Application of LRR receptor kinase PcTMK1 in improving fungal disease resistance of poplar

By overexpressing the LRR receptor kinase PcTMK1 gene in poplar trees, the environmental problems caused by chemical fungicides and the long traditional breeding cycle were solved, the poplar trees' resistance to fungal diseases was effectively improved, and the use of pesticides and environmental pollution were reduced.

CN120796232APending Publication Date: 2025-10-17NANJING FORESTRY UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510961016.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-12
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

Chemical fungicides in existing technologies lead to environmental residues and pathogen resistance. Traditional disease-resistant breeding cycles are long and lack natural resistance gene resources. Existing gene transformation methods have limited effects in poplars and lack an efficient and stable transformation system.

Method used

The LRR receptor kinase PcTMK1 gene is overexpressed, and the overexpression vector is constructed and transformed into poplar tissue to improve the poplar's resistance to fungal diseases. The specific steps include constructing the vector, transforming and screening transgenic poplars.

Benefits of technology

It significantly improves the resistance of poplar trees to Diplodia populi, reduces the use of chemical pesticides, reduces environmental pollution, and does not affect the growth rate of poplar trees.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796232A_ABST
    Figure CN120796232A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to application of LRR receptor kinase PcTMK1 in improving fungal disease resistance of poplars, the amino acid sequence of protein encoded by the LRR receptor kinase PcTMK1 is shown as SEQ ID NO.1, and the nucleotide sequence of the LRR receptor kinase PcTMK1 is shown as SEQ ID NO.2. The invention further discloses a preparation method of the poplars. The invention also provides a method for improving fungal disease resistance of poplar. The method comprises the following steps: (1) constructing an overexpression vector of LRR receptor kinase PcTMK1; (2) transforming the constructed overexpression vector into poplar tissues or poplar cells; and (3) cultivating and screening to obtain the transgenic poplar with improved fungal disease resistance. According to the invention, an overexpression transgenic plant of the poplar PcTMK1 gene is constructed, and experiments find that the PcTMK1 gene can be applied to improving the disease resistance of the plant to the poplar brown-tray dispora and cultivating a new variety of the poplar brown-tray dispora resistant transgenic plant.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology, and particularly relates to application of LRR receptor kinase PcTMK1 in improving Populus resistance to fungal diseases. BACKGROUND

[0002] Current prevention and control means mainly rely on chemical fungicides (such as difenoconazole) and traditional disease-resistant breeding, but the former is easy to cause environmental residues and pathogen resistance, and the latter is limited by the lack of natural resistance gene resources of Italian poplar I-214 and a long hybrid breeding cycle of 8-10 years.

[0003] In recent years, plant genetic engineering provides a new idea for disease-resistant breeding. For example, the resistance of poplar can be partially improved by transforming chitinase gene (Chi2) or pathogenesis-related protein gene (PR1), but the effect is limited (only 20-30% reduction in lesion) and is accompanied by growth inhibition. Studies have shown that LRR receptor kinase plays a core role in plant innate immunity, such as AtBAK1 in Arabidopsis thaliana triggering disease resistance by activating the MAPK signaling pathway, but the functional analysis of similar genes in woody plants is still blank. There is no use of the gene to transform poplar in the prior art, and there is also a lack of design of an efficient and stable transformation system for poplar.

[0004] Therefore, it is urgent to provide a method for effectively improving the disease resistance of poplar to provide a sustainable molecular breeding scheme for the prevention and control of poplar fungal diseases. SUMMARY

[0005] In order to overcome the above technical problems, the present application provides the application of LRR receptor kinase PcTMK1 or its coding nucleic acid in improving the resistance of poplar to fungal diseases and a method for improving the resistance of poplar to fungal diseases, which provides a sustainable molecular breeding scheme for the prevention and control of poplar fungal diseases.

[0006] In a first aspect, the present application provides the application of LRR receptor kinase PcTMK1 or its coding nucleic acid in improving the resistance of poplar to fungal diseases, wherein the amino acid sequence of the protein encoded by the LRR receptor kinase PcTMK1 is as shown in SEQ ID NO. 1. In some embodiments, the nucleotide sequence of the LRR receptor kinase PcTMK1 is as shown in SEQ ID NO. 2.

[0007] In some embodiments, the poplar is Italian poplar, preferably Italian poplar I-214.

[0008] In some embodiments, the fungus includes Marssonina brunnea.

[0009] In some embodiments, the application includes the step of increasing the expression amount of LRR receptor kinase PcTMK1 in poplar.

[0010] In another aspect, the present application also provides a method for improving the resistance of poplar to fungal diseases, the method comprising the steps of,

[0011] (1) constructing an overexpression vector of LRR receptor kinase PcTMK1;

[0012] (2) transforming the constructed overexpression vector into poplar tissues or poplar cells;

[0013] (3) cultivating the transgenic poplar with improved resistance to fungal diseases.

