Uses of a common Bacteroides in lowering blood sugar

By isolating and purifying the Bacteroides vulgaris J2525 strain, the adverse reaction problem of existing hyperglycemia treatment drugs has been solved, and the effects of significantly reducing fasting blood glucose and improving glucose tolerance and insulin sensitivity have been achieved without affecting weight and appetite, providing a safe new intervention technology.

CN120796134BActive Publication Date: 2026-05-05ZHEJIANG UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHEJIANG UNIV
Filing Date
2025-07-23
Publication Date
2026-05-05

AI Technical Summary

Technical Problem

Existing medications for treating hyperglycemia have adverse reactions, affecting the safety of long-term use and patient compliance. There is a lack of novel intervention technologies with clear sources, well-defined effects, and higher safety. The application of Bacteroides plebeius in lowering blood sugar has not been systematically studied.

Method used

Using the Gram-negative strain Bacteroides vulgaris J2525 isolated and purified from human feces, an animal intervention experiment was conducted to verify its effect on improving blood glucose in a metabolic disorder model mouse. Long-term intervention was carried out, and body weight and blood glucose were monitored. It was found that it significantly improved fasting blood glucose, glucose tolerance and insulin tolerance.

Benefits of technology

Bacteroides J2525 significantly reduces fasting blood glucose levels, improves glucose tolerance and insulin sensitivity, without affecting body weight and food intake, providing a safe and effective blood glucose-lowering strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796134B_ABST
    Figure CN120796134B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of Bacteroides in lowering blood sugar. Specifically, the present application provides a kind of Bacteroides plebeius J2525 with the function of lowering blood sugar, which is a strain of gram-negative bacteria isolated and purified from human feces, which has been preserved in China General Microbiological Culture Collection Center (CGMCC) on April 25, 2025, and the preservation number is CGMCC NO.46398. The present application also provides the use of Bacteroides plebeius J2525 of the present application in the preparation of products for lowering blood sugar, improving glucose tolerance or improving insulin sensitivity. The present application shows that Bacteroides plebeius strain J2525 can be developed as a kind of probiotics with good blood sugar lowering effect, and has high reference value for the application of the strain in clinic.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbiology, and more specifically, to the use of a common Bacteroides in lowering blood sugar. Background Technology

[0002] Hyperglycemia is the most prominent clinical manifestation and diagnostic criterion for diabetes, and it is also a core pathological link in the development of many chronic metabolic diseases. Long-term or chronic hyperglycemia can cause irreversible damage to blood vessels, nerves, and multiple vital organs, leading to serious health consequences. Various metabolic disorders caused by hyperglycemia have become a major global public health challenge. Current technologies indicate that the gut microbiota, as an indispensable "metabolic organ" and "immune regulator" of the host, plays a crucial mediating role in the pathophysiological process of diabetes by regulating energy metabolism, maintaining intestinal barrier integrity, producing key metabolites such as short-chain fatty acids, and influencing systemic inflammation levels. Therefore, targeted regulation of the gut microbiota to improve host glucose metabolism disorders has become a recognized promising intervention strategy in this field.

[0003] Current traditional treatments include oral hypoglycemic agents and insulin preparations. While these can control blood sugar to some extent, their clinical application is often accompanied by adverse reactions, including the risk of hypoglycemia, gastrointestinal discomfort, weight gain, and increased metabolic burden on the liver and kidneys. These drawbacks seriously affect the long-term safety and patient adherence. Therefore, there is an urgent need in the industry to develop novel intervention technologies with clear sources, well-defined mechanisms of action, and higher safety. Screening and identifying specific functional strains from human gut commensal bacteria that can effectively regulate glucose and lipid metabolism disorders has become a technological hotspot in the development of next-generation diabetes biotherapies. However, there is currently no research on the use of Bacteroides commensalis (Bacteroides commensalis)... Bacteroides plebeius Systematic research reports or related technology applications for the prevention, relief or treatment of hyperglycemia are publicly disclosed. Summary of the Invention

