Schizomycosphaeria-tolerant D23 and application thereof
By providing salt-tolerant Cladophora spp. D23, the problem of plant growth difficulties in saline-alkali land has been solved, and the effects of improving the salt and alkali tolerance and promoting the growth of plants in saline-alkali environment have been achieved. Specifically, it is applied to promote the growth of plants in saline-alkali land and improve their salt and alkali tolerance.
Patent Information
- Application Number
- CN202511021874.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-23
- Publication Date
- 2025-10-17
AI Technical Summary
At present, there are no reports on the functions of Cladophora mycorrhizal in improving saline-alkali land and promoting crop growth. How to improve the growth ability and salt tolerance of plants in saline-alkali environments has become a research hotspot.
A salt-tolerant Cladorrhinum hyalocarpum strain D23 was provided. This strain has extremely strong salt tolerance and can withstand a Na concentration of 600 mM. By inoculating it into the rhizosphere or roots of plants, it promotes Na ion retention in plant roots, regulates root metabolic processes, and improves the plant's salt and alkali tolerance and growth.
In saline-alkali environments, inoculation with salt-tolerant mycorrhizal fungi D23 can increase rice plant height, tiller number, and chlorophyll content, promote root growth, enhance the plant's salt and alkali tolerance, regulate root metabolite secretion, and promote plant growth.
Smart Images

Figure CN120796082A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of microorganisms, and particularly relates to a salt-tolerant Cladorrhinum D23 and application thereof. BACKGROUND
[0002] Saline-alkali soil is a land resource widely existing in the world. High salt content in the environment can destroy soil structure, reduce soil fertility, inhibit the absorption of water and nutrients by plant roots, and lead to crop yield reduction or even absolute loss, which seriously restricts the sustainable development of agriculture and the improvement of the ecological environment. At present, finding microbial resources that can adapt to saline-alkali environment and effectively improve the physical and chemical properties of soil and promote the growth of plants in saline-alkali soil has become a research hotspot in the field of saline-alkali soil management.
[0003] Cladorrhinum hyalocarpum is a fungus in the phylum Ascomycota, which is saprophytic or weakly parasitic, commonly found in soil or plant residues. The mycelium is usually white to gray-brown, and the conidium is transparent or light-colored. Studies have shown that Cladorrhinum can be used for plant disease control. For example, Cladorrinum flexuosum has the ability to control Gibberella zeae and Podospora chesnutti, and can be used as a biological control agent. Martin found that an unidentified Cladorrhinum strain could produce an antitumor compound MPC1001, which could inhibit prostate cancer cells (Mara Martin, Mario Saparrat, Viviana Barrera, Laura Gasoni. 2018. Mini-review: Cladorrhinum species, their diversity and application in biotechnology. Nova Hedwigia. 108, 489-503.). However, the function of Cladorrhinum in saline-alkali soil improvement and crop growth promotion has not been reported at present. SUMMARY
[0004] The purpose of the present application is to provide a salt-tolerant Cladorrhinum D23 and its application. The salt-tolerant Cladorrhinum D23 can promote the growth of plants in saline-alkali soil and improve the salt-tolerance of plants.
[0005] The present application provides a salt-tolerant Cladorrhinum (Cladorrhinum hyalocarpum) D23, and the preservation number of the salt-tolerant Cladorrhinum D23 is CGMCC No. 41437.
[0006] The present application also provides a microbial agent, and the effective component of the microbial agent comprises the salt-tolerant Cladorrhinum D23 described in the above scheme.
[0007] As a preferred solution, the viable cell number of the Cladorrhinum hyalocarpum D23 in the microbial inoculant is ≥ 1 x 10 6 CFU / mL or the viable cell number is ≥ 1 x 10 6 CFU / g.
[0008] The application also provides the use of the Cladorrhinum hyalocarpum D23 or the microbial inoculant in at least one of the following 1) to 4):
[0009] 1) promoting the growth of plants in saline-alkali soil;
[0010] 2) improving the salt-tolerance of plants;
[0011] 3) improving the Na ion interception of plant roots;
[0012] 4) optimizing the metabolic process of plant roots.
[0013] As a preferred solution, the plant growth promotion includes at least one of the following: increasing plant height, increasing tiller number, increasing chlorophyll content, and promoting root growth.
[0014] As a preferred solution, the plant growth promotion includes at least one of the following: increasing plant height, increasing tiller number, increasing chlorophyll content, and promoting root growth.
[0015] As a preferred solution, the plant includes rice.
[0016] The application also provides a method for improving the salt-tolerance of plants and / or promoting the growth of plants, comprising the step of applying the Cladorrhinum hyalocarpum D23 or the microbial inoculant to the plants.
[0017] As a preferred solution, the application amount is 3 to 10 L / acre or 3 to 10 kg / acre.
[0018] As a preferred solution, the application site includes the rhizosphere.
[0019] The application provides a Cladorrhinum hyalocarpum D23, and the preservation number of the Cladorrhinum hyalocarpum D23 is CGMCC No.41437. The Cladorrhinum hyalocarpum D23 has strong salt tolerance and can tolerate a Na concentration of 600 mM. The Cladorrhinum hyalocarpum D23 can promote the root interception of Na in plants. After the rice is treated with the Cladorrhinum hyalocarpum D23, the plant height, SPDA, and tiller number of the rice in the inoculation group are higher than those in the non-inoculation group at the jointing stage and the heading stage, and the Cladorrhinum hyalocarpum D23 can promote the increase of the total length of plant roots and the volume of plant roots. Meanwhile, the Cladorrhinum hyalocarpum D23 can regulate the metabolic process of plant roots, regulate the secretion of metabolites in plant roots, and promote the growth of plants. BRIEF DESCRIPTION OF DRAWINGS
[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments will be briefly introduced as follows.
[0021] Figure 1 Phylogenetic tree of the salt-tolerant branch fungus D23;
[0022] Figure 2 Colony pictures of the salt-tolerant branch fungus D23 on different culture media; wherein a is CA culture medium; b is PDA culture medium; c is OA culture medium; d is PCA culture medium; and e is MEA culture medium;
[0023] Figure 3 Microscope observation pictures of the salt-tolerant branch fungus D23; wherein A is an overview of the mycelium of D23, and the scale is 100 μm; B is the septum of the mycelium of D23, and the scale is 4 μm; C is the diameter and bifurcation of the mycelium of D23; D and E are ascus formed by the mycelium of D23; the scale in D is 50 μm, and the scale in E is 100 μm;
[0024] Figure 4 Spearman correlation analysis result picture between the copy number of the salt-tolerant branch fungus D23 and the biomass of rice;
[0025] Figure 5 Dry weight biomass picture of the salt-tolerant branch fungus D23 under different NaCl concentrations, wherein different lowercase letters in the picture represent significant differences in data;
[0026] Figure 6 Cross-section pictures of the root of R15 rice infected by the salt-tolerant branch fungus D23, wherein the scale in the first row of pictures is 50 μm, and the scale in the second row of pictures is 20 μm;
[0027] Figure 7 Cross-section pictures of the root of S17 rice infected by the salt-tolerant branch fungus D23, wherein the scale in the first row of pictures is 50 μm, and the scale in the second row of pictures is 20 μm and 50 μm from left to right;
[0028] Figure 8 R15 rice cell wall thickness measurement picture, wherein ns represents no significant difference in data, and *** represents significant difference in data, p<0.001;
[0029] Figure 9 S17 rice cell wall thickness measurement picture, wherein ns represents no significant difference in data, and * represents significant difference in data, p<0.05;
[0030] Figure 10 Picture of the effect of inoculation of the salt-tolerant branch fungus D23 on the growth of rice varieties R15 and S17.
