Application of brown planthopper Cathepsin B protein in prevention and treatment of brown planthopper

Abstract

The invention discloses an application of brown planthopper Cathepsin B protein in prevention and treatment of brown planthopper, and relates to the technical field of biological prevention and treatment of brown planthopper. By inhibiting the expression of the coding gene of the Cathepsin B protein in the brown planthopper, the growth and development of the brown planthopper can be obviously inhibited; the method has wide application prospect and great application value in the fields of pesticide use reduction, ecological balance maintenance, sustainable development and the like.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological control of brown planthopper, and particularly relates to application of brown planthopper Cathepsin B protein in resisting brown planthopper. BACKGROUND

[0002] Brown planthopper, belonging to Homoptera and Delphacidae, is one of the main pests on rice. Brown planthopper is a monophagous pest, and its piercing-sucking mouthpart can pierce into the plant body to suck phloem sap, resulting in reduction of panicle number and grain number. When rice is seriously damaged by brown planthopper, large areas of rice will die, and the phenomenon of "brown planthopper fire" will occur, so that there will be no harvest. Brown planthopper causes about 1 to 1.5 billion kilograms of rice yield reduction per year, which is equivalent to tens of billions of economic losses. At present, insecticides are generally used to control brown planthopper, but with the large-scale use of insecticides, brown planthopper has developed resistance. In addition, spraying pesticides is not only harmful to humans and animals, but also causes serious environmental pollution. Therefore, actively carrying out research and application of biological control technology of brown planthopper has important significance for scientifically and effectively controlling brown planthopper, and protecting food safety and environmental safety.

[0003] RNA interference (RNAi) refers to a phenomenon that double-stranded RNA induces efficient and specific degradation of homologous mRNA. Since its discovery, RNAi has rapidly developed and become an effective tool for gene function research, and is also widely used in insect gene research. The method of injecting in vitro synthesized dsRNA into specific parts of insects using a microinjector is called microinjection method, the injection amount of which can be accurately controlled, and the influence of specific gene expression reduction on insects can be specifically observed, so the microinjection method is one of the most commonly used introduction methods at present. It is of great significance to use genetic engineering technology to improve the resistance of rice to brown planthopper, and to breed and cultivate new rice varieties resistant to brown planthopper. SUMMARY

[0004] The present application first discovers that brown planthopper Cathepsin B protein plays an important role in inhibiting the growth of brown planthopper, and provides application of brown planthopper Cathepsin B protein in preventing and treating brown planthopper. Specifically, by inhibiting the expression of Cathepsin B gene in brown planthopper, the survival ability of brown planthopper can be effectively reduced. The application is realized through the following technologies.

[0005] In a first aspect, the present application provides application of brown planthopper Cathepsin B protein in resisting brown planthopper, by inhibiting the expression of the coding gene of brown planthopper Cathepsin B protein to inhibit the growth of the brown planthopper; the amino acid sequence of the Cathepsin B protein is shown as SEQ ID NO. 1.

[0006] Further, the coding gene sequence of the Cathepsin B protein is shown as SEQ ID NO. 3.

[0007] Further, the expression of the coding gene of the Cathepsin B protein is inhibited by using dsRNA; the amino acid sequence of the Cathepsin B protein is shown as SEQ ID NO. 1.

[0008] In the second aspect of the present application, an application of an inhibiting factor in inhibiting the growth of the brown planthopper is provided, wherein the inhibiting factor is dsRNA for inhibiting the expression of the coding gene of the Cathepsin B protein; the amino acid sequence of the Cathepsin B protein is shown as SEQ ID NO. 1.

[0009] Further, the nucleotide sequence of the dsRNA is shown as SEQ ID NO. 2.

[0010] In the third aspect of the present application, a method for inhibiting the growth of the brown planthopper is provided, wherein the growth of the brown planthopper is inhibited by inhibiting the expression of the coding gene of the Cathepsin B protein of the brown planthopper; the amino acid sequence of the Cathepsin B protein is shown as SEQ ID NO. 1.

