Specific sgRNA for targeted knockout of CIITA gene, low-immunogenicity iPSC cell based on CIITA gene knockout and preparation method and application of low-immunogenicity iPSC cell

Abstract

The invention discloses a specific sgRNA for targeted knockout of a CIITA gene, a low-immunogenicity iPSC cell based on CIITA gene knockout as well as a preparation method and application of the low-immunogenicity iPSC cell. Specific sgRNA for targeted knockout of the CIITA gene is combined with an exon region 2 and an exon region 3 of the CIITA gene, a required sgRNA sequence is designed based on a PAM sequence, namely, 20 basic groups in front of NGG, and the sgNRA sequence is selected from at least one of SEQ ID NO: 1-SEQ ID NO: 10. According to the invention, the RNP-mediated gene editing technology is utilized to directly introduce Cas9 protein and sgRNA into cells, so that the editing efficiency is improved, the off-target effect is remarkably reduced, the potential toxicity to the cells is reduced, and the sgRNA (SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 7) capable of efficiently knocking out the CIITA gene is obtained through screening.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering and cell biology technology, in particular to a specific sgRNA for targeted knockout of CIITA gene, low immunogenic iPSC cells based on CIITA gene knockout and a preparation method and application thereof. BACKGROUND

[0002] Cell therapy is an innovative medical approach that uses in vitro cultured normal cells or induced differentiated stem cells to produce a large number of healthy functional cells to repair tissues and organs. Stem cells, with their unique self-renewal and multi-directional differentiation capabilities, have become the focus of regenerative medicine, and they have the potential to transform into cells of various tissues and organs in the human body. Induced pluripotent stem cells (iPSCs) are a type of stem cell obtained by reprogramming mature somatic cells with specific factors, which have similar multi-directional differentiation potential and continuous self-renewal characteristics to embryonic stem cells. The preparation method of iPSCs is relatively simple and stable, and avoids the use of embryonic cells or egg cells, which not only has an advantage in ethics, but also expands the source of stem cells, making more patients have the opportunity to use this technology to obtain the required stem cells. Currently, iPSC cell therapy has shown great potential and growing application value in the treatment of macular degeneration, heart failure, Parkinson's disease, and spinal cord injury, among other diseases.

[0003] Despite the many advances in the field of iPSC research, the problem of immune rejection has not yet been well solved. Autologous cell therapy can avoid the problem of immune rejection, but it has the problems of high cost and long preparation period, and the treatment effect may be affected by individual differences. Allogeneic cell therapy can reduce the immunogenicity of allogeneic cells through immunosuppressive drugs, HLA matching, and gene editing. However, long-term use of immunosuppressive drugs has side effects. The establishment and maintenance of an HLA-matched iPSC bank is costly and can provide matching for specific populations, but it cannot cover most people.

[0004] The major histocompatibility complex (MHC) of humans, also known as human leukocyte antigen (HLA), is the main cause of immune rejection. The HLA system is composed of multiple genes, divided into class I, class II, and class III genes. Class I MHC genes are expressed on the surface of almost all cells in the body, and if the transplanted cells express different class I MHC molecules from the host, CD8 + T cells will be activated, leading to the elimination of these cells. Class II MHC genes are mainly expressed on antigen-presenting cells, and when CD4 +T cells recognize non-self MHC class II molecules, which can trigger immune rejection. Although class III genes are not directly involved in immune recognition, they play a role in inflammatory responses. In recent years, through gene editing techniques such as knocking out key genes such as B2M and CIITA, the expression of MHC-I and MHC-II on the cell surface or the expression of their genes has been successfully reduced, which helps cells to escape specific recognition by T cells and B cells, thereby enhancing the immune tolerance or immune escape ability of the cells. The CRISPR / Cas9 system is a revolutionary gene editing technology, in which the design and selection of sgRNA (small guide RNA) is a key step to achieve precise gene editing. It is responsible for guiding the Cas9 enzyme to accurately recognize and cut the target DNA sequence. The screening of sgRNA is crucial for improving the accuracy and efficiency of gene editing. There are many similar sequences in the genome, and improper sgRNA design can cause the Cas9 enzyme to mistakenly cut non-target genes, causing non-specific gene editing. By screening sgRNAs with high specificity, off-target effects can be reduced. In addition, different sgRNAs have different guiding efficiencies for the Cas9 enzyme, and some sgRNAs may not be able to effectively guide the Cas9 enzyme to the target site, or have low cutting efficiency. Screening of high-efficiency sgRNAs can improve the success rate of gene editing. Similarly, different cell types may respond differently to sgRNAs. Systematic sgRNA screening helps to identify and avoid these potential problems. SUMMARY

[0005] In view of the defects in the prior art, the purpose of the present application is to provide a CIITA gene knockout-based low immunogenic iPSC cell and a preparation method and application thereof.