[0031] Biological preservation instructions
[0032] Cladorrhinum hyalocarpum D23 was preserved in China General Microbiological Culture Collection Center (CGMCC) on August 15, 2024, the address of the preservation center is No. 1, Beichen West Road, Haidian District, Beijing, and the preservation number is CGMCC No. 41437. DETAILED DESCRIPTION
[0033] The present application provides a Cladorrhinum hyalocarpum D23, and the preservation number of the Cladorrhinum hyalocarpum D23 is CGMCC No. 41437. The Cladorrhinum hyalocarpum D23 is isolated and screened from the soil of rice roots, and the colony is grayish white or white. The development degree of aerial hyphae varies with the culture medium. The colonization ability of the Cladorrhinum hyalocarpum D23 in the rhizosphere and inside the roots is not affected by the difference of rice varieties, and has strong stability. The Cladorrhinum hyalocarpum D23 has strong salt tolerance and can tolerate 600 mM NaCl concentration.
[0034] The present application also provides a microbial agent, and the effective component of the microbial agent includes the Cladorrhinum hyalocarpum D23 described in the above scheme. As an embodiment, the viable bacterial count of the Cladorrhinum hyalocarpum D23 in the microbial agent is ≥1×10 6 CFU / mL; as another embodiment, the viable bacterial count of the Cladorrhinum hyalocarpum D23 in the microbial agent is ≥1×10 6 CFU / g.
[0035] The present application also provides the application of the Cladorrhinum hyalocarpum D23 described in the above scheme or the microbial agent in at least one of the following 1) to 4): 1) promoting the growth of plants in saline-alkali land; 2) improving the salt-tolerant ability of plants; 2) improving the Na ion interception of plant roots; and 4) optimizing the metabolic process of plant roots. The Cladorrhinum hyalocarpum D23 has strong salt tolerance and can tolerate 600 mM Na concentration, can promote the root interception of Na of plants, and can regulate the metabolic process of roots, regulate the secretion of metabolites of plant roots, and promote the growth of plants. After the rice is treated with the Cladorrhinum hyalocarpum D23, the plant height, SPDA and tiller number of the rice in the inoculation group are higher than those in the non-inoculation group at the jointing stage and the heading stage, and the total length of the roots and the root volume of the salt-sensitive rice varieties are increased.
[0036] As an embodiment, the plant growth promotion includes at least one of the following: increasing plant height, increasing tiller number, increasing chlorophyll content, and promoting root growth.
[0037] As an embodiment, the promotion of root growth includes promoting root length and / or root volume.
[0038] As an implementation form, the plant comprises rice.
[0039] The application further provides a method for improving the salt and alkali tolerance of a plant and / or promoting the growth of a plant, comprising the following steps: applying the salt-tolerant Clonostachys rosea D23 or the microbial inoculant to the plant.
[0040] As an implementation form, the amount of application is 3-10 L / acre; in specific embodiments of the application, the amount of application is any value within the range of 3-10 L / acre, such as 3, 4, 4.5, 5, 6, 6.2, 7, 7.5, 8, 9, or 10 L / acre. As another implementation form of root irrigation, the amount of application is 3-10 kg / acre; in specific embodiments of the application, the amount of application is any value within the range of 3-10 kg / acre, such as 3, 4, 5, 6, 6.2, 7, 7.5, 8, 9, or 10 kg / acre.
[0041] As an implementation form, the application site comprises the rhizosphere. As an implementation form, the application method comprises root irrigation and / or root dipping. As an implementation form, the plant comprises rice. The application of the salt-tolerant Clonostachys rosea D23 at the rhizosphere site can improve the salt and alkali tolerance of the plant and regulate the secretion of root metabolites of the plant, thereby promoting the growth of the plant.
[0042] In order to further illustrate the application, the technical solutions provided by the application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the application.
[0043] Example 1
[0044] (1) Isolation, identification, and morphological observation of the salt-tolerant Clonostachys rosea
[0045] 5 g of rhizosphere soil of the strong rice variety S17 (Jinnong silk seedling) was placed in 100 mL of sterile water, 3 sterilized glass beads were added, and then the bottle was sealed and shaken at 180 rpm and 25℃ for 20 min to obtain a soil suspension; the soil suspension was gradiently diluted, and 10 -3 , 10 -4Each 200 μL of the soil suspension was spread on the surface of the Bengal red medium. The upright culture was carried out at 25 °C for 2-3 days. Single colonies were picked up on potato dextrose agar medium. When the colony diameter was 3-4 cm, the mycelium growing vigorously at the edge of the colony was picked up on a new PDA medium. After the colony covered the plate, the DNA was extracted using Lysis Buffer for Microorganism to Direct PCR (TaKaRa, Dalian, China). The procedure was as follows: a small amount of mycelium was picked up with a gun head and placed in 50 μL of lysis buffer. After stirring for 5 s, it was removed. After heat deformation at 80 °C for 15 min, it was centrifuged at 5000 rpm for 10 min. The supernatant was the DNA.
[0046] PCR amplification was performed using primers ITS1F (SEQ ID NO. 1: 5'-CTTGGTCATTTAGAGGAAGTAA-3') and ITS4 (SEQ ID NO. 2: 5'-TCCTCCGCTTATTGATATGC-3'). The PCR system was as follows: 3 μL of supernatant, 25 μL of Premix Taq (Ex Taq Version 2.0), 1 μL of forward / reverse primer (10 pmol / uL), and 20 μL of sterilized water. The PCR reaction conditions were as follows: 95 °C for 5 min, 35 cycles of 95 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s, and finally 72 °C for 10 min. After the amplification product was detected as a single band by 1% agarose gel electrophoresis, the gel was cut and recovered according to the operation manual of MiniBEST Agarose Gel DNA Extraction Kit Ver. 4.0 (TaKaRa, Dalian, China). The purified DNA was sequenced by the Sanger method. All strains were searched in NCBI and classified into potential genera and species. The internal transcribed spacer (ITS) from fungal types and reference materials was selected by comparing the database, and two strains of salt-tolerant Lecythophora (D23 and D55) were obtained.