[0004] This invention provides a common bacterium with hypoglycemic function ( Bacteroides plebeiusJ2525, a Gram-negative bacterium isolated and purified from human feces, is an anaerobic bacterium living in the human gut. It was deposited on April 25, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC NO. 46398. This invention verifies the blood glucose-improving effect of *Bacteroides vulgaris* on a metabolic disorder model mouse through animal intervention experiments. A long-term intervention experiment with *Bacteroides vulgaris* was conducted in mice, monitoring their weight and blood glucose levels. Glucose tolerance and insulin tolerance tests were performed after 6 weeks of intervention. The results demonstrate that *Bacteroides vulgaris* J2525 of this invention does not affect the weight or food intake of mice, but significantly improves fasting blood glucose, glucose tolerance, and insulin tolerance in mice fed a high-fat diet.

[0005] In this context, the present invention includes, but is not limited to, the following:

[0006] In one aspect, the present invention provides a Bacteroides vulgaris J2525 with hypoglycemic function, which was deposited on April 25, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO. 46398.

[0007] In another aspect, the present invention provides a hypoglycemic drug comprising the live Bacteroides J2525 strain described herein, its fermentation broth, or an extract thereof.

[0008] In another aspect, the present invention provides a medicine for improving glucose tolerance, comprising live Bacteroides J2525 as described in the present invention, its fermentation broth or an extract thereof.

[0009] In another aspect, the present invention provides a medicine for improving insulin sensitivity, comprising the live Bacteroides J2525 bacteria described in the present invention, its fermentation broth, or an extract thereof.

[0010] In another aspect, the present invention provides the use of the Bacteroides vulgaris J2525 described herein in the preparation of hypoglycemic drugs.

[0011] In another aspect, the present invention provides the use of the Bacteroides vulgaris J2525 described herein in the preparation of a pharmaceutical for improving glucose tolerance.

[0012] In another aspect, the present invention provides the use of the Bacteroides vulgaris J2525 described herein in the preparation of a medicament for improving insulin sensitivity.

[0013] In one aspect, the pharmaceutical product of the present invention comprises live Bacteroides J2525, its fermentation broth, or an extract thereof.

[0014] In one aspect, the pharmaceutical product of the present invention comprises live Bacteroides J2525.

[0015] Beneficial technical effects:

[0016] The *Bacteroides vulgaris* J2525 strain of this invention can significantly reduce fasting blood glucose levels, improve glucose tolerance, and increase insulin sensitivity. Furthermore, this invention also found that the *Bacteroides vulgaris* strain of this invention does not affect body weight or food intake. In vivo experimental data of this invention directly confirms for the first time that the *Bacteroides vulgaris* strain of this invention has a significant effect on improving blood glucose homeostasis. These results indicate that the *Bacteroides vulgaris* strain of this invention can be developed as a probiotic with good hypoglycemic effects and has high reference value for its clinical application. Attached Figure Description

[0017] Figure 1 The growth curve of Bacteroides J2525 is shown.

[0018] Figure 2 The fasting blood glucose level of mice was shown after 6 weeks of bacterial intervention. express p <0.05).

[0019] Figure 3 This shows the blood glucose levels in mice after 6 weeks of bacterial intervention, as measured by an oral glucose tolerance test (OGTT). and This indicates a significant difference in blood glucose levels between the Bacteroides intervention group and the control group. express p <0.05, express p <0.01).

[0020] Figure 4 The area under the blood glucose curve in mice after 6 weeks of bacterial intervention was shown. express p <0.05).

[0021] Figure 5 The results showed that after 6 weeks of bacterial intervention, the blood glucose levels in mice were measured using the insulin tolerance test (ITT). and This indicates a significant difference in blood glucose levels between the Bacteroides intervention group and the control group. express p <0.05, express p <0.01).

