Acarisporidium arbuscula and application thereof in prevention and treatment of soft rot of Chinese cabbage
By using the fermentation liquid or fermentation supernatant of the HHZ07 strain of Acididium spp., the pathogen of cabbage soft rot is directly inhibited, which solves the green prevention and control problem of cabbage soft rot in the existing technology and achieves a significant disease inhibition effect.
Patent Information
- Application Number
- CN202511115087.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-11
- Publication Date
- 2025-10-17
AI Technical Summary
In existing technologies, the prevention and control of cabbage soft rot mainly relies on the selection and breeding of disease-resistant varieties and chemical agents. Disease-resistant breeding progresses slowly and is prone to drug resistance. Chemical control has environmental pollution problems, and green prevention and control strategies need to be developed.
The fermentation liquid or fermentation supernatant of Calcarisporium arbuscula HHZ07 strain was sprayed on cabbage to directly inhibit the soft rot of cabbage caused by Pectobacterium carotovorum subsp. brasiliense (Pcb). The fermentation liquid was 3 days old, and the crude metabolite extract was used for disease control.
The metabolites of Aspergillus niger can significantly inhibit the activity of pathogens, prolong the lag period of the pathogens, reduce the area of lesions, and provide theoretical basis and technical guidance for the prevention and control of cabbage soft rot with green biological agents.
Smart Images

Figure CN120796086A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of microorganisms, and particularly relates to a Calcarisporium arbuscula and application of the Calcarisporium arbuscula in prevention and treatment of Chinese cabbage soft rot. BACKGROUND
[0002] Chinese cabbage soft rot is a key bacterial disease caused by Pectobacterium carotovorum subsp. brasiliense (Pcb), which can occur in the field, storage and transportation process, and causes yield loss of Brassica rapa up to 20%-30%. At present, prevention and control mainly depends on disease-resistant variety breeding and chemical agents. However, disease-resistant breeding is limited by the complex pathogenicity differentiation of the pathogen, and the progress is slow; and chemical control (such as copper preparations, antibiotics, etc.) faces problems such as easy drug resistance of the pathogen, drug damage and environmental pollution of copper preparations. Therefore, it is urgent to develop a new green control strategy. SUMMARY
[0003] In view of the problems in the prior art, the purpose of the application is to provide a Calcarisporium arbuscula and application of the Calcarisporium arbuscula in prevention and treatment of Chinese cabbage soft rot.
[0004] In order to achieve the above purpose, the technical scheme is as follows: The Calcarisporium arbuscula is a Calcarisporium arbuscula HHZ07 strain, which was preserved in the China General Microbiological Culture Collection Center on June 5, 2025, with a preservation number of CGMCC No.42021 and a preservation address of No.3, Institute of Microbiology, Chinese Academy of Sciences, Beijing City, Chaoyang District, Beichen West Road 1st Courtyard.
[0005] The application of the Calcarisporium arbuscula in prevention and treatment of Chinese cabbage soft rot.
[0006] On the basis of the above scheme, the Chinese cabbage soft rot is a disease caused by Pectobacterium carotovorum subsp. brasiliense (Pcb).
[0007] A biological agent for preventing and treating Chinese cabbage soft rot, wherein the effective component is fermentation broth or fermentation supernatant of Calcarisporium arbuscula; the preservation number of the Calcarisporium arbuscula is CGMCC No.42021.
[0008] On the basis of the above scheme, the fermentation broth of the Calcarisporium arbuscula is a broth fermented for 3 days.
[0009] On the basis of the above scheme, the preparation method of the fermentation broth of Calcarisporium arbuscula is as follows: Calcarisporium arbuscula is inoculated into PDA liquid medium at an inoculation amount of 2%, and then cultured at 28℃ and 180rpm to obtain the fermentation broth.
[0010] On the basis of the above scheme, the fermentation supernatant of Calcarisporium arbuscula is a crude metabolite extract obtained by filtering and sterilizing the fermentation broth fermented for 3 days.