[0047] The strain D23 is preserved in China General Microbiological Culture Collection Center, the number of which is CGMCC No: 41437. The ITS sequence (SEQ ID NO. 3) of the obtained clavaria is as follows: 5'-TCTTGGT CAATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCTAAACCATCGCGAACCCACCCCTAAACAGTTGCTTCGGCGGCGCCAGAGGCCCTACGGCCCGAGGCCCGCCGGGGACCCCCCAAACTCTTGTTTTTCACAAATGGCCTCTCTGAGTACTGTACTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCGAGTATTCTCGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCCGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAATCCAGTGGCGGGCTCGCTGTCGCACCGAGCGTAGTAGCATACTTCTCGCTCCGGGAGCGCGGCGGGCGCCTGCCGTAAAACCCCCTACATACCAAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAATGACGTTGTTTACGC-3'. The evolutionary relationship tree of clavaria is constructed by MEGA 6.0 based on the neighbor-joining method, and the results are shown in Figure 1 .
[0048] PDA, potato carrot agar (PCA), cornmal agar (CA), oatmeal agar (OA), and malt extract agar (MEA) are used to culture and observe the morphology of clavaria, and the results are shown in Figure 2 . The microstructure is observed by ECLIPSE Ni-L (Nikon, Shinagawa-ku, Tokyo, Japan) differential interference phase contrast microscope, and the results are shown in Figure 3 .
[0049] The medium formula is as follows: 1) PDA medium: potato 200 g, sucrose 20 g, agar 20 g and deionized water 1000 mL, natural pH; 2) CA medium: corn steep powder 7.0 g, agar 15.0 g and deionized water 1000 mL, pH 6.0; 3) OA medium: oat 60.0 g, agar 12.5 g and deionized water 1000 mL, pH 6.0; 4) MEA medium: malt extract 30.0 g, soybean peptone 3.0 g, agar 15.0 g and deionized water 1000 mL, pH 7.0; 5) PCA medium: potato powder 20 g, carrot powder 20 g, agar 13.0 g and deionized water 1000 mL, pH 6.0-6.5.
[0050] The colony of salt-tolerant Clavaria D23 was grayish white or white ( Figure 2 ), and the development of aerial hyphae varied with the medium. The colony was grayish white on OA medium, and the aerial hyphae were developed. The colony of D23 was yellowish white on MEA medium, and the aerial hyphae were floccose. The colony was light yellow on OA medium, and the aerial hyphae grew radially, with septate hyphae of 2.7-6.1 μm in diameter ( Figure 3 ). The hyphal tips were partially bifurcated, and the hyphae were cross-linked to form ascocarps of 50-100 μm in size after more than 2 weeks of culture ( Figure 3 ).
[0051] (2) Determination of the copy number of salt-tolerant Clavaria in the rhizosphere soil and roots of rice
[0052] Twenty-eight rice varieties were selected for pot experiments in saline-alkali soil. The soil was collected from the 0-20 cm depth of a typical rice planting area in Tongyu County, Baicheng City, Jilin Province. After air-drying, the soil was sieved through a 2 mm sieve and mixed uniformly. The basic physicochemical properties of the soil were as follows: soil organic carbon 10.58 g / kg; total nitrogen 0.47 g / kg; electrical conductivity 750 μS / cm; alkali-hydrolyzable nitrogen 46.50 mg / kg; available potassium 153 mg / kg; pH 9.16; and total salt content 8.00 g / kg.
[0053] Each pot was filled with 1.2 kg of soil, and fertilized with 0.15 g of urea, 0.04 g of superphosphate, and 0.10 g of potassium sulfate per kg of soil, which corresponded to 150 kg of nitrogen, 40 kg of phosphorus, and 100 kg of potassium per hectare. Before potting, the fertilizers were thoroughly mixed with the soil. After the soil was saturated with water, 5 rice seeds were directly sown in each pot. When the seedlings grew to a height of 10 cm, the seedlings were thinned to 2 plants per pot. The pots were placed in an artificial climate box for cultivation, with a light cycle of 16 hours (daytime, temperature 30°C) and a dark cycle of 8 hours (nighttime, temperature 25°C), and the relative humidity was maintained at 75%. Distilled water was added as needed to maintain soil moisture. After 35 days, the aboveground parts of the plants were harvested, dried at 50°C to constant weight, and recorded. The results are shown in Table 1. At this time, the two plants in each pot were of similar height. Rhizosphere soil and rice roots were collected for determination of the copy number of D23.
[0054] The specific primers D23-F (SEQ ID NO. 4: 5'-ACTCCCTAAACCATCGCGAA-3') and D23-R (SEQ ID NO. 5: 5'-TCGATGCCAGAACCAAGAGA-3') were designed using NCBI-primer blast, with an amplification efficiency of 91.05%. Total DNA was extracted from the roots and rhizosphere soil, and the extracted DNA was used as a template to amplify the D23 DNA fragment. The gel-purified DNA fragment was ligated with the Amp-resistant plasmid pMD18-T Vector at 4°C overnight. Ten microliters of the ligation product were added to 50 microliters of competent JM109 cells (2692 bp), which were gently mixed and then incubated in an ice bath for 30 minutes. After 90 seconds of heat shock at 42°C, the cells were immediately cooled on ice for 3 minutes. The recovered competent cell broth was spread on the surface of 2YT solid medium containing Amp for screening, and PCR verification was performed.
[0055] The PCR-verified successfully transformed strain was cultured in large quantities, and the plasmid was extracted using TaKaRa MiniBEST Plasmid Purification Kit Ver. 4.0. (Takara, Dalian, Japan). The purified plasmid was sequenced using BigDye Terminator v3.1 after formamide deformation, and the sequencing results were used to determine the accuracy of the amplified sequence. The concentration and purity of the plasmid were determined using NanoDrop 2000 (Thermo, USA), and the plasmid copy number was calculated according to the following formula: Plasmid copy number (copies / μL) = 6.02 x 1023 x (ng / μL) x 10 -9ng / μL: plasmid concentration, bp: vector plus insert size (2692 bp + 178 bp).
[0056] The plasmid was gradient diluted into 8 gradient templates, and each template was repeated 3 times. The PCR system was as follows: 2x SYBR real-time PCR premixture 12.5 μL, D23-F 1.0 μL, D23-R 1.0 μL, diluted template 5 μL, ddH2O to 25 μL. The real-time PCR reaction program was denaturation at 95℃ for 5 min, 40 cycles of 95℃ for 15 s, 60℃ for 30 s. The cycle threshold Ct value of each template was obtained, and the standard curve was constructed. The quantification method of root and soil DNA samples was consistent with the standard curve, and the average value of each sample was taken as the Ct value of the sample, and the copy number of each sample was obtained according to the standard curve. At the same time, the biomass of each rice plant was determined by drying method. The experimental data were analyzed by SPSS19.0 system software, and the data homogeneity was tested by Duncan test, and the results are shown in Tables 1 and 2.