[0022] Figure 6 The area under the blood glucose curve in mice after 6 weeks of bacterial intervention was shown. express p <0.01).

[0023] Figure 7 This shows the fasting body weight of mice during bacterial culture intervention.

[0024] Figure 8 This shows the amount of food consumed by mice during bacterial culture intervention. Detailed Implementation

[0025] Example 1: In vitro fermentation experiment of Bacteroides vulgaris

[0026] Experimental methods:

[0027] 1. Screening, identification, and preservation of Bacteroides J2525

[0028] 1.1 Sample Source

[0029] The strain used in this invention was isolated from the feces of healthy adult males in the Hangzhou area.

[0030] 1.2 Isolation and purification of strains

[0031] Approximately 2g of fresh fecal sample was collected in a sterile tube and immediately sent to the laboratory for bacterial isolation. 1g of sample was placed in 9mL of heme-supplemented brain heart extract (h-BHI) liquid culture medium, vortexed, and then enriched under anaerobic conditions at 37℃ for 24h. Then, 1mL of the enriched solution was extracted in a laminar flow hood and serially diluted tenfold with sterile physiological saline. 10... 6 10 7 10 8 Three dilution gradients were applied, with 100 μL of bacterial culture from each gradient spread onto h-BHI agar medium and incubated at 37°C for 24–48 h. After incubation, samples with 50 cells / mL of bacterial culture grown were selected from the agar medium. A plate containing 150 single colonies was used. Typical colonies were picked and purified again on h-BHI agar medium. Then, single colonies were picked and amplified on h-BHI agar medium. The amplified bacterial culture was used for cryopreservation (50% glycerol) and 16S rDNA sequencing identification.

[0032] 1.3 16S rDNA Identification

[0033] Genomic DNA was extracted from bacterial culture using the TIANamp bacterial genomic DNA extraction kit. The extracted genomic DNA was used as a template for PCR amplification, and PCR experiments were performed using universal bacterial primers 27F and 1492R for 16S rDNA. After PCR amplification, the PCR product was analyzed by agarose gel electrophoresis and photographed; the amplified fragment length was approximately 1.4 kbp. The PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The results are shown in SEQ ID NO: 1. BLAST sequence alignment on the NCBI website showed that the sequence had over 99% homology with the identified 16S rDNA sequence of *Bacteroides vulgaris*, confirming that the selected strain was *Bacteroides vulgaris*.

[0034] The strain of this invention, Bacteroides vulgaris J2525, is preserved under the name Bacteroides vulgaris (…). Bacteroides plebeius (), deposited by: China General Microbiological Culture Collection Center, deposited address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, deposit number: CGMCC NO. 46398, deposited on April 25, 2025.

[0035] In this invention, the preparation method of Bacteroides vulgaris J2525 bacterial suspension is as follows: Bacteroides vulgaris J2525 preserved in glycerol tubes is first streaked 2-3 times on h-BHI agar plates for activation. Then, single colonies are picked and cultured in h-BHI liquid medium at 37°C for 24-36 hours until the bacterial suspension concentration reaches 10%. 9 ~10 10 The concentration is approximately CFU / mL, used as a bacterial suspension. In actual use, the concentration can be adjusted using conventional methods.

[0036] The isolation and culture of the above-mentioned strains were carried out in an anaerobic incubator at 37°C, with a gaseous environment of 90% nitrogen, 5% carbon dioxide, and 5% hydrogen. Under these conditions, *Bacteroides vulgaris* achieved a rapid exponential growth from an OD value of 0.15 to 1.1 within 8 hours (see [link to relevant documentation]). Figure 1The detailed formulation of the above-mentioned h-BHI medium is as follows: 10.0 g peptone; 12.5 g dehydrated calf brain extract; 5.0 g dehydrated calf heart extract; 5.0 g sodium chloride; 2.0 g glucose; 2.5 g disodium hydrogen phosphate. Adjust the pH to 7.4 ± 0.2; bring the volume to 1 L, and autoclave at 121°C for 15 minutes.

