Leu -SA and tRNA Gln -SA respectively activated TLR3 to further activate the downstream NF-κB and IRF-3 related molecular pathways.

[0113] Test Example 5

[0114] Transfection with tRNA Leu -SA and tRNA Gln Effect of tRNA

[0115] (1) Construction of standard curve between viral gene copy number and Ct value

[0116] Virus titer was determined using the external standard method. PEGF-C1 was used as an empty vector, into which a highly conserved viral sequence, ORF2, was inserted to construct a recombinant expression vector. Primers, designated ORF2, were designed targeting the conserved ORF2 sequence and used for qPCR detection of the ORF2 gene fragment. A standard curve was generated using qPCR to compare plasmid copy number with the Ct value, which was then used to calculate the titer in the supernatant.

[0117] (2) Extraction of viral RNA (EZNA Viral RNA Kit)

[0118] Marc-145 cells were seeded at 5×10⁴ cells / well in a 6-well plate. Cell transfection was performed according to the Pvam manufacturer's instructions, using a 20 nM 3'PRRSV transfection concentration. 24 hours after transfection, Marc-145 cells were infected with the virus. Supernatants were collected and viral RNA was extracted on days 1, 2, 3, 4, 5, and 6 of infection.

[0119] (3) Virus titer determination

[0120] The viral RNA extracted in step (2) was reverse transcribed into cDNA using the TAKARA reverse transcription kit. The reverse transcription conditions were: 37°C / 15 min; 80°C / 15 s. The cDNA of each group was used as a template. After the Ct value of the viral ORF2 sequence was determined by qPCR, the qPCR operation program was shown in Table 4, the ORF2 qPCR primer sequence was shown in Table 5, and the viral titer at each time point was calculated. The results are shown in Table 4. Figure 14 shown.

[0121] Table 4 qPCR operation program

[0122] Pre-denaturation Denaturation Annealing / extension 95℃,30s 95℃,10s 60℃,30s

[0123] Table 5 ORF2 qPCR primers

[0124]

[0125] The results are as follows Figure 14 As shown, tRNA was transfected Leu -SA and tRNA Gln After 24 hours of the administration of -SA adjuvant, PRRSV infection was performed, and the virus titer in the supernatant of Marc-145 cells was detected 1 day, 2 days, 3 days, 4 days, 5 days and 6 days after infection. The results showed that the virus content in the vaccine adjuvant group was significantly increased compared with the Blank group, and reached peak values ​​on the 1st and 2nd days, respectively, indicating that tRNA Leu -SA and tRNA Gln -SA adjuvant can significantly increase the amount of intracellular antigens.

[0126] Test Example 6

[0127] Preparation of lipid nanoparticles and their effect on tRNA Leu -SA and tRNA Gln Evaluation of encapsulation effect of -SA

[0128] (1) Preparation of tRNA-containing -SA Leu -SA and tRNA Gln Preparation of citrate buffer for -SA

[0129] A 10 mM citrate buffer was prepared by dissolving 2.1014 g of monohydrate citric acid and 2.941 g of sodium citrate dihydrate in 1 L of DEPC water. 320 μg of tRNA Leu -SA or tRNA Gln -SA was dissolved in 3 mL of citrate buffer to prepare tRNA Leu -SA or tRNA Gln -SA in citrate buffer.

[0130] (2) Preparation of lipid nanoparticle synthesis system

[0131] The raw materials of the lipid nanoparticles were dissolved in ethanol at a molar ratio of 50:10:37.5:2.5 (MC3 / DSPC / cholesterol / DMG-PEG2000), and the system volume was adjusted to 20 mL.

[0132] (3) Preparation of lipid nanoparticle encapsulated RNA working solution system

[0133] The lipid nanoparticle synthesis system was mixed with the tRNA Leu -SA or tRNA Gln -SA in citrate buffer at a volume ratio of 3:1 by microfluidic mixing. The microfluidic parameters were set as follows: ethanol flow rate 5 mL / min, tRNA Leu -SA or tRNA Gln -SA in citrate buffer aqueous phase flow rate 15 mL / min. After encapsulation was completed, the encapsulated tRNA Leu -SA or tRNA Gln -SA was diluted 5-fold. The prepared lipid nanoparticle encapsulated tRNA Leu -SA or tRNA Gln-SA was concentrated, diluted to the original volume with neutral PBS buffer, and ultrafiltered again. After repeated ultrafiltration to remove ethanol, the concentrate was diluted to the original volume with neutral PBS buffer containing 10% sucrose, filtered and sterilized with a 0.22 μm filter, and stored in a sealed container at 4°C.