[0057] Table 1 CT value and copy number of D23 ITS gene of Cladosporium in rhizosphere soil of rice
[0058]
[0059]
[0060] Note: N = 1, biomass of 0 indicates that the variety is not salt-tolerant and dies.
[0061] Table 2 CT value and copy number of D23 ITS gene of Cladosporium in roots of different varieties of rice
[0062] Number Rice Variety CT Copy Number R2 Root 212(6F0109) 31.28±0.42 8.52E+00 R3 Root CT6946-9-1-2-M-1P::IRGC117329-1 27.08±0.23 1.29E+02 R7 Root Jin 1297 29.97±0.24 1.99E+01 R10 Root ADAIR::GERVEX1640-C1 23.61±0.23 1.22E+03 R11 Root R2492-23 26.53±0.31 1.84E+02 R12 Root R938 Awnless 26.11±0.18 2.42E+02 R13 Root IR-44595 29.08±0.36 3.54E+01 R14 Root CNAR2888-B-47::IRGC117325-1 29.52±0.31 2.66E+01 R15 Root VISTA::IRGC14530-1 29.70±0.48 2.36E+01 R18 Root 501 (6F0318) / 735 (6F0979) 29.76±0.44 2.27E+01 R19 Root Tianfeng B 29.58±0.17 2.56E+01 R20 Root 14 Nian Junmin Dahuangjiliang Rice 34.03±0.36 1.44E+00 R22 Root 0522 29.74±0.45 2.30E+01 R24 Root ELVO::IRGC82422-1 28.53±0.46 5.04E+01 R29 Root IRAT177 28.53±0.06 5.07E+01 S2 Root 15WL08 23.23±0.38 1.57E+03 S6 Root Zhimin 155 27.89±0.20 7.67E+01 S12 Root 13-14 Nian Guangpo Wu Dafuben 30.73±0.11 1.22E+01 S15 Root R1251 / 2007 P897-1 / / R1251.BC3F8) 31.38±0.55 8.01E+00 S17 Root Jinnong Simian 31.86±0.22 5.87E+00 S18 Root 751(6F1011) 30.28±0.51 1.62E+01 S19 Root Qu USA444 29.87±0.26 2.13E+01 S20 Root IR64 / D Qibaoyou 527 29.96±0.22 2.00E+01 S21 Root 1003 31.56±0.23 7.09E+00 S23 Root IMPROVED BLUEBONNET::IRGC6224-1 25.89±0.44 2.79E+02 S26 Root Jin 9 29.61±0.14 2.51E+01 S28 Root R510 28.87±0.16 4.06E+01 S29 Root R950 Single 25.19±0.12 4.38E+02 S30 Root Minghui 63 32.38±0.40 4.18E+00
[0063] According to Tables 1 and 2, the copy number of Cladosporium D23 in rhizosphere soil was between 1.12E+02 and 9.55E+00, and the copy number of Cladosporium D23 in roots was between 1.22E+01 and 8.52E+00. The correlation analysis between the copy number of salt-tolerant Cladosporium D23 and the dry weight of rice plants was carried out, and the results are shown in Table 3. Figure 4 According to Table 3, with the increase of the copy number of salt-tolerant Cladosporium D23, the biomass of rice on saline-alkali soil increased significantly, and the increasing trend in rhizosphere reached significance. Figure 4
[0064] (3) Determination of the range of salt-tolerance degree of Cladosporium
[0065] The pH 8.5 PD liquid medium was prepared with a NaCl concentration gradient of 0, 200, 400, 500 and 600 mM, and 5 replicates for each treatment. The preparation method of the PD liquid medium was as follows: 200 g of potatoes were placed in a pot, 1 L of water was added to the pot, and the potatoes were boiled until they were cooked but not rotten, then 8 layers of gauze were used to filter into a 1 L graduated cylinder, then distilled water was added to the 1 L mark of the graduated cylinder, finally 20 g of glucose was added, sealed with a sealing film, sterilized at 121°C for 20 min, and ready for use.
[0066] After sterilization of the medium, 1 piece of 0.8 cm diameter agar block of salt-tolerant clavaria D23 was inoculated into each 100 mL of medium. The culture was carried out at 25°C and 180 rpm in the dark for 20 days. After the culture ended, the mycelium was obtained by filtering with filter paper, and after removing the original agar block, it was dried at 60°C and weighed. The results are shown in Table 3 and Figure 5
[0067] Table 3 Dry weight of salt-tolerant clavaria under different salt concentrations
[0068] Salt Concentration 0 mM 200 mM 400 mM 500 mM 600 mM Dry Weight (g) 1.17±0.17 1.92±0.16 2.14±0.47 1.16±0.20 0.57±0.13
[0069] According to Table 3 and Figure 5 it can be seen that the growth rate of clavaria is the fastest under a NaCl concentration of 400 mM, and the maximum biomass is reached after 20 days of culture. After 500 mM, the growth rate slows down, and under a Na ion concentration of 600 mM, the growth rate does not decrease significantly compared with the control. It can be seen that the salt-tolerant clavaria has a high degree of sodium chloride tolerance, and the optimal Na concentration is 400 mM.
[0070] (4) Na ion removal by salt-tolerant clavaria and distribution of Na in various subcellular components
[0071] A, salt-tolerant clavaria D23 treatment, the specific steps are as follows: the clean bench was ultraviolet sterilized for 15 min, then the baffle was slightly lifted to leave a gap for ventilation for 15 min. The salt-tolerant clavaria D23 mother plate was inoculated into new PDA potato solid medium with a diameter of 7 mm (a total of 5 plates), and placed in a constant temperature incubator at 25°C in the dark until the medium was covered with mycelium. The preparation method of the potato solid medium was as follows: 200 g of potatoes were placed in a pot, 1 L of water was added to the pot, and the potatoes were boiled until they were soft and rotten, then 8 layers of gauze were used to filter into a 1 L graduated cylinder, then distilled water was added to the 1 L mark of the graduated cylinder, finally 20 g of glucose and 20 g of agar powder were added, sealed and sterilized in a sterilization pot
[0072] B, prepare PD liquid medium (pH 8.5), with a NaCl concentration gradient of 0, 100, 200 and 400 mM, and 5 replicates for each treatment. Take 100 mL and put it into a 250 mL volumetric flask, finally seal it and sterilize it in a sterilization pot.
[0073] C. Inoculation: The D23 grown on solid medium in step A was inoculated into the sterilized flask in step B in a super-clean bench with 7mm puncher, 2 agar blocks containing bacteria in step A were put into each flask. After sealing, the culture was carried out in a shaker at 30℃ in the dark for 15 days.
[0074] D. A piece of quantitative filter paper was put into an oven and dried at 60℃ for 3h, the weight of the filter paper was measured, then M1 was recorded. The D23 cultured for 15 days was filtered with the above quantitative filter paper. The bacterial liquid with NaCl concentration of 0, 100, 200 and 400mM was filtered with the dried filter paper, the bacteria on the filter paper was put into an oven and dried, the oven temperature was set at 50-70℃, the dried weight was measured after drying to constant weight, M2, the dry weight of the bacteria was measured: M=M2-M1, the experimental data was expressed as "mean ± standard deviation", Duncan test was used to analyze the data homogeneity, the results were shown in Table 4.