[0011] A method for preventing and treating Chinese cabbage soft rot, wherein the fermentation broth or fermentation supernatant of Calcarisporium arbuscula is sprayed on Chinese cabbage to achieve the purpose of preventing and treating Chinese cabbage soft rot, and the preservation number of the Calcarisporium arbuscula is CGMCC No.42021.
[0012] On the basis of the above scheme, the fermentation broth of Calcarisporium arbuscula is a broth fermented for 3 days.
[0013] On the basis of the above scheme, the fermentation supernatant of Calcarisporium arbuscula is a crude metabolite extract obtained by filtering and sterilizing the fermentation broth fermented for 3 days.
[0014] Advantages of the technical scheme of the present application The present application isolates and obtains a strain of endophytic fungus Calcarisporium arbuscula which is highly antagonistic to Pcb. The Calcarisporium arbuscula of the present application directly inhibits the activity of pathogenic bacteria by secreting heat-sensitive metabolites (80℃ inactivation). The bacteriostatic activity of the metabolites has a culture time and concentration dependence. The primary metabolites produced by culturing for 3 days can extend the lag phase of Pcb by 300% (8h vs 2h, P<0.01) and reduce the maximum biomass by 16.7% (ODmax=3.0 vs CK 3.6) at a 50% addition amount. The secondary metabolites produced by culturing for 6 days have almost no bacteriostatic properties. High-concentration Pcb (OD 600 =2.48) can weaken the bacteriostatic effect of the metabolites. In the seedling pot experiment using the metabolites of the Calcarisporium arbuscula of the present application, the pre-treatment of the metabolites of Calcarisporium arbuscula reduces the lesion area by 76.8% (0.7±0.2 cm 2 vs 3.2±0.5 cm 2 of the control), and the lesion of the treatment group is localized in the mechanical damage area, showing typical local resistance. Therefore, the Calcarisporium arbuscula of the present application has important application prospects in the prevention and treatment of Chinese cabbage soft rot, and provides an important theoretical basis and technical guidance for the development of green biological agents based on Calcarisporium arbuscula to prevent and control Chinese cabbage soft rot. BRIEF DESCRIPTION OF DRAWINGS
[0015] Figure 1 Inhibition of Calcarisporium arbuscula HHZ07 on Pcb in vitro at different concentrations (from left to right, OD 600In order, 0.12, 0.26, 0.62, 1.24, 2.48 Figure 2 Influence of metabolites of G. denticulatum HHZ07 with different dilution times on Pcb inhibition after 3d culture; Figure 3 Influence of metabolites of G. denticulatum HHZ07 with different dilution times on Pcb inhibition after 6d culture; Figure 4 Influence of metabolites of G. denticulatum HHZ07 treated at different temperatures on Pcb inhibition; Figure 5 Influence of metabolites of G. denticulatum HHZ07 on soft rot disease resistance of Chinese cabbage seedlings (wherein the left side: CK is PDA medium; the right side: metabolites of G. denticulatum HHZ07 treatment; the arrow is the inoculation site of soft rot pathogen); Figure 6 Inhibition of Pcb with OD 600 =0.1 by metabolites of G. denticulatum HHZ07 fermentation liquor; Figure 7 Inhibition of Pcb with OD 600 =0.3 by metabolites of G. denticulatum HHZ07 fermentation liquor; Figure 8 Inhibition of Pcb with OD 600 =0.4 by metabolites of G. denticulatum HHZ07 fermentation liquor; Figure 9 Inhibition of Pcb with OD 600 =0.5 by metabolites of G. denticulatum HHZ07 fermentation liquor; Figure 10 Inhibition of Pcb with OD 600 =1.0 by metabolites of G. denticulatum HHZ07 fermentation liquor. DETAILED DESCRIPTION
[0016] The terms used in the present application have the meanings generally understood by those of ordinary skill in the art, unless otherwise defined. The present application is described in further detail below in conjunction with specific examples and with reference to the data. The following examples are merely for the purpose of illustrating the present application, and are not intended to limit the scope of the present application in any way.