[0014] In some embodiments, the LRR receptor kinase PcTMK1 encodes a protein with an amino acid sequence as shown in SEQ ID NO. 1.

[0015] In some embodiments, the LRR receptor kinase PcTMK1 has a nucleotide sequence as shown in SEQ ID NO. 2.

[0016] In some embodiments, the poplar is Italian poplar, preferably Italian poplar I-214.

[0017] In some embodiments, the fungus includes Marssonina brunnea.

[0018] Compared with the prior art, the present application finds that the infection of Marssonina brunnea induces the up-regulated expression of the PcTMK1 gene in Italian poplar I-214; at the same time, the overexpression transgenic plant of the poplar PcTMK1 gene is constructed, and it is found through experiments that the PcTMK1 gene can be applied to improve the disease resistance of plants to Marssonina brunnea and cultivate new varieties of transgenic plants resistant to Marssonina brunnea. The method provided by the present application can improve the disease resistance of plants, thereby reducing the use of chemical pesticides and reducing environmental pollution. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Gene expression pattern analysis of PcTMK1.

[0020] Figure 2 Construction of PcTMK1 overexpression Italian poplar lines; (A) PcTMK1 overexpression Italian poplar lines rooting in medium containing 10 mg / L Kan, (B) PCR identification of positive plants, (C) measurement of the relative expression level of PcTMK1 in different PcTMK1 overexpression Italian poplar lines.

[0021] Figure 3PcTMK1 positively regulates poplar resistance to P. ramorum infection; (A) The growth rate of PcTMK1 overexpression poplar I-214 and wild type plantlet in height and root length, (B) Representative images of PcTMK1 overexpression poplar I-214 and wild type plantlet 4 days after inoculation with P. ramorum, (C) The area of lesion and healthy region was calculated by ImageJ, the lesion area was expressed as the ratio of lesion area to healthy area, (D) The determination of P. ramorum relative biomass in poplar I-214 leaves.

[0022] Figure 4 SA and JA pathways are involved in PcTMK1-mediated poplar defense against P. ramorum. DETAILED DESCRIPTION

[0023] The following examples facilitate a better understanding of the present application, but do not limit the present application. In the following examples, the experimental methods are conventional methods unless otherwise specified. In the following examples, the experimental materials are commercially available from conventional biochemical reagent stores unless otherwise specified.

[0024] I-214 poplar differentiation medium: 2.41 g WPM medium powder, 25 g sucrose, 7.8 g agar, and then add plant hormones to make the final concentration of each hormone 0.2 mg / L 6-BA, 0.02 mg / L NAA, 0.002 mg / L TDZ, and then add deionized water to 1 L, adjust pH to 6.8, and autoclave at 121°C for 20 minutes.

[0025] I-214 poplar rooting medium: 2.41 g WPM medium powder, 30 g sucrose, 7.8 g agar, and then add deionized water to 1 L, adjust pH to 6.8, and autoclave at 121°C for 20 minutes.

[0026] Example 1 Analysis of PcTMK1 relative expression in poplar I-214 induced by P. ramorum infection

[0027] The wild type I-214 poplar leaves were inoculated by spore spraying, and the relative expression of genes was analyzed by qRT-PCR, and the specific steps were as follows.

[0028] 1) 3-4 weeks old I-214 poplar aseptic tissue culture seedlings were taken out from the culture bottle, and the root residual medium was washed completely under the flow of sterile water, and then the seedlings were transferred to a transparent culture box containing sterile water, and maintained in a constant temperature incubator at 25°C, and set 16 hours light and 8 hours dark cycle conditions, and then the seedlings were cultured in water for 2 days.

[0029] 2) At the time of inoculation, a sterile spray bottle was used to suspend the spore suspension (1*10 7) evenly spray the underside of the leaves, ensuring the atomized droplets completely cover the leaf surface. Immediately after spraying, cover the entire plant with a transparent plastic cover to create an airtight, moisturizing environment. Return the plant to the original incubator under the same culture conditions and remove the plastic cover after 3 days.

[0030] 3) Collect inoculated leaf samples from 0 to 8 days after inoculation. For each plant, collect the 3rd, 4th, and 5th leaves from the top and combine them together to form the inoculated leaf sample for that plant. All samples were quickly frozen in liquid nitrogen and stored at -80°C until use.

[0031] 4) The relative expression level of PcTMK1 was determined by qRT-PCR. Actin from Populus Italiana was used as a normalization reference gene. The specific qRT-PCR primer sequences are shown in Table 1.