[0075] E. The PD filtered in the experimental group with NaCl concentration of 0, 100, 200 and 400mM was filtered again with 0.45μm filter membrane, then 1mL filtrate was taken with a pipette and diluted 10 times with 9mL deionized water, part of the high concentration treatment (200 and 400mM) needed to be diluted 100 times for measurement. Then Na standard solution was prepared (method see "Soil and Agricultural Chemistry Analysis", 3rd edition, edited by Bao Shidan, China Agricultural Press, ISBN: 9787109064963, May 2000), and the Na ion content was measured with a flame spectrophotometer (Youke Instruments, model FP6431). The experimental data was expressed as "mean ± standard deviation", Duncan test was used to analyze the data homogeneity, the results were shown in Table 4.
[0076] F. The mycelium of salt-tolerant D23 obtained by filtration was digested with nitric acid, and the Na ion, K ion and Ca ion contents of the bacteria under different salt concentrations were measured by inductively coupled plasma mass spectrometry (Inductively coupled plasma mass spectrometry), the results were shown in Table 5.
[0077] Table 4 Dry weight of salt-tolerant D23 under different NaCl concentrations and Na concentration of culture filtrate
[0078]
[0079] Note: Different letters represent significant at P=0.05 level, the same below.
[0080] Table 5 Na, K and Ca contents of salt-tolerant D23 under different NaCl concentrations (mg / kg)
[0081] Treatment Na K Ca 0 mM 164.9±57.2d 839.0±65.5a 191.7±55.8a 100 mM 1408.2±63.1c 288.6±54.9b 95.9±19.8b 200 mM 2337.5±65.2b 307.4±85.5b 80.1±13.8b 400 mM 3428.0±57.1a 353.6±31.2b 71.6±9.4b
[0082] Tables 4 and 5 show that as the NaCl concentration increased, the dry weight of Cladosporium spp. gradually increased, and the Cladosporium's ability to remove Na ions from the culture medium also significantly improved. The Na ion content in the cells also gradually increased, indicating that Cladosporium spp. has a strong ability to assimilate Na ions in the culture medium. At the same time, the potassium and calcium contents in the cells significantly decreased, indicating that excessive assimilation of Na ions significantly affects the absorption of potassium and calcium ions by salt-tolerant Cladosporium spp.
[0083] Example 2: Halotolerant Cladosporium halophilum alleviates rice salt stress
[0084] (1) The typical strong trade-off variety S17 and the typical weak trade-off variety R15 were selected for sand culture experiments, with Na stress treatment and cladocerin inoculation treatment respectively. R15 is an indica rice, numbered VISTA::IRGC 14530-1, bred by the International Rice Research Institute. It is widely used in rice cultivation in Asia, Africa, and Latin America, and is tolerant to salinity and drought. S17 is an indica rice Jinnongsi Miao, bred by the Guangdong Academy of Agricultural Sciences, and is a salt-sensitive variety. An appropriate amount of seeds were selected and soaked in 75% alcohol for 90 seconds, followed by 3-5 rinses with sterile water. Place them in a sterile dish, add 10 mL of sterile water, and culture in the dark at 37°C for 2 days. The germinated seeds were transferred to a seedling tray for hydroponics. When the seedlings grew to 10 cm in height, they were transplanted into tissue culture bottles, with 2 seedlings per bottle. Prepare the tissue culture flasks as follows: Place 120 g of calcined clay in a 300 mL tissue culture flask and sterilize at 121°C for 20 minutes. Repeat the sterilization process twice, with a 24-hour interval. Randomly divide R15 and S17 tissue culture seedlings into four treatment groups, each with five replicates.
[0085] In order to strictly control the Na concentration, 0mM NaPD medium was used to culture the salt-tolerant Cladosporium D23. The concentration of the culture medium was 10 6 copies / mL.
[0086] Prepare modified Magnavaca nutrient solution with sterile water: the formula is based on (Liu et al., 2023, Root microbiota confers rice resistance to aluminum toxicity and phosphorus deficiency in acidic soils, Nature Food), recorded as modified Magnavaca nutrient solution.
[0087] Aseptic base solution preparation of Magnavaca culture solution: the base solution was NaHCO3:Na2CO3:NaCl:Na2SO4(molar ratio 2:1:2:1), the final solution contained 150 mM Na + , 37.5 mM Cl - , 37.5 mM HCO3 - , 18.75 mM CO3 2- , 18.75 mM SO4 2- , and was designated as Magnavaca base solution.
[0088] R15-0mM-aseptic solution: 80 mL of modified Magnavaca nutrient solution was added to R15 seedlings, and 10 mL of sterile PD medium without Na was added.
[0089] R15-0mM-bacteria solution: 80 mL of modified Magnavaca nutrient solution was added to R15 seedlings, and 10 mL of salt-tolerant Cladosporium D23 bacterial solution was added.
[0090] R15-100mM-aseptic solution: 80 mL of Magnavaca base solution was added to R15 seedlings, and 10 mL of sterile PD medium without Na was added.
[0091] R15-100mM-bacteria solution: 80 mL of Magnavaca base solution was added to R15 seedlings, and 10 mL of salt-tolerant Cladosporium D23 bacterial solution was added.
[0092] S17 seedlings were also divided into four groups, S17-0mM-aseptic solution, S17-0mM-bacteria solution, S17-100mM-aseptic solution, and S17-100mM-bacteria solution, with the same treatment as the R15 treatment group, except that the seedlings were replaced with S17.
[0093] The culture conditions of the seedlings in the above eight treatment groups were 16 h of light at 30°C, 8 h of darkness at 25°C, and a relative humidity of 70%. On the 25th day of culture, all treatments were supplemented with 20 mL of Magnavaca culture solution prepared with sterile water to ensure the normal growth of rice; the culture was harvested after 50 days.
[0094] (2) Observation of the colonization of Cladosporium in the roots of R15 and S17 rice
[0095] The middle section of the harvested mature rice root system was cut and subjected to alcohol gradient dehydration at different concentrations. The dehydrated root system was paraffin-embedded, and after the paraffin was cooled, a biological tissue slice machine JK-6 (Wuhan Junjie Electronics Co., Ltd.) was used to make cross-sectional slices. The complete slices were taken with tweezers and placed on a carrier wave. Aniline blue dye BHC0620 (Frdbio) was used for staining for 5 min. The method is described in (Chen Sijie et al., Staining method of root system of Lycium barbarum, Journal of Hebei University, 2021). Excess dye was washed off with 95% alcohol. After transparent treatment with xylene, a Leica DM2000 LED microscope was used for observation and photography. The results are shown in Figure 6-7
[0096] (3) R15 and S17 rice structure determination
[0097] A. One seedling was taken from each treatment group, and the root zone Na ion flow was determined using NRT technology. The specific process is as follows: the living plant was taken out of the pot, and the roots were cleaned with water to avoid damage to the plant roots. The root tip part of the same length and thickness was cut, 8-9 layers of filter paper of appropriate size were placed in the plate, then the roots were placed on the filter paper, and the position was adjusted so that the root tip was about 3 mm longer than the filter paper. Two-thirds of the test solution was added to the plate. The sodium ion flow of 5-30 μm on the outer edge of the corn root was determined using non-invasive micro-test technology. The measurement position was 700 μm from the root tip, and the detection time was 10 min.