[0017] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The experimental materials, reagents, and drugs used in the following examples can be purchased through general channels, unless otherwise specified.
[0018] Example 1 Isolation, purification and identification of Calcarisporium arbuscula The fruiting bodies of Calocera corium were collected from Chuxiong Yi Autonomous Prefecture, Yunnan Province. The surface of the fruiting bodies was sterilized with 75% alcohol in a clean bench. The fruiting bodies were cut into 1 cm 2 size tissue blocks at the cut surface under sterile conditions, inoculated on PDA solid medium, and cultured at 24℃ in the dark for 5-7 days. Single colonies were picked and inoculated on PDA medium for purification and cultured for 5-7 days. After confirming that no other bacteria were growing, the pure endophytic fungus was used for subsequent experiments. The pure endophytic fungus was sent to Shanghai Shengong Biotechnology Co., Ltd. for Its sequencing. The obtained sequence was subjected to BLAST comparison, and the similarity with the sequence of Calcarisporium arbuscula strain was 100%. The strain was identified as Calcarisporium arbuscula HHZ07. The strain was preserved in the China General Microbiological Culture Collection Center on June 5, 2025, with the preservation number CGMCC No. 42021 and the address of the Institute of Microbiology, Chinese Academy of Sciences, No. 1, Beichen West Road, Chaoyang District, Beijing.
[0019] The Its sequence determination results are as follows: SEQ ID NO: 1 (5'→3') TGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCATGTGAACATACCTATCGTTGCTTCGGCGGGACCGCCCCGGCGCCTTGTGCCCGGAACCAGGCGCCCGCCGGAGACCACAAACTCTTGTATTTATA CGAATTATCTGAGGATTTATACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTG AACGCAATTGCGCCTGCCAGTATTCTGGCAGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAAGCCCCCGGGCTTGGTGTTGGGGACCGGCCACCGCCGCAACTCGCGGCAGGCCGCCCCCGAAATACAGTGG CGGTCACGCTGCGGCATCTCCTGCGTAGTAACACACCTCGCATCAGATACGCTACGAGACCACGCCGTAAAACAACCCACTTCTGAAATGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC Example 2 Inhibitory effect of Psoralea corylifolia HHZ07 on soft rot pathogen Pcb at different concentration gradients The Psoralea corylifolia HHZ07 was inoculated into a PDA plate and cultured at 28°C and 180 rpm for 3 days (logarithmic phase) and 6 days (stationary phase). The activated bacterial solution of the soft rot pathogen Pcb was inoculated into a beef extract peptone liquid medium and cultured at 30°C and 180 rpm for 24-48 hours to prepare different concentrations of Pcb bacterial suspensions (different concentrations refer to OD 600 =0.12, 0.24, 0.62, 1.24, 2.48). Plates were coated with different concentrations of PCB suspensions. Mycelial masses of 3-day and 6-day-old Cercospora spp. HHZ07 were inoculated onto the PCB plates, with the substrate surface or the aerial hyphae surface in contact. The plates were incubated at 28°C for 72 h, and the diameters of the inhibition zones were measured. Three biological replicates were performed.
[0020] The results are as follows Figure 1 As shown, Figure 1 The PCB concentrations in the plates from left to right are 0.12, 0.24, 0.62, 1.24, and 2.48 respectively; Figure 1A in the figure is a mycelial block of the 6-day-old spore spore HHZ07; B is a mycelial block of the 3-day-old spore spore HHZ07. The black arrow in B indicates the surface of the culture medium in contact with the PCB plate inoculation, and the non-arrowed block indicates the surface of the aerial mycelium in contact with the PCB plate inoculation. Figure 1 It can be seen that the mycelial block of HHZ07 cultured for 3 days has antibacterial activity, while the mycelial block of HHZ07 cultured for 6 days has no inhibition zone; moreover, the mycelial block can only be inoculated with the culture medium surface in contact with the PCB plate ( Figure 1 The arrow in row B indicates the bacterial block), only when the surface of the aerial hyphae is in contact can a clear inhibition zone be formed (100% formation rate); there is basically no inhibition phenomenon ( Figure 1 When the mycelial block was inoculated with the culture medium substrate surface in contact with the PCB plate, the mycelial block was inoculated with the culture medium substrate surface, and ... 600 The inhibition zone diameter increased by 15.4% (from 12.3 mm to 14.2 mm) with increasing Pcb concentration (0.12 to 1.24), but decreased significantly to 9.8 mm at the highest concentration (2.48).