[0011] Further, the expression of the coding gene of the Cathepsin B protein of the brown planthopper is inhibited by using dsRNA.

[0012] Further, the nucleotide sequence of the dsRNA is shown as SEQ ID NO. 2.

[0013] In the fourth aspect of the present application, a biological material for inhibiting the expression of the coding gene of the Cathepsin B protein of the brown planthopper is provided, wherein the biological material is dsRNA, or an expression cassette, a vector or an engineering cell for preparing the dsRNA.

[0014] Further, the nucleotide sequence of the dsRNA is shown as SEQ ID NO. 2.

[0015] Compared with the prior art, the present application has the advantages that the expression of the Cathepsin B protein of the brown planthopper is found for the first time, and has significant correlation with the growth and development of the brown planthopper. Through further tests, it is found that the expression of the gene Cathepsin B in the brown planthopper can significantly inhibit the growth and development of the brown planthopper. Specifically, by silencing the Cathepsin B gene of the brown planthopper, a lethal effect is caused on the brown planthopper, and the survival rate is lower and lower with the extension of time.

[0016] The above test results all show that the Cathepsin B gene of the brown planthopper has a very important role in inhibiting the growth and development of the brown planthopper, has a broad application prospect, and has a great application value in reducing the use of pesticides, maintaining ecological balance, and sustainable development. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 The cloning results of the gene Cathepsin B provided for Example 1 are shown in the figure. The first lane is Marker, and the second lane is Cathepsin B ORF.

[0018] Figure 2 The agarose gel electrophoresis diagram of dsCathepsin B and dsGFP provided for Example 2 is shown in the figure.

[0019] Figure 3 The relative expression amount analysis results of the Cathepsin B gene after microinjection provided for Example 3 are shown in the figure. CK is a blank group, i.e., the brown planthoppers without injection; dsGFP is the group of brown planthoppers injected with dsGFP; dsCB-24h and dsCB-48h are the groups of brown planthoppers injected with Cathepsin B 24 h and 48 h after injection.

[0020] Figure 4 The survival rate and weight gain analysis results of the brown planthoppers after microinjection provided for Example 4 are shown in the figure. Figure 4 A is the result of counting the survival rate of the brown planthoppers every day after microinjection, Figure 4 B is the weight gain result of the female insects in two days after the brown planthoppers are injected and then become adult insects. Figure 4 C is the result of the amount of honeydew excreted by the female insects in two days after the brown planthoppers are injected and then become adult insects. DETAILED DESCRIPTION

[0021] The technical solutions of the present application will be described clearly and completely below. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0022] Example 1: Cloning of the Cathepsin B gene of the brown planthopper

[0023] The cloning process of the Cathepsin B gene of the brown planthopper is as follows:

[0024] 1. Take 20 brown planthoppers of biotype 1 (the brown planthopper population without any resistance genes is biotype 1), extract total RNA, and reverse to cDNA.

[0025] 2. Primers were designed based on the above cDNA sequence and TaKaRa 5' and 3' RACE kits were used to obtain the 5' and 3' end sequences of the candidate gene, determine the transcription start and end sites of the candidate gene, and splice the full-length cDNA sequence of the gene.

[0026] 3. Based on the full-length cDNA sequence, primers Cathepsin BF and Cathepsin BR were resynthesized to amplify the full-length cDNA of Cathepsin B. Figure 1 shown.

[0027] Primer Cathepsin BF: 5′-atgggtcttcgtctctttgc-3′, as shown in SEQ ID NO.4.

[0028] Primer Cathepsin BR: 5′-atgtttagtgacttttggaa-3′, as shown in SEQ ID NO.5.

[0029] Figure 1 In the figure, the first lane is a marker, and the second lane is Cathepsin B ORF; ORF was sequenced, and the amino acid sequence is shown in SEQ ID NO.1.