[0098] B, another representative root system sample was taken for root structure observation: ① A part was stained with toluidine blue for 1 h, and then decolorized with 75% ethanol for 3 h. The sample was embedded in 3%-5% agarose gel according to the hardness of the root system. Root system transverse sections were cut using a full-automatic vibration section machine VT1200S (Leica Camera AG's headquarters is located in Wetzlar, Hesse, Germany), and the section thickness was set to 60-200 μm according to the thickness of the root system. The obtained sections were placed on glass slides, and observed and photographed using an ECLIPSE Ni-L (Nikon, Shinagawa-ku, Tokyo, Japan) microscope to determine the subcellular localization of the colonization of Cladosporium. ② Fresh root systems were used to determine the colonization of Cladosporium by absolute quantitative PCR. ③ The remaining root systems were collected, and the cell walls were extracted using the extraction buffer in step (3) of the example, and the cellulose, hemicellulose, lignin and total pectin components in the cell walls were determined. The method is described in (Leng et al., 2023, A comparative analysis of major cell wall components and associated gene expression in autotetraploid and its donor diploid rice (Oryza sativa L.) under blast and salt stress conditions, Plants-Basel).
[0099] C, one rice plant was taken from each treatment group for rhizosphere soil and root separation, and the copy number of Cladosporium was determined. The determination method was the same as in Example 1.
[0100] SPSS19.0 system software was used for analysis, and the experimental data was represented as "mean ± standard deviation". Duncan test was used to determine data homogeneity, and the results are shown in Tables 6-11 and Figure 8-9 .
[0101] Table 6 Effect of salt-tolerant Cladosporium D23 inoculation on the root cell wall components of R15 rice
[0102] Treatment Cellulose (mg / g) Hemicellulose (mg / g) Lignin (mg / g) Total Pectin (pmol / g) 0 mM Sterile 402.46±34.73a 146.39±3.63a 82.30±2.67d 46.87±14.67a 100 mM Sterile 361.42±10.30a 137.69±3.85b 95.87±2.87c 68.94±36.63a 0 mM Non-sterile 312.84±14.96b 149.10±4.27a 111.02±1.81a 78.29±20.48a 100 mM Non-sterile 309.40±20.41b 126.27±3.61c 100.79±2.61b 43.71±10.88a
[0103] As shown in Table 6, when R15 rice was not inoculated with the D23 bacterial solution, the cellulose and hemicellulose contents in the cell walls of rice with a Na concentration of 0 mM were greater than those in rice with a Na concentration of 100 mM, while the lignin and total pectin contents were less than those in rice with a Na concentration of 100 mM. When R15 rice was inoculated with the D23 bacterial solution, the cellulose, hemicellulose, lignin, and total pectin contents in the cell walls of rice with a Na concentration of 0 mM were all greater than those in rice with a Na concentration of 100 mM. At a Na concentration of 0 mM, the hemicellulose, lignin, and total pectin contents in the cell walls of rice inoculated with the bacterial solution were greater than those in rice not inoculated with the bacterial solution, while the cellulose content was less than that in rice not inoculated with the bacterial solution. At a Na concentration of 100 mM, the cellulose, hemicellulose, and total pectin contents in the cell walls of rice not inoculated with the bacterial solution were greater than those in rice inoculated with the bacterial solution, while the lignin content was less than that in rice inoculated with the bacterial solution.
[0104] Table 7 Effects of Haloperidol D23 on root cell wall components of S17 rice
[0105] Treatment Cellulose (mg / g) Hemicellulose (mg / g) Lignin (mg / g) Total Pectin (pmol / g) 0 mM Sterile 403.25±25.62a 168.46±6.25b 73.94±2.35c 55.81±22.01a 100 mM Sterile 153.94±9.68b 183.83±4.30a 112.28±3.25b 60.83±1.76a 0 mM Non-sterile 440.48±28.06a 143.37±1.59c 75.20±3.65c 49.82±11.64a 100 mM Non-sterile 145.06±43.92b 190.48±3.31a 121.49±4.83a 6.49±22.99b
[0106] According to Table 7, when S17 rice was not inoculated with D23 bacterial solution, the cellulose content in the cell wall of rice with a Na concentration of 0 mM was greater than that of rice with a Na concentration of 100 mM, while the lignin, hemicellulose and total pectin contents were less than those of rice with a Na concentration of 100 mM. When S17 was inoculated with bacterial solution, the cellulose content in the cell wall of rice with a Na concentration of 0 mM was greater than that of rice with a Na concentration of 100 mM, while the hemicellulose, lignin and total pectin contents were less than those of rice with a Na concentration of 100 mM. When the Na concentration was 0 mM, the cellulose and lignin contents in the cell wall of rice inoculated with bacterial solution were greater than those of rice not inoculated with bacterial solution, while the hemicellulose and total pectin contents were less than those of rice not inoculated with bacterial solution. When the Na concentration was 100 mM, the cellulose and total pectin contents in the cell wall of rice not inoculated with bacterial solution were greater than those of rice inoculated with bacterial solution, while the hemicellulose and lignin contents were less than those of rice inoculated with bacterial solution.
[0107] Table 8 Copy numbers of Cladosporium sp. in the root system and rhizosphere soil of rice R15
[0108]
[0109] Note: “*” indicates significant difference at the P=0.05 level, the same below.
[0110] Table 9 Copy numbers of Cladosporium sp. in rice roots and rhizosphere soil of S17 rice
[0111]
[0112] Figure 6 and Figure 7The colonization of Clavibacter D23 in R15 and S27 is shown, indicating that Clavibacter is widely colonized in the epidermal cells, air cavities and cortical cells of rice varieties R15 and S17. According to Table 8, the copy number of Clavibacter in the roots of R15 rice inoculated with D23 bacterial solution significantly increased at a concentration of 100 mM Na, while the copy number of Clavibacter in the rhizosphere soil significantly decreased, indicating that R15 allocates resources to resist stress, reducing carbon input to the rhizosphere Clavibacter. According to Table 9, after inoculation with D23 bacterial solution, the copy number of Clavibacter in the roots of S17 rice significantly decreased at 100 mM Na, while the copy number of Clavibacter in the rhizosphere soil significantly increased, suggesting that sensitive varieties increase carbon input to the rhizosphere Clavibacter under stress. It shows that different salt-tolerant varieties regulate the distribution of Clavibacter in the root zone differently.