[0006] In the first aspect of the present application, a specific sgRNA for targeting knockout of the CIITA gene is provided, which binds to exon region 2 and exon region 3 of the CIITA gene. The required sgRNA sequence is designed based on the PAM sequence, i.e. 20 bases before NGG. The gene sequence of the sgRNA is selected from at least one of the following sequences: SEQ ID NO: 1: CAGCTCACAGTGTGCCACCA; SEQ ID NO: 2: ATGGAGTTGGGGCCCCTAGA; SEQ ID NO: 3: GCCCCTAGAAGGTGGCTACC; SEQ ID NO: 4: CTTCTATGACCAGATGGACC; SEQ ID NO: 5: AGGCTGTTGTGTGACATGGA; SEQ ID NO: 6: AGGTGATGAAGAGACCAGGG; SEQ ID NO: 7: TAGGGGCCCCAACTCCATGG; SEQ ID NO: 8: CATAGAAGTGGTAGAGGCAC; SEQ ID NO: 9: GGTCCATCTGGTCATAGAAG; SEQ ID NO: 10: CTTCTCCAGCCAGGTCCATC.

[0007] Further preferably, the gene sequence of the sgRNA is selected from at least one of the following sequences: SEQ ID NO: 1: CAGCTCACAGTGTGCCACCA; SEQ ID NO: 3: GCCCCTAGAAGGTGGCTACC; SEQ ID NO: 5: AGGCTGTTGTGTGACATGGA; SEQ ID NO: 7: TAGGGGCCCCAACTCCATGG.

[0008] Further preferably, the gene sequence of the sgRNA is SEQ ID NO: 1: CAGCTCACAGTGTGCCACCA.

[0009] In a second aspect, the present application provides a method for constructing a low immunogenic iPSC cell based on CIITA gene knockout, comprising the following steps: S1, designing sgRNA sequences, wherein the sgRNA sequences comprise at least one of the specific sgRNAs for targeting CIITA gene knockout described above, and the sgRNA sequences are referred to as B2M-sgRNA; S2, preparing an RNP complex, wherein the RNP complex is composed of a Cas9 protein and the CIITA-sgRNA described in step S1; S3, directly introducing the RNP complex in step S2 into an iPSC cell, so as to knockout the CIITA gene, thereby obtaining a low immunogenic iPSC cell based on CIITA gene knockout.

[0010] Further preferably, in step S3, the introduction is performed by electroporation.

[0011] Further preferably, the electroporation parameters are as follows: iPSC cells 1×10 4 -3×10 4, Cas9 protein 30-50 pmol, CIITA-sgRNA 50-100 pmol.

[0012] In a third aspect, the present application provides a low immunogenic iPSC cell based on CIITA gene knockout, which is prepared according to the above-mentioned method for preparing a low immunogenic iPSC cell based on CIITA gene knockout.

[0013] In a fourth aspect, the present application provides the above-mentioned low immunogenic iPSC cell based on CIITA gene knockout for use in the preparation of a product for inhibiting immune rejection.

[0014] Compared with the prior art, the present application has the following beneficial effects: The specific sgRNA for targeting knockout of the CIITA gene provided by the present application is combined with exon region 2 and exon region 3 of the CIITA gene, and the required sgRNA sequence is designed based on the PAM sequence, i.e., 20 bases in front of NGG. The specific sgRNA for targeting knockout of the CIITA gene provided by the present application can efficiently knockout the CIITA gene, thereby efficiently preparing a low immunogenic iPSC cell. BRIEF DESCRIPTION OF DRAWINGS