[0030] The gene sequence encoding Cathepsin B protein is shown in SEQ ID NO.3.

[0031] Example 2: Preparation of dsRNA (dsCathepsin B) for silencing the brown planthopper Cathepsin B gene, and dsRNA (dsGFP) for the green fluorescent protein GFP gene as a control

[0032] 1. Using the cDNA obtained in Example 1 as a template, PCR amplification was performed using the following primers: dsCathepsin BF and dsCathepsin BR to obtain a PCR amplification product.

[0033] Forward primer dsCathepsin BF: 5′-taatacgactcactatagggagaatgggtcttcgtctctttgc-3′, as shown in SEQ ID NO.6.

[0034] Reverse primer dsCathepsin BR: 5′-taatacgactcactatagggagaatgtttagtgacttttggaa-3′, shown in SEQ ID NO. 7.

[0035] wherein the region of the sequence "taatacgactcactatagggaga" is a T7 RNA polymerase promoter sequence.

[0036] 2. PCR amplification was performed using the following primers, dsGFP-F and dsGFP-R, with the pCXUN plasmid containing GFP as a template to obtain the PCR amplification product.

[0037] Forward primer dsGFP-F: 5'-taatacgactcactatagggcggact-3', as SEQ ID NO. 8.

[0038] Reverse primer dsGFP-R: 5'-taatacgactcactatagggcgatgc-3', as SEQ ID NO. 9.

[0039] wherein the region of the sequence "taatacgactcactataggg" is a T7 RNA polymerase promoter sequence.

[0040] 3. The two amplification products of step 1 and step 2 were recovered, added with A, and ligated to the pMD18-T (TAKARA) vector. The positive clones were sequenced, and the correct cloned plasmid was screened.

[0041] The cloned plasmid was used as a template, and the above-mentioned primers dsCathepsin B-F and dsCathepsin B-R, and dsGFP-F and dsGFP-R were used for amplification, respectively. The amplification products were purified, concentrated, and made to have a concentration of 1 μg / μL. The product was a template for dsRNA synthesis.

[0042] 4. The reagent system of Table 1 below was added into a 200 μL centrifuge tube in proportion; mixed by flicking and centrifuged momentarily. Amplification was performed in a PCR instrument. The amplification procedure was 37 °C, 4 h; 75 °C, 5 min; 16 °C storage. After 1 μL was aspirated and gel electrophoresis detection, the target band was detected, and the next step was continued.

[0043] Table 1

[0044]

[0045] 5. The reagents shown in Table 2 below were added to the above centrifuge tube to remove DNA and ssRNA.

[0046] Table 2

[0047]

[0048] Mix well, centrifuge, put into PCR instrument at 37℃ for 30 min. Take out the PCR product, add EDTA (Fementas company) 1 μL, continue to put back into the PCR instrument at 65℃ for 5 min to terminate the reaction. Absorb 1 μL, dilute 10 times, take 2 μL for gel electrophoresis detection, and take 2 μL for NANOdrop ultraviolet spectrophotometer detection.

[0049] If the detection band is a very single bright band, as shown in Figure 2 OD 260 / 280 between 1.8-2.0, it indicates that the dsRNA quality is good, and the next step can be carried out. The nucleotide sequence of the dsRNA (dsCathepsin B) for silencing the Cathepsin B gene of the brown planthopper is shown in SEQ ID NO. 2.

[0050] 6. Perform conventional phenol chloroform extraction, remove protein, and according to the concentration, adjust the dsRNA to 5 μg / μL, 10 μL per tube, and store at -80℃.

[0051] Example 3: Microinjection of dsCathepsin B and dsGFP and effect detection

[0052] The microinjection and effect detection method is as follows.

[0053] 1. Brown planthopper preparation: take 30 female insects and 10 male insects in a cup with TN1 (Taichung 1) seedlings, 24 h later, take out the adult insects. After hatching, 20 d later, the fourth instar nymphs are used for injection.