[0113] Table 10 Na ion flow in the roots of R15 rice and the roots of S17 rice
[0114]
[0115] Note: positive numbers indicate efflux, and negative numbers indicate influx.
[0116] Table 11 R15 and S17 rice cell wall thickness measurement data
[0117] Treatment R15 S17 0 0.52±0.16 0.72±0.33 D23 0.42±0.16 0.73±0.18 100 Na 0.80±0.34 0.66±0.18 100 Na+D23 0.99±0.45 0.45±0.20
[0118] According to Table 10, the Na ion efflux rate in the root zone of the two rice varieties significantly increased at 100 mM NaCl. After inoculation with salt-tolerant Clavibacter D23, the sodium ion in the root system changed from efflux to influx, and the influx rate increased at 100 mM. According to Table 11 and Figure 8-9 it is known that for R15, under the condition of inoculation, the increase of Na ion concentration significantly increases the thickness of root cell wall; while under the same condition, the thickness of root cell wall of S17 variety significantly decreases. Under 100 mM sodium stress, inoculation of Clavibacter D23 also significantly reduces the cell wall thickness of S17 rice variety. The stress response of cell wall thickness to Na ion toxicity, and the thickening of cell wall will also affect the absorption of nitrogen and phosphorus nutrients, and inoculation of Clavibacter D23 can well alleviate the above symptoms.
[0119] Example 3 Effect of salt-tolerant Clavibacter D23 inoculation on R15 and S17 growth
[0120] Microzone test was used to verify the inoculation effect of Clavibacter. The pot volume is 55 cm long x 45 cm wide x 34 cm high, and each pot contains 55 x 45 x 20 x 1.35 = 70 Kg of soil.
[0121] Select R15 and S17 rice seedlings grown in water, when the seedlings are 10 cm high, transplant them into pots, 3 rows per pot, 5 holes per row, and 3 seedlings per hole, 15 x 3 = 45.
[0122] R15 inoculation group and R15 non-inoculation group, S17 inoculation group and S17 non-inoculation group were set up, and 120 mL of salt-tolerant Lentinus tigrinus D23 bacterial solution (10 6 copys / mL) was added to the inoculation group, and 120 mL of culture medium was added to the non-inoculation group. Cultivation was carried out in a natural state, and water and fertilizer were supplemented as needed during the period. After 6 weeks of growth, the plant height, SPDA value, tiller number and biomass were determined. The experimental data were expressed as "mean ± standard deviation", and Duncan test was used for data homogeneity. The results are shown in Tables 12-13 and Figure 10 .
[0123] Table 12 Plant height, SPDA and tiller number of R15 and S17 rice at the jointing stage
[0124] Treatment Plant Height (cm) SPDA Tiller Number R15 Inoculated 86.67±2.65a 44.06±1.95a 6.70±1.70b R15 Uninoculated 82.11±2.67b 43.68±2.36a 4.89±0.33c S17 Inoculated 63.78±1.84c 41.99 ± 2.28ab 10.30±1.42a S17 Uninoculated 61.67±2.12c 40.71±2.89b 7.60±1.26b
[0125] Table 13 Plant height, SPDA and tiller number of R15 and S17 rice at the heading stage
[0126] Treatment Plant Height (cm) SPDA Tiller Number R15 Inoculated 95.40±2.67a 39.49±1.91a 7.20±1.32b R15 Uninoculated 91.80±4.85b 38.82±1.76a 4.20 ± 0.63cc S17 Inoculated 68.20±1.87c 39.47±1.29a 9.70±1.42a S17 Uninoculated 65.10±2.69d 35.72±2.31b 7.70±2.16b
[0127] According to Tables 12-13 and Figure 10 , it can be seen that the plant height, SPDA and tiller number of R15 rice inoculated with bacteria are higher than those of R15 rice without inoculation, and the plant height, SPDA and tiller number of S17 rice inoculated with bacteria are higher than those of S17 rice without inoculation. It is shown that Lentinus tigrinus inoculation can promote the growth of R15 and S17 rice in saline-alkali soil.
[0128] Example 4 Effect of Lentinus tigrinus D23 inoculation on R15 and S17 rice varieties root system and exudates
[0129] R15 and S17 seedlings with a height of 10 cm were selected, and the roots were washed thoroughly with sterile water to remove the microorganisms on the root surface. The seedlings were transplanted into the prepared salt-alkali soil in the sterile bench, 2 seedlings per bottle. Each type of rice was randomly divided into 5 treatment groups, with 5 replicates in each group. Each culture bottle was filled with 240 g of salt-alkali soil mixed with a 2 mm sieve, 100 mL of distilled water was added, and the mixture was sterilized at 121°C for 20 min for 3 times. The properties of the salt-alkali soil were as follows: AP 5.66 mg / kg, AK 11.40 mg / kg, PH 8.38, EC 437.70 ms / m.
[0130] Each treatment group was inoculated with 0 mL, 0.01 mL, 0.1 mL, 1 mL and 10 mL of salt-tolerant Lentinus tigrinus D23 bacterial solution (10 6 copys / mL), which corresponded to 0 g / Kg, 0.0001 g / Kg, 0.001 g / Kg, 0.01 g / Kg and 0.1 g / Kg of bacterial dry weight, respectively; and distilled water was supplemented to the appropriate level for continuous cultivation.
[0131] After 2 weeks of culture, the roots of the plants were carefully removed with minimal damage, rinsed with excess sterile water to remove loose substrate, and placed in a 50 mL sterile centrifuge tube wrapped in foil containing 30 mL of 0.5 mM CaCl2solution in sterile water, ensuring complete submersion of the roots. The tubes were immediately placed in a 4°C environment and stored in the dark for 6-8 h. The roots were then carefully removed, and the solution in the centrifuge tube was filtered through a 0.45 μm filter to remove debris, and the filtrate was lyophilized to obtain the exudate solution. The lyophilized root exudate was dissolved in 50 mL of methanol, and the content of organic acids, including shikimic acid, was determined using targeted metabolomics to calculate the relative and absolute contents of shikimic acid. The lyophilized powder was added to 1000 μL of 70% methanol water internal standard extraction solution and vortexed for 5 min. The solution was centrifuged at 12000 r / min for 10 min at 4°C, and 250 μL of the supernatant was transferred to a new centrifuge tube. The tube was stored in a -20°C refrigerator for half an hour, and then centrifuged at 12000 r / min for 10 min at 4°C. 180 μL of the supernatant was used for analysis after protein precipitation, and the analysis solution was stored at -20°C. Qualitative analysis was performed after chromatography and mass spectrometry using UltraPerformance Liquid Chromatography (UPLC) and Tandem Mass Spectrometry (MS / MS). The experimental data were analyzed using SPSS 19.0, and the results are shown in Tables 14-17.