[0134] (4) Lipid nanoparticles encapsulating tRNA Leu -SA or tRNA Gln -SA effect evaluation

[0135] The particle size of the encapsulated particles was measured using a Zeta particle size analyzer, and the gel retardation test was used to determine whether the RNA was encapsulated.

[0136] The results are as follows Figure 15 The results show that the effect of PEG-LNP on tRNA was detected by denaturing polyacrylamide gel electrophoresis. Leu -SA or tRNA Gln -SA encapsulation. The results showed that PEG-LNP-tRNA encapsulated by lipid nanoparticles Leu -SA and PEG-LNP-tRNA Gln -SA has no significant band, indicating tRNA Leu -SA and tRNA Gln -SA can be stably encapsulated in lipid nanoparticles.

[0137] The results are as follows Figure 16 As shown, PEG-LNP encapsulated tRNA Leu -SA and tRNA Gln -SA Zeta particle size range chart. Zeta particle size analyzer results show that lipid nanoparticles encapsulate tRNA Leu -SA or tRNA Gln -SA(PEG-LNP-tRNA Leu -SA and PEG-LNP-tRNA Gln -SA) after the particle size is 60-80nm, which meets the particle size requirements for nucleic acid vaccine adjuvant delivery.

[0138] Test Example 7

[0139] Detection of tRNA at animal level Leu -SA and tRNA Gln -SA's effect on the body's immune system

[0140] (1) Experimental grouping and vaccination

[0141] Twelve 6-8 week old SD rats were divided into normal saline group, Al salt adjuvant positive control group, tRNA Leu -SA treatment group and tRNAGln -SA treatment group, 3 mice in each group. Inactivated virus vaccine (150 μg) was mixed with normal saline (100 μL), Al salt adjuvant (100 μg), tRNA encapsulated by liposomes, Leu -SA and tRNA Gln -SA vaccine adjuvant (100 μg) was mixed and each group of rats was vaccinated once on day 0, day 7 and day 21 respectively.

[0142] (2) Serum sample collection

[0143] Blood was collected from rats via tail tip sampling on days 0, 7, 14, 21, 28, 35, 42, 49, and 56. The blood was allowed to clot naturally at room temperature for 30-60 minutes. After coagulation, the blood was centrifuged at 2000-2500g for 10 minutes. The supernatant serum was collected and stored at -80°C.

[0144] (3) Specific antibody titer detection

[0145] PRRSV-specific IgG antibodies were detected using an ELISA kit. Polyethylene 96-well microplates pre-coated with PRRSV antigen were obtained from the IDEXX PRRS X3 ELISA kit. After adding 100 μL (1:100 dilution) of serum sample to the microplate, the microplate was incubated at 37°C for 1 hour. After washing, 100 μL of horseradish peroxide (HRP)-conjugated goat anti-rat IgG (1:5000) was added to each well, and the microplate was incubated at room temperature for 1 hour. After washing, 100 μL of 3,3',5,5'-tetramethylbenzidine substrate solution provided by IDEXX was added to each well, and the reaction was terminated by adding stop solution after 15 minutes. The OD value of each well was read using an ELISA plate reader.

[0146] The ELISA method was used to dynamically monitor the changes in specific IgG antibody titers in rat serum after immunization with inactivated virus vaccine alone or inactivated virus vaccine combined with adjuvant. Figure 17 shown.

[0147] The results are as follows Figure 17 Shown are the concentrations of PRRSV-specific IgG antibodies in rat serum detected by ELISA at different time points.

[0148] The results showed that compared with the saline group, the injection of Al salt adjuvant, tRNA Leu -SA adjuvant and tRNA Gln The concentration of PRRSV-specific IgG antibody in the SA adjuvant group increased significantly at each time point; starting from the 21st day, the concentration of PRRSV-specific IgG antibody in the Al salt adjuvant, tRNA Leu -SA adjuvant and tRNA GlnThe IgG antibody concentration in the SA adjuvant group increased rapidly and reached the peak on day 28, but the tRNA Leu The peak IgG antibody concentration in the SA adjuvant group was significantly higher than that in the Al salt adjuvant group, but the tRNA Gln The IgG antibody concentration in the SA adjuvant group was slightly lower than that in the Al salt adjuvant group. It was shown that the tRNA Leu -SA and tRNA Gln -SA has a significant ability to activate the immune response of the body as a vaccine adjuvant for PRRSV.

[0149] Finally, it should be pointed out that the above embodiments are only used to illustrate the technical solutions of the present application, but not to limit it. The basic principles and main features of the present application have been described above with specific embodiments, and some modifications or replacements can be made on the basis of the present application, but these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the present application.