[0054] 2. Plate preparation: weigh 1.5 g of agar powder into 100 ml of water, boil, pour into a glass plate, and use after solidification.

[0055] 3. Injection: take 5-8 insects with similar growth potential in a test tube, and anesthetize for 20 s by passing CO2. Then pour the insects on a 1.5% agar powder plate with the abdomen upwards. Use Nanoliter 2010 microinjection instrument to perform injection according to the instruction manual. The injection position is between the prothorax and the mesothorax. The injection amount is 46 nL (5 μg / μL).

[0056] 4. After the brown planthopper is injected with dsRNA, sampling is started from the first day after injection, three insects are sampled every day, and sampling is performed for ten days; at the same time, brown planthoppers without injection and injected with dsGFP are taken as controls.

[0057] 5. Verify the change in gene expression by qRT-PCR. The specific operation is as follows: after sampling, RNA is extracted, and reverse transcription is performed according to the instructions of TAKARA PrimeScript RT reagent Kit with gDNA Eraser (item number RR047A) to obtain reverse transcription products (cDNA). Take 5 μL of the cDNA obtained by reverse transcription, dilute 10 times with TE, and perform real-time quantitative PCR according to the following operation. The primers for the internal reference gene actin and the quantitative primers for Cathepsin B used in the quantitative PCR are also shown as follows. The internal reference gene actin primers are used to standardize the gene expression amount to eliminate the difference in RNA amount between samples, and the quantitative primers for the target gene Cathepsin B are used to detect the expression level of the Cathepsin B gene.

[0058] PCR reactions are performed on a CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad) instrument, following the reaction system shown in Table 3.

[0059] Table 3

[0060]

[0061] Reaction conditions: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 5-10 s, TM (55-65℃) annealing and extension for 30 s, repeating the two steps for 40 cycles; finally, 65℃-95℃, increasing by 0.5℃ for each step, 5 s for melting curve to determine the specificity of the amplification product. Each sample is repeated for 3 technical repeats, and each plate PCR is amplified for efficiency.

[0062] The results are analyzed by quantitative PCR data analysis software. First, analyze the melting curve, QC (quality control), etc., remove unqualified data, and analyze the gene expression using the Gene Study function of the software (1+E) -ΔΔCt algorithm.

[0063] Internal reference gene actin primers:

[0064] Actin-F: 5'-gacaggatgcagaaggaaatca-3', as shown in SEQ ID NO. 10.

[0065] Actin-R: 5'-gactcgtcgtactcctgctttg-3', as shown in SEQ ID NO. 11.

[0066] Cathepsin B quantitative primers:

[0067] Cathepsin B-1F: 5′-ggaaggctggaaggaacttc-3′, as shown in SEQ ID NO.12.

[0068] Cathepsin B-1R: 5′-ggccaatgctctcgagtc-3′, as shown in SEQ ID NO.13.

[0069] The results are as attached Figure 3 As shown in the figure, the relative expression of the Cathepsin B gene in the dsCathepsin B microinjection group was significantly reduced 24 and 48 hours after injection, compared with the uninjected brown planthoppers and the dsGFP-injected control group. This indicates that microinjection of dsCathepsin B can induce an RNAi effect on the salivary gland secretory gene Cathepsin B in brown planthoppers, resulting in a significant decrease in gene expression.

[0070] Example 4: Phenotypic detection of brown planthopper after microinjection

[0071] 1. Brown planthopper survival rate test

[0072] Brown planthoppers (short-winged female brown planthoppers) were divided into three groups: uninjected, dsGFP-injected, and dsCathepsin B-injected. After injection, the brown planthoppers were allowed to recover and then placed back on the rice paddies. Ten insects were used each time, and this was repeated five times.

[0073] The test results are as follows Figure 4 As shown in A, it can be seen that after injection of dsCathepsin B, the survival rate of brown planthoppers has been significantly lower than that of brown planthoppers injected with dsGFP and without injection since the third day of injection.