[0132] Table 14 Root index of S17 rice inoculated with different gradients of bacterial solution
[0133] Treatment Total Root Length (cm) Average Diameter (mm) Volume (cm3) Root Tip Number 0 mL 267.02±58.00a 0.33±0.03a 0.23±0.05a 2597.20±464.68a 0.01 mL 243.66 ± 66.24ab 0.35±0.04a 0.23±0.03a 2599.20±777.89a 0.1 mL 217.26 ± 33.28ab 0.34±0.04a 0.20 ± 0.04ab 2141.40 ± 427.44ab 1 mL 169.23±49.03b 0.32±0.04a 0.14±0.06b 1778.60 ± 1778.60ab 10 mL 181.82±65.69b 0.33±0.04a 0.15±0.04b 1617.80±695.27b
[0134] Table 15 Root index of S17 rice inoculated with different gradients of bacterial solution
[0135] Treatment Total Root Length (cm) Average Diameter (mm) Volume (cm3) Root Tip Number 0 mL 140.04±39.88b 0.32±0.03b 0.11±0.02b 1201.80±436.10a 0.01 mL 171.97 ± 51.89ab 0.33±0.04b 0.15±0.07b 1317.00±285.56a 0.1 mL 188.96 ± 69.88ab 0.35 ± 0.04ab 0.35±0.04b 1540.40±624.47a 1 mL 175.07 ± 33.86ab 0.33 ± 0.02ab 0.33±0.02b 1433.40±380.51a 10 mL 252.08±75.70a 0.38±0.04a 0.38±0.04a 1846.20±661.46a
[0136] According to Table 14, the total root length of R15 rice decreases with the increase of the inoculation concentration of the bacteria liquid, the average diameter of the root system inoculated with different concentrations of the bacteria liquid changes little, the total volume of the root system generally decreases with the increase of the inoculation concentration, and the number of root tips decreases with the increase of the inoculation concentration of the bacteria liquid. According to Table 15, the total root length of S17 rice increases with the increase of the inoculation concentration of the bacteria liquid, the average diameter of the root system inoculated with different concentrations of the bacteria liquid changes little, the volume of the root system increases with the increase of the concentration, and the number of root tips inoculated with different concentrations of the bacteria liquid changes little. It is shown that the promotion effect of the clavariazima on the root system growth of rice has variety difference. Specifically, the greater the sensitive inoculation amount is, the better the growth promotion effect is, while the low concentration has growth promotion effect on the salt-tolerant variety, and the high concentration will inhibit it. The sensitive variety has poor stress resistance, and has strong dependence on the root system probiotics, so a large amount of metabolic substances are input to support the survival and function of the clavariazima, and the inoculation amount and the growth promotion effect change consistently. The resistant variety has certain resistance, and has less input of beneficial microorganisms, so that the clavariazima cannot obtain enough carbon source in the rhizosphere, and then the clavariazima is planted into the roots to compete for the carbon of the plant, which is not conducive to the growth. Therefore, the application amount of the salt-tolerant clavariazima involved in the application should be determined by fully considering the variety characteristics in the actual application.
[0137] Table 16 Correlation between the inoculation amount of salt-tolerant clavariazima D23 and organic acid metabolites of R15 rice
[0138]
[0139] Note: “**” represents that the difference is significant at the level of P=0.01, “*” represents that the difference is significant at the level of P=0.05, and the same below.
[0140] Table 17 Correlation between the inoculation amount of salt-tolerant clavariazima D23 and organic acid metabolites of S17 rice
[0141]
[0142]
[0143] According to Table 16, it can be seen that the inoculation amount of R15 rice Pythium aphanidermatum has significant positive correlation with the metabolic yield of 3-hydroxyisovalerate, p-hydroxybenzoic acid, chloramphenicol, pantothenic acid, salicylic acid, 4-aminobutyric acid, 4-coumaric acid, caffeic acid and 3-hydroxy-3-methylglutamic acid. It is illustrated that the salt-tolerant Pythium D23 promotes plant growth by up-regulating nitrogen metabolism (3-hydroxyisovalerate and 4-aminobutyric acid), vitamin metabolism (pantothenic acid) and secondary metabolism (p-hydroxybenzoic acid, 4-coumaric acid and caffeic acid). In addition, the positive correlation between the salt-tolerant Pythium D23 and salicylic acid indicates that the inoculation amount in the test setting is too large, which stimulates the hormone stress response of R15 rice. According to Table 17, it can be seen that the inoculation amount of S17 rice Pythium D23 has significant positive correlation with the metabolic yield of 3-hydroxyisovalerate, p-hydroxybenzoic acid, o-aminobenzoic acid, glutaric acid, pantothenic acid, 3-hydroxyphenylacetic acid, 5-hydroxymethyl-2-furoic acid and shikimic acid. It is illustrated that the salt-tolerant Pythium D23 promotes plant growth by up-regulating phenylalanine metabolic pathway (p-hydroxybenzoic acid, o-aminobenzoic acid, 3-hydroxyphenylacetic acid and shikimic acid), tricarboxylic acid cycle (glutaric acid) and vitamin synthesis pathway (pantothenic acid).
[0144] In summary, the salt-tolerant Pythium D23 can regulate the root metabolic pathway of plants, improve the salt tolerance of plants in saline-alkali land and promote plant growth.
[0145] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, but not all the embodiments. Other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.
Claims
1. A salt-tolerant Cladorrhinum hyalocarpum D23, characterized in that: The preservation number of the salt-tolerant Cladosporium sp. D23 is: CGMCC No.41437.
2. A microbial agent, characterized in that: The active ingredient of the microbial agent includes the salt-tolerant Cladosporium D23 described in claim 1.
3. The microbial agent according to claim 2, characterized in that The number of viable bacteria of the salt-tolerant Cladosporium D23 in the microbial agent is ≥1×10 6 CFU / mL or viable bacteria count ≥1×10 6 CFU / g.
4. Use of the haloduronic acid Cladosporium D23 according to claim 1 or the microbial agent according to claim 2 or 3 in at least one of the following 1) to 4): 1) Promoting plant growth in saline-alkali soil; 2) Improve the salt and alkali tolerance of plants; 3) Improve Na ion interception by plant roots; 4) Optimize the metabolic process of plant roots.
5. The use according to claim 4, characterized in that The plant growth promotion includes at least one of increasing plant height, increasing tiller number, increasing chlorophyll content and promoting root growth.
6. The use according to claim 5, characterized in that The promoting root growth includes: promoting root length and / or root volume.
7. The use according to any one of claims 4 to 6, characterized in that: The plants include rice.
8. A method for improving plant salt-alkali tolerance and / or promoting plant growth, characterized in that: The method comprises the following steps: applying the salt-tolerant Cladosporium sp. D23 according to claim 1 or the microbial agent according to claim 2 or 3 to plants.
9. The method according to claim 9, characterized in that The amount of application is 3 to 10 L / mu or 3 to 10 kg / mu.
10. The method according to claim 8 or 9, characterized in that: The application site includes the rhizosphere.