[0015] Other features, objects and advantages of the present application will become more apparent from the following detailed description of non-limiting embodiments, made with reference to the following drawings: Figure 1 A plasmid structure containing CIITA-sgRNA and Cas9 protein provided by an embodiment of the present application; Figure 2 A fluorescence result schematic diagram of plasmid transfection of Hek 293A cells containing CIITA-sgRNA and Cas9 protein provided by an embodiment of the present application; Figure 3 A schematic diagram of off-target prediction results of CIITA-sgRNA (SEQ ID NO. 1) provided by an embodiment of the present application; Figure 4 A schematic diagram of knockout efficiency results of CIITA-sgRNA (SEQ ID NO. 1) on hiPSC cells provided by an embodiment of the present application; Figure 5 CIITA KO A schematic diagram of the morphology of a hiPSC monoclonal cell (KO: KnockOut, meaning knockout); Figure 6 CIITA KOFigure 1 shows the results of base editing of hiPSC cell monoclonal CL44-9 (KO: Knock-Out); Figure 7 CIITA provided in the first experimental example of the present application KO Figure 2 shows the results of AP staining of hiPSC cells (KO: Knock-Out); Figure 8 CIITA provided in the second experimental example of the present application KO Figure 3 shows the results of RT-PCR of pluripotent gene expression of hiPSC cells (KO: Knock-Out); Figure 9 CIITA provided in the third experimental example of the present application KO Figure 4 shows the results of immunofluorescence of pluripotent protein expression of hiPSC cells (KO: Knock-Out). DETAILED DESCRIPTION

[0016] The following examples will help those skilled in the art to further understand the present application, but do not limit the present application in any form. It should be noted that those skilled in the art can make several changes and improvements without departing from the concept of the present application. These are within the scope of protection of the present application.

[0017] In addition, the technical features involved in the different embodiments of the present application described below can be combined with each other as long as they do not conflict with each other.

[0018] The following examples and experimental examples use conventional instruments and equipment in the art. Unless otherwise specified, the experimental methods are usually performed under conventional conditions, or under the conditions recommended by the manufacturer. The various raw materials used, unless otherwise specified, are conventional commercially available products, and their specifications are conventional in the art. The sequencing services involved in the present application are completed by Beijing Genewiz Co., Ltd.

[0019] The present application will be described in detail below with reference to specific embodiments.

[0020] EMBODIMENT The present embodiment provides a low immunogenic iPSC cell based on CIITA gene knockout and a preparation method thereof. The iPSC cell type in the present embodiment is preferably a hiPSC cell, and the Cas9 protein type is preferably a SpCas9 protein. The specific operation steps of the preparation method are as follows: I. Design of sgRNA (the sgRNA designed in this step is called CIITA-sgRNA) (1) Find target gene information and select editing region. Obtain gene information on NCBI. Input "species" - Homo, "gene name" - CIITA on the Gene interface of NCBI homepage, click Genebank, download sequence, and select exon regions 2 and 3.

[0021] (2) Find PAM sequence, i.e., 20 bases in front of NGG, which is the required sgRNA sequence (3) Design 10 CIITA-sgRNAs and select a CIITA-sgRNA sequence (SEQ ID NO: 11) reported in a literature (Feng L, Chao J, Ye P, Luong Q, Sun G, Liu W, Cui Q, Flores S, Jackson N, Shayento ANH, Sun G, Liu Z, Hu W, Shi Y. Developing Hypoimmunogenic Human iPSC-Derived Oligodendrocyte Progenitor Cells as an Off-The-Shelf Cell Therapy for Myelin Disorders. Adv Sci (Weinh). 2023 Aug;10(23):e2206910.) as a control group.

[0022] (4) Design CIITA-sgRNA results as follows: SEQ ID NO. 1: CAGCTCACAGTGTGCCACCA; SEQ ID NO. 2: ATGGAGTTGGGGCCCCTAGA; SEQ ID NO. 3: GCCCCTAGAAGGTGGCTACC; SEQ ID NO. 4: CTTCTATGACCAGATGGACC; SEQ ID NO. 5: AGGCTGTTGTGTGACATGGA; SEQ ID NO. 6: AGGTGATGAAGAGACCAGGG; SEQ ID NO. 7: TAGGGGCCCCAACTCCATGG; SEQ ID NO. 8: CATAGAAGTGGTAGAGGCAC; SEQ ID NO. 9: GGTCCATCTGGTCATAGAAG; SEQ ID NO. 10: CTTCTCCAGCCAGGTCCATC; SEQ ID NO. 11 (control): GATATTGGCATAAGCCTCCC.