[0074] 2. Brown planthopper weight gain test

[0075] After injection, the three groups of brown planthoppers were placed back onto the rice plants and allowed to emerge. Each brown planthopper that emerged on the first day was weighed individually and placed in a wax bag tied to the rice seedlings. Two days later, the surviving brown planthoppers were removed and weighed again. The difference between the two weights was recorded as the insect weight gain. Ten insects were used each time, and this was repeated five times.

[0076] The weight gain of newly emerged brown planthoppers within 48 hours was analyzed. Figure 4 As shown in Figure B, we can see that after injection of dsCathepsin B, insect weight gain decreased. This indicates that after injection of dsCathepsin B, due to the reduced expression of this gene, the feeding of brown planthoppers was affected, thereby affecting the survival rate of brown planthoppers.

[0077] 3, Honeydew of the brown planthopper in the test of the embodiment

[0078] Honeydew is the excretion of the brown planthopper during feeding, and can be used to measure how much the brown planthopper feeds. The color and area of honeydew on the filter paper can reflect the feeding activity of the brown planthopper. The honeydew of the brown planthopper in the two groups of different treatments of injecting dsGFP and dsCathepsin B was treated, and it was found that the amount of honeydew excreted by the brown planthopper after injecting dsCathepsin B was reduced, reaching a highly significant difference, as shown in Fig. C. It is thus illustrated that after the Cathepsin B gene is silenced, the feeding amount of the brown planthopper is significantly reduced. Figure 4

[0079] The above specific embodiments describe the implementation of the present application in detail, but the present application is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concepts of the present application, various simple modifications and changes can be made to the technical solutions of the present application, and these simple modifications all belong to the protection scope of the present application.​

Claims

1. An application of brown planthopper Cathepsin B protein in combating brown planthopper, characterized in that: The growth of brown planthopper is inhibited by inhibiting the expression of the gene encoding the Cathepsin B protein of the brown planthopper; the amino acid sequence of the Cathepsin B protein is shown in SEQ ID NO.

1.

2. The use of the brown planthopper Cathepsin B protein in combating brown planthoppers according to claim 1, characterized in that: The gene sequence encoding the Cathepsin B protein is shown in SEQ ID NO.

3.

3. The use of the brown planthopper Cathepsin B protein in combating brown planthoppers according to claim 2, characterized in that: The expression of the gene encoding Cathepsin B protein is inhibited by using dsRNA.

4. An application of an inhibitory factor in inhibiting the growth of brown planthopper, characterized in that: The inhibitor is a dsRNA that inhibits the expression of the gene encoding Cathepsin B protein; the amino acid sequence of the Cathepsin B protein is shown in SEQ ID NO.

1.

5. Use of the inhibitory factor according to claim 4 in inhibiting the growth of brown planthopper, characterized in that: The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

2.

6. A method for inhibiting the growth of brown planthopper, characterized in that: The growth of brown planthopper is inhibited by inhibiting the expression of the gene encoding the Cathepsin B protein of brown planthopper; the amino acid sequence of the Cathepsin B protein is shown in SEQ ID NO.

1.

7. The method for inhibiting the growth of brown planthopper according to claim 6, characterized in that: dsRNA was used to inhibit the expression of the gene encoding Cathepsin B protein of the brown planthopper.

8. The method for inhibiting the growth of brown planthopper according to claim 7, characterized in that: The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

2.

9. A biological material for inhibiting the expression of a gene encoding Cathepsin B protein of brown planthopper, characterized in that: The biological material is dsRNA, or an expression box, vector or engineered cell for preparing dsRNA.

10. The biological material for inhibiting the expression of the gene encoding the brown planthopper Cathepsin B protein according to claim 9, characterized in that: The nucleotide sequence of the dsRNA is shown in SEQ ID NO.2.

Images