Claims

1. A tRNA-based Leu and / or tRNA Gln The nucleic acid vaccine adjuvant is characterized in that The nucleic acid vaccine adjuvant contains human active tRNA Leu As a scaffold, the recombinant sequence of the chimeric aptamer tRNA Leu -SA; and / or human active tRNA Gln As a scaffold, the recombinant sequence of the chimeric aptamer tRNA Gln -SA; The human active tRNA Leu The sequence is a sequence with a similarity of more than 90% to SEQ ID NO.1; the human active tRNA Gln The sequence is more than 90% similar to SEQ ID NO.2; the tRNA Leu The sequence is shown in SEQ ID NO.1: the tRNA Gln The sequence is shown in SEQ ID NO.2; SEQ ID NO.1: ACCAGGAUGGCCGAGUGGUUAAGGCGUUGGACUUAAGAUCCAAUGGACAUAUG UCCGCGUGGGUUCGAACCCCACUCCUGGUACCA; SEQ ID NO.2: GGUCCCAUGGUGUAAUGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGGACCUCCA.

2. The nucleic acid vaccine adjuvant according to claim 1, characterized in that The recombinant sequence tRNA Leu -SA is a sequence with a similarity of more than 90% to SEQ ID NO.3; the recombinant sequence tRNA Gln -SA is a sequence with a similarity of more than 90% to SEQ ID NO. 4; The recombinant sequence tRNA Leu -SA sequence is shown in SEQ ID NO.3; the recombinant sequence tRNA Gln -SA sequence is shown in SEQ ID NO.4; SEQ ID NO.3: ACCAGGAUGGCCGAGUGGUUAAGGCGUUGGACUAGUAAUUUACGUCGACGGUG ACGUCGAUGGUUGCGGGAUCCAAUGGACAUAUGUCCGCGUGGGUUCGAACCCCACU C CUGGUACCA; SEQ ID NO.4: GGUCCCAUGGUGUAAUGGUUAGCACUCUGGACUAGUAAUUUACGUCGACGGUG ACGUCGAUGGUUGCGGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUGGGACCUCCA.

3. The nucleic acid vaccine adjuvant according to claim 1, characterized in that The nucleic acid aptamer is an inactive aptamer; the sequence of the inactive aptamer is shown in SEQ ID NO.5; SEQ ID NO.5: AGTAATTTACGTCGACGGTGACGTCGATGGTTGCGG.

4. The method for preparing the nucleic acid vaccine adjuvant according to any one of claims 1 to 3, characterized in that: The preparation method of the nucleic acid vaccine adjuvant is as follows: S1: Chimerizing the nucleic acid aptamers into the human active tRNA as claimed in claim 2 Leu and tRNA Gln The anticodon loop of the synthesized recombinant sequence tRNA as claimed in claim 2 Leu -SA, recombinant sequence tRNA Gln -SA; using the restriction sites on the pBSMrna plasmid, the recombinant sequence tRNA Leu -SA, recombinant sequence tRNA Gln -SA was inserted into the pBSMrna plasmid to construct recombinant tRNA Leu -SA expression vector, recombinant tRNA Gln -SA expression vector; S2: Recombinant tRNA Leu -SA expression vector, recombinant tRNA Gln -SA expression vectors were transformed into Escherichia coli competent cells to obtain recombinant strains, which were amplified and cultured in culture medium to obtain bacterial liquid tRNA. Leu -SA, bacterial liquid tRNA Gln -SA; S3: Extract tRNA from the bacterial solution in step S2 Leu -SA, bacterial liquid tRNA Gln -SA total RNA, and separated and purified by FPLC to obtain recombinant tRNA Leu -SA, recombinant tRNA Gln -SA.

5. The method for preparing the nucleic acid vaccine adjuvant according to claim 4, characterized in that: The restriction enzyme cutting sites of the pBSKrna plasmid in step S1 are Eag I and Sac II.

6. The method for preparing the nucleic acid vaccine adjuvant according to claim 4, characterized in that: In step S2, the competent E. coli cells are HST08 or DH5α competent cells; and the culture medium is LB culture medium or TB culture medium.

7. The method for preparing the nucleic acid vaccine adjuvant according to claim 4, characterized in that: The following steps are also included: Nanoliposomes are used as carriers to encapsulate the recombinant tRNA Leu -SA, recombinant tRNA Gln -SA.

8. Use of the nucleic acid vaccine adjuvant according to any one of claims 1 to 3 in the preparation of porcine reproductive and respiratory syndrome vaccine.

Citation Information

Patent Citations

  • Yeast beta-glucan particle vaccine of trichina muscle larvae and application of yeast beta-glucan particle vaccine

    CN118059220A

  • Recombinant RNA (Ribonucleic Acid) aptamer as well as preparation method and application thereof

    CN120082561A

  • Live Attenuated Bacterial Vaccine

    US20070280968A1