[0021] Example 3 Effects of different culture time and working concentration of metabolites of Hypodiella sp. HHZ07 on the growth of Pcb The inoculum of 2% was inoculated into PDA liquid medium and cultured at 28°C and 180 rpm. The fermentation broth of 3 days (D3) and 6 days (D6) of culturing ... were collected and sterilized by 0.22 μm filter membrane to obtain crude metabolite extracts. A certain amount of crude metabolite extracts of D3 and D6 were mixed with LB liquid medium and PCB bacterial suspension (OD 600 = 0.6) and the total volume of the mixture was 1.5 mL. The amount of metabolite extract added was adjusted to 1 / 2, 1 / 4, and 1 / 8 of the total volume (see Table 1). The OD was automatically monitored every 2 h using a growth curve analyzer. 600 The untreated group was set as the control (CK) and repeated 3 times.
[0022] Table 1 Effects of different incubation times of metabolites of Psoralea corylifolia and different working concentrations of metabolites on the growth of Pcb By fitting the S-shaped growth curve (Gompertz model), it was found that ( Figure 2 and Figure 3 ): Treatment with 1 / 2 concentration of D3 metabolite (3-day culture) significantly prolonged the lag phase of Pcb (λ=8 h vs CK 2 h, p<0.01) and reduced its maximum biomass by 16.7% (ODmax =3.0 vs CK 3.6). The antibacterial effect was weakened with the increase of dilution ratio (1 / 4, 1 / 8 concentration only slightly lower than CK OD value in logarithmic phase). D6 metabolites (6 days of culture) at each concentration had no significant effect (p>0.05) on Pcb growth parameters (λ, μ max, OD max ) of Pcb, indicating that the antibacterial activity was lost.
[0023] Example 4 Effect of different temperature pretreatment on the antibacterial activity of G. denticulatum HHZ07 metabolites The D3 metabolite crude extract (prepared according to Example 3) was heated in a water bath at 40℃, 60℃, 80℃ for 30 min (control group 25℃), and cooled in an ice bath. According to the concentration combination of D3-1 / 2 in Table 1, mix. Use the growth curve analyzer to automatically monitor OD 600 value every 2 h, for 48 h. Set the untreated group as the control (CK), with 3 replicates.
[0024] The results are shown in Figure 4 , the antibacterial activity of G. denticulatum HHZ07 fermentation broth is heat sensitive: 80℃ treatment completely loses antibacterial activity, the growth curve has no difference with the positive control (no metabolites); 60℃ treatment has no difference with the positive control in lag phase, but the logarithmic phase bacterial concentration is lower than the positive control, indicating that part of the antibacterial activity is retained; 40℃ treatment has a significantly longer lag phase than the positive control (2.5 h vs ~2 h), and the logarithmic phase bacterial concentration is significantly lower than the positive control, with less affected antibacterial activity.
[0025] Example 5 Protection of G. denticulatum HHZ07 metabolites on Pakchoi seedlings against Pcb Draw a "cross" at the base of the 2-3 true leaves of Pakchoi seedlings. Dip the D3 metabolite crude extract (prepared according to Example 3) or PDA medium control with a sterile cotton swab, evenly smear on the damaged area, and air dry for 10 min at room temperature. Dip the Pcb liquid (OD 600 =0.6) with a sterile cotton swab and smear it on the same damaged area. Place the seedlings in an artificial climate chamber (25℃, 16 h light / 8 h dark, RH 80%) for culture, and observe the lesion area 24-48 h after inoculation.