[0037] Bacteroides vulgaris ( Bacteroides plebeius Strain J2525 was isolated from a human fecal sample, and its 16S rRNA was sequenced, as shown in SEQ ID NO: 1.

[0038] >BP.16S-27FSEQ ID NO: 1:

[0039] CTCGGCTTACCATGCAGTCGAGGGGCAGCGGGATTGAAGCTTGCTTCAATTGCCGGCGACCGGCGCACGGGTGAGTAACGCGTATCCAACCTTCCGTACACTCAGGGATAGCCTTTCGAAAGAAAGATTAATACCTGATGGTATGATGAGATTGCATGATAGCATCATTAAAGATTTATCGGTGTACGATGGGGATGCGTTCCATTAGGTAGTAGGCGGGGTAACGGCCCACCTAGCCTACGATGGATAGGGGTTCTGAGAGGAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGAAGGTCCTACGGATTGTAAACTTCTTTTATAAGGGAATAAAACCTCCCACGTGTGGGAGCTTGTATGTACCTTATGAATAAGCATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGTCGTTAAGTCAGCTGTGAAAGTTTGGGGCTCAACCTTAAAATTGCAGTTGATACTGGCGTCCTTGAGTGCGGTTGAGGTGTGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGATATCACGAAGAACTCCGATTGCGAAGGCAGCACACTAAGCCGTAACTGACGTTCATGCTCGAAAGTGTGGGTATCAAACAGGATTAGATACCCTGGTAGTCCACACGGTAAACGATGGATACTCGCTGTTGGCGATATACAGTCAGCGGCTTAGCGAAAGCGTTAAGTATCCCACCTGGGGAGTACGCCGGCAACGGTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGCTTAAATTGCAAAGGAATGATCTGGAAACAGGTCAGTC。

[0040] Example 2: Mouse intervention experiment with Bacteroides vulgaris

[0041] 1. Mouse experiment

[0042] Specific pathogen-free (SPF) grade C57BL / 6 male mice were housed in a standard SPF environment with environmental conditions of 20-24°C, 40%-60% relative humidity, and a 12-hour diurnal cycle.

[0043] Eight-week-old mice were randomly divided into a control group (n=5), a *Bacteroides commonis* J2525 intervention group (n=5), and a *Bacteroides monomorpha* intervention group (n=5). After one week of barrier adaptation, mice were fed a high-fat diet (60% fat-based energy source, Changzhou Shuyi Shuer Biotechnology Co., Ltd., product number: PD6001) for eight weeks. Following this, *Bacteroides commonis* J2525 colonization was performed for six consecutive weeks. During colonization, control group mice were administered PBS (100 μL per mouse) by gavage, while experimental group mice were administered *Bacteroides commonis* J2525 and *Bacteroides monomorpha* (approximately 10 μL each) in the logarithmic growth phase by gavage. 9 CFU / mouse, with the culture and preparation method of *Bacteroides monomorpha* cultured in the same manner as *Bacteroides commonis* J2525. To enhance colonization, mice were administered glucose via gavage daily for the first week and three times weekly for the following five weeks. At the end of the experiment, mice underwent an oral glucose tolerance test (OGTT) and an insulin tolerance test (ITT). For the OGTT, mice were fasted for 12 hours and then administered glucose (2 g / kg) orally via gavage. For the ITT, mice were fasted for 6 hours and then injected intraperitoneally with insulin (0.6 U / kg, Shanghai Beyotime Biotechnology Co., Ltd., catalog number: P3376). Blood glucose levels were measured before and after glucose / insulin administration (0, 30, 60, 90, and 120 minutes). The method is as follows: The experimental mice were effectively fixed and their tails were fully exposed. Then, the tip of the mouse's tail was disinfected with a cotton ball soaked in 75% alcohol. After the alcohol had completely evaporated, the tip of the tail was quickly cut off by sterile surgical scissors, about 1-2 mm. A drop of blood was collected from the wound by applying pressure from the base of the tail to the tip. The blood glucose concentration was measured and recorded using a portable blood glucose meter (Sannuo Biosensor Co., Ltd., GA-3 blood glucose meter) and test strips. After the test was completed, the wound was immediately pressed with sterile dry gauze until the bleeding stopped completely, and then the mouse was removed from the restraint.