[0032] Table 1 qRT-PCR primer sequences

[0033] Primer name Sequence (5'-3') PcTMK1 qRT-F GTGTGCAATTCCTTCTTCAGTAAC (SEQ ID NO. 3) PcTMK1 qRT-R GAAACTCTACTTAAAGCATCAG (SEQ ID NO. 4) PcActin-F GCCCTTCCACATGCCATCCT (SEQ ID NO. 5) PcActin-R TCCCGTTCAGCTGTGGTTGT (SEQ ID NO. 6)

[0034] Test results such as Figure 1 As shown in the figure, the relative expression of PcTMK1 gene in wild-type seedlings of Italian Populus I-214 after induction treatment with Trichoderma populi for 0, 1, 3, 5 and 7 days was detected by qRT-PCR technology, which proved that the infection of Trichoderma populi would induce a significant increase in the expression level of PcTMK1 in Italian Populus I-214.

[0035] Example 2 Obtaining a PcTMK1 overexpressing transgenic line

[0036] The amino acid sequence of the protein encoded by the LRR receptor kinase PcTMK1 in poplar is shown in SEQ ID NO.1, and the nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0037] 1. Use EcoRI restriction endonuclease to perform single enzyme digestion on the PRI101 vector at 37°C overnight. The enzyme digestion system is shown in Table 2.

[0038] Table 2 Enzyme digestion system

[0039] Component name Volume PRI101 vector 2 EcoRI 2.5 NEBuffer 2.1 10 Sterile deionized water 37.5

[0040] To perform homologous recombination with pRI101 vector, the gene sequence of PcTMK1 (SEQ ID NO. 1) was cloned using primers with 18 bp overlapping homology arms flanking the pRI101 enzyme cutting sites. The primers for ligating PcTMK1 to pRI101 were pRI101-PcTMK1-F: 5'-CCGTCGACCCCGGGGGTACCGGATCCATGAGAAAACACCACA AAAAGCTT-3' (SEQ ID NO. 7), pRI101-PcTMK1-R: 5'-TCCTCGCCCTTGCTCACCATGGATCCCCGCCCATCAGCAGAAGTGAAAG-3' (SEQ ID NO. 8), then the linearized plasmid was subjected to homologous recombination with the target gene fragment recovered accordingly, and the homologous recombination reaction was performed using the homologous recombination enzyme ClonExpress II One Step Cloning Kit (Vazyme), with the reaction conditions being 37°C water bath for 30 minutes, and the specific reaction system being shown in Table 3. The overexpression vector of the PcTMK1 gene was obtained after verification.

[0041] Table 3 Homologous recombination reaction system

[0042] Component name Volume Linearized plasmid 2 Insert fragment 1 CEII Buffer 4 Exnase II 2 Sterile deionized water 11

[0043] 2. Obtaining I-214 poplar PcTMK1 overexpression strain by Agrobacterium infection

[0044] 1) Agrobacterium activation and expansion

[0045] GV3101 Agrobacterium containing pRI101 ::PcTMK1 overexpression vector was streaked on LB solid medium containing the corresponding antibiotic and cultured at 28°C for 48 hours. A single colony was inoculated into LB liquid medium containing the same concentration of antibiotic, and cultured at 28°C with 200 rpm shaking until OD600 = 0.6 (about 18 hours). 1 mL of activated bacterial solution was transferred to 50 mL of fresh LB medium and cultured at 28°C with shaking for 6 hours until OD600 = 0.6. The bacterial cells were collected by centrifugation at 4°C and 5000 rpm for 5 minutes, resuspended with liquid differentiation medium to adjust OD600 = 0.3, and 150 μM acetyl-syringone was added for standby.

[0046] 2) Poplar leaf transformation

[0047] Young leaves of Italian poplar I-214 tissue culture seedlings were selected, prepared with 3 mm wound incisions, and then immersed in Agrobacterium suspension for 7 minutes. The surface bacteria were removed by washing with sterile water for 3 times, and then the leaves were placed on antibiotic-free differentiation medium after absorbing water with filter paper and incubated in the dark for 48 hours to induce callus.

[0048] 3) Resistance screening and regeneration

[0049] The leaves were transferred to differentiation medium containing 200 mg / L timentin for sterilization, and after 8 days, they were transferred to selection medium containing 30 mg / L Kan for continuous selection, and the medium was replaced every 8 days. When the shoots grew to 3 cm, they were cut and transferred to rooting medium containing 10 mg / L Kan, and positive plants were selected and verified for gene expression. The primer sequences used are shown in Table 1.

[0050] The results are shown in Table 2. Figure 2 As shown in Table 2, transgenic Populus nigra I-214 plants overexpressing PcTMK1 were successfully obtained, and the expression level of the PcTMK1 gene in the transgenic lines was 13.26 times that of the wild type. There was no significant difference in plant height and root length between the transgenic lines and the wild type.