[0026] The results are shown in Figure 5 : the control group (CK) showed typical water-soaked lesions (area 3.2 ± 0.5 cm 2 ) at the injury site 24 h after inoculation with Pcb, and the lesions expanded to the veins and the leaves shriveled 48 h later. The lesion area of the metabolite pretreatment group was significantly reduced by 76.8% (0.7 ± 0.2 cm 2, p<0.01), and the lesion was strictly limited in the mechanical damage area, and did not spread to the surrounding healthy tissue, showing typical local acquired resistance characteristics.
[0027] Example 6 Inhibition of Pcb by G. denticulatum HHZ07 metabolites The G. denticulatum D3 fermentation supernatant (prepared according to Example 3) was mixed with Pcb bacterial suspensions (OD 600 = 0.1, 0.3, 0.5, 0.7, 1.0) in 24-well plates. The OD 600 changes were monitored by a growth curve analyzer.
[0028] G. denticulatum HHZ07 fermentation broth showed significant inhibition (prolonged lag phase, lower OD values in the logarithmic phase and plateau phase than the control) to all test concentrations of Pcb (OD 600 = 0.1-1.0), and the effect was stronger at higher concentrations of fermentation broth. Figure 6-10
[0029] The above description is only the preferred embodiments of the present application, and is not intended to limit the present application in other forms. Any person skilled in the art can modify or change the above-mentioned disclosed technical content to equivalent embodiments. However, any simple modification, equivalent change and modification of the above-mentioned embodiments without departing from the technical solution of the present application, and according to the technical essence of the present application, still belongs to the protection scope of the technical solution of the present application.
Claims
1. A strain of Odontoglossum, characterized in that The Calcarisporium arbuscula is the Calcarisporium arbuscula HHZ07 strain, which was deposited in the General Microbiology Center of the China Culture Collection Administration on June 5, 2025, with the deposit number CGMCC No. 42021, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.
2. Use of the fungus Psoralea corylifolia according to claim 1 in preventing and treating soft rot of Chinese cabbage.
3. The use according to claim 2, characterized in that The cabbage soft rot is a disease caused by Pectobacterium carotovorum subsp. brasiliense (Pcb).
4. A biological agent for preventing and treating cabbage soft rot, characterized in that: The active ingredient is the fermentation liquid or fermentation supernatant of Corydalis spp.; the preservation number of Corydalis spp. is CGMCC No.42021.
5. The biological agent for preventing and treating cabbage soft rot according to claim 4, characterized in that: The fermentation broth of the Acididium spp. is a broth fermented for 3 days.
6. The biological agent for preventing and treating soft rot of cabbage according to claim 5, characterized in that: The preparation method of the fermentation bacterial liquid of the sclerotium is as follows: the sclerotium is inoculated into a PDA liquid culture medium at a 2% inoculation amount, and cultured at 28° C. and 180 rpm.
7. The biological agent for preventing and treating soft rot of Chinese cabbage according to claim 4, characterized in that: The fermentation supernatant of the Acidis spp. is a crude metabolite extract obtained by filtering and sterilizing the fermentation broth fermented for 3 days.
8. A method for preventing and treating soft rot of cabbage, characterized in that: The purpose of preventing and controlling the soft rot of cabbage is achieved by spraying the fermentation liquid or fermentation supernatant of Cercospora spp. on the cabbage. The preservation number of Cercospora spp. is CGMCC No.42021.
9. The method for preventing and controlling soft rot of Chinese cabbage according to claim 8, characterized in that: The fermentation broth of the Acididium spp. is a broth fermented for 3 days.
10. The method for preventing and controlling soft rot of Chinese cabbage according to claim 8, characterized in that: The fermentation supernatant of the Acidis spp. is a crude metabolite extract obtained by filtering and sterilizing the fermentation broth fermented for 3 days.