[0044] 2. Statistical Analysis

[0045] Data are expressed as mean ± standard deviation. One-way ANOVA was used to compare population differences between groups. If the ANOVA results were statistically significant (…), then… pIf the value is <0.05, Dunnett's post-hoc test is used to further analyze the differences between each treatment group and the control group. P A value <0.05 was considered statistically significant. Statistical analysis was performed using GraphPad Prism 10 software.

[0046] In intervention experiments on mice, it was found that the Bacteroides strain J2525 of this invention could significantly reduce fasting blood glucose levels and improve glucose tolerance in mice (see [link to relevant documentation]). Figure 2-4 Among them, fasting blood glucose levels: the average decrease in the Bacteroides J2525 intervention group was 17.0% compared with the control group (). p <0.05 (see Figure 2 ); Glucose tolerance: The average area under the blood glucose curve decreased by 24.3% in the oral glucose tolerance test (OGTT). p <0.01) (see Figure 4 Insulin sensitivity: The average area under the blood glucose curve decreased by 40.0% in the insulin tolerance test (ITT). p <0.05 (see Figure 6 Bacteroides monomorpha did not improve fasting blood glucose, glucose tolerance, or insulin tolerance in mice. Furthermore, there were significant differences in glucose tolerance and insulin tolerance between the Bacteroides monomorpha intervention group and the Bacteroides common intervention group, with marginally significant differences in fasting blood glucose levels. p = 0.06, Figure 2 The areas under the blood glucose curve for both OGTT and ITT in the routine Bacteroides intervention group were significantly lower than those in the monobacteroides intervention group. p <0.05, Figure 4 and 6 These results indicate that blood glucose lowering is a unique function of Bacteroides J2525.

[0047] Furthermore, in this study, we observed that intervention with Bacteroides thuringiensis J2525 significantly improved glucose metabolism parameters in mice, while mouse body weight and food intake did not change significantly (see [link to study report]). Figure 7 and Figure 8This discovery is significant, suggesting that Bacteroides vulgaris J2525 of this invention may exert its hypoglycemic effect through a specific mechanism independent of overall energy balance or appetite regulation. Many metabolic interventions (whether pharmaceuticals or other probiotics, such as GLP-1) are often accompanied by changes in weight or food intake, and this selective effect of Bacteroides vulgaris J2525 reveals that its glycemic regulation is independent of weight / appetite control pathways. Importantly, this characteristic of Bacteroides vulgaris J2525 in improving only blood glucose without affecting weight and food intake may have unique advantages in clinical applications. For individuals who need to control their blood glucose but do not wish to experience weight loss (e.g., in certain populations) or changes in appetite (which may affect quality of life or adherence), Bacteroides vulgaris J2525 may offer a more targeted treatment strategy.

Claims

1. A hypoglycemic drug, characterized in that, Includes Bacteroides vulgaris ( Bacteroides plebeius The live strain J2525, its fermentation broth, or its fermentation broth extract, wherein the Bacteroides vulgaris J2525 was deposited on April 25, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO. 46398.

2. The use of Bacteroides J2525 in the preparation of hypoglycemic drugs, characterized in that, The Bacteroides vulgaris J2525 was deposited on April 25, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.46398.

3. The use according to claim 2, characterized in that, The drug contains live Bacteroides J2525, its fermentation broth, or its fermentation broth extract.

Citation Information

Patent Citations

  • Common bacteroides and application thereof

    CN120442502A