[0051] Example 3 Analysis of the effect of overexpression of PcTMK1 on the resistance of Populus nigra I-214 to Diaporthe ambroisiana

[0052] Transgenic Populus nigra I-214 leaves were inoculated by spore spraying, and the preparation of the spore suspension, the inoculation method, and the collection of the disease samples were as described in Example 1. Diaporthe ambroisiana biomass determination was performed by qRT-PCR. Populus nigra Actin was used as the uniformization reference gene, and the relative expression level of the Diaporthe ambroisiana EF-1a internal reference gene was used as a representative of biomass accumulation. The primer sequences used were MbEF1a-F: 5'-GCCCAGGTCATCGTTCTCAACCAC-3' (SEQ ID NO. 9) and MbEF1a-R: 5'-ATCCAATCCTCGCACATCGTAACA-3' (SEQ ID NO. 10). The Diaporthe ambroisiana biomass of the inoculated wild type plants was used as a control.

[0053] The results are shown in Table 3. Figure 3 As shown in Table 3, the leaves of the Populus nigra I-214 PcTMK1 overexpression transgenic lines were inoculated with Diaporthe ambroisiana spore suspension for 4 days, and the differences in resistance to Diaporthe ambroisiana were compared, which proved that overexpression of PcTMK1 could significantly improve the resistance of transgenic Populus nigra I-214 plants to Diaporthe ambroisiana.

[0054] Example 4 Effect of overexpression of PcTMK1 on the expression of immune-related marker genes in Populus nigra I-214

[0055] The immune-related marker genes of Italian poplar I-214 include SA and JA defense signal pathway related genes: PcPR1, PcPR2, PcPAD4, PcPAL1, PcPAL2, PcWRKY73, PcCOI1, and PcWRKY40. Italian poplar Actin is used as an internal reference gene, and the expression amount of the target gene in a wild type plant is used as a control. The qRT-PCR primers are shown in Table 4.

[0056] Table 4 qRT-PCR primers of SA and JA defense signal pathway related genes

[0057]

[0058] The detection results are shown in Table 5. Figure 4 As shown in Table 5, overexpression of PcTMK1 can significantly increase the up-regulated expression of SA and JA defense signal pathway related genes in transgenic Italian poplar I-214. It can be seen that PcTMK1 overexpression strains significantly enhance the resistance of poplar to pathogenic bacteria, and PcTMK1 is involved in the regulation of the activation of SA and JA defense signal pathways.

[0059] In summary, the infection of Magnaporthe grisea can induce the up-regulated expression of PcTMK1 gene in Italian poplar I-214, and overexpression of PcTMK1 can significantly increase the immune resistance of transgenic Italian poplar I-214 to Magnaporthe grisea, and does not affect the growth rate of Italian poplar I-214. Therefore, the small peptide signal molecule PcTMK1 gene can be applied to improve the disease resistance of plants to Magnaporthe grisea and cultivate new varieties of transgenic plants resistant to Magnaporthe grisea. In addition, the improvement of plant disease resistance can reduce the use of chemical pesticides and reduce environmental pollution.

[0060] The specific embodiments of the present application are described in detail above, but only as an example, and the present application is not limited to the specific embodiments described above. Any equivalent modifications and alternatives to the present application made by those skilled in the art are also within the scope of the present application. Therefore, any equivalent transformation and modification made without departing from the spirit and scope of the present application should be covered within the scope of the present application.

Claims

1. Use of LRR receptor kinase PcTMK1 or its encoding nucleic acid in improving poplar resistance to fungal diseases, characterized in that: The amino acid sequence of the protein encoded by the LRR receptor kinase PcTMK1 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The nucleotide sequence of the LRR receptor kinase PcTMK1 is shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that The poplar is Italian poplar, preferably Italian poplar I-214.

4. The use according to claim 1, characterized in that The fungi include Marssonina brunnea.

5. The use according to any one of claims 1 to 4, characterized in that: The application comprises the step of increasing the expression level of LRR receptor kinase PcTMK1 in poplar.

6. A method for improving poplar resistance to fungal diseases, characterized in that: The method comprises the following steps, (1) Construct an overexpression vector for the LRR receptor kinase PcTMK1; (2) transforming the constructed overexpression vector into poplar tissue or poplar cells; (3) Cultivate and screen transgenic poplars with improved resistance to fungal diseases.

7. The method according to claim 6, characterized in that The amino acid sequence of the protein encoded by the LRR receptor kinase PcTMK1 is shown in SEQ ID NO.

1.

8. The method according to claim 6, characterized in that The nucleotide sequence of the LRR receptor kinase PcTMK1 is shown in SEQ ID NO.

2.

9. The method according to claim 6, characterized in that The poplar is Italian poplar, preferably Italian poplar I-214.

10. The method according to claim 6, characterized in that The fungi include Marssonina brunnea.