[0023] II. Synthesis of CIITA-sgRNA in step one, then CIITA-sgRNA is connected with Cas9 protein plasmid vector (with mCherry marker) (plasmid vector is purchased from Fenghui Biology) The operation steps are as follows: (1) Synthesis of CIITA-sgRNA: The primers are synthesized by solid-phase phosphoramidite triester method. The synthesized primers are purified by PAGE, specifically: the synthesized primers are denatured at 95°C, then the primer samples are loaded into a polyacrylamide gel containing 7M urea, and denatured polyacrylamide gel electrophoresis (PAGE) is performed at 600V for 2 hours; after electrophoresis, the target primer band is cut from the gel, and the purified primer is recovered by elution. CIITA-sgRNAs annealing, operation as follows: a) Instant primer, configure 100uM stock solution with DEPC water.

[0024] b) Configure working solution (10uM): take 10ul stock solution and 90ul DEPC water.

[0025] c) Reaction system (20ul), see Table 1.

[0026] Table 1. CIITA-sgRNAs annealing reaction system d) 95°C water bath for 5min, turn off the switch, and let the water bath cool naturally. When connecting, take 2ul from 20ul for connection.

[0027] (2) Cas9 protein plasmid transformation a) Take a tube of 100ul DH5a competent cells and the required plasmid to thaw on ice.

[0028] b) Take 0.5ul of the desired plasmid into 30ul of competent cell suspension (completed in a clean bench), and ice bath for 30min.

[0029] c) After heating at 42°C water bath for 90s, quickly ice bath for 3min.

[0030] d) Add 500ul of 37°C preheated LB medium (without antibiotics) in a clean bench, then fix to a shaker at 37°C 250rmp for 1h.

[0031] e) Divide the transformed bacterial solution into 4 tubes containing 15 ml Amp+LB medium (100 μg / ml ampicillin) in 50 ml centrifuge tubes and incubate overnight at 37°C.

[0032] f) After the completion of the overnight incubation, observe the turbidity of the bacterial solution and proceed with the midiprep.

[0033] (3) Midiprep of Cas9 protein (use plasmid midiprep kit (OMEGA endotoxin free plasmid midiprep) to extract plasmid) a) Transfer 30 ml of the overnight culture into a 50 ml centrifuge tube.

[0034] b) Centrifuge at 4000 x g for 10 min at room temperature.

[0035] c) Remove the supernatant. (The liquid on the tube wall is removed with a clean paper towel.) d) Add 2.5 mL Solution I / RNase A and vortex or pipette up and down to resuspend the cells completely. Shake vigorously, but do not have lumps. (Note: RNase A must be added to Solution I before use) e) Add 2.5 ml Solution II, invert and gently swirl the tube 10 times to obtain a clear lysate. Incubate at room temperature for 3 min with occasional mixing. (Note: Avoid vigorous mixing, as this will shear chromosomal DNA and decrease plasmid purity. Do not allow the lysis reaction to proceed for more than 5 min. Keep Solution II tightly capped when not in use to avoid acidification by atmospheric CO2) f) Add 1.25 ml of pre-chilled N3 Buffer, and gently invert the centrifuge tube several times until a white, fluffy precipitate forms. Incubate at room temperature for 2 min. (The solution must be mixed thoroughly. If the mixture is still thick and brown, in the form of a ball, continue mixing until the solution is completely neutralized. Complete neutralization of the solution is critical for obtaining high yields) g) Prepare a filter syringe by pulling the plunger out of the syringe, and place the syringe upright on a suitable tube rack. Place a centrifuge tube under the outlet end of the syringe, with the opening of the syringe facing upward. Immediately pour the lysate into the filter syringe. Allow the cell lysate to remain in the syringe for 2 min. At this time, the white, fluffy precipitate will float on the surface of the lysate. The cell lysate may have run out of the filter syringe. Collect the lysate in a new 15 mL tube. Carefully insert the plunger of the syringe into the syringe, and slowly push the plunger to allow the lysate to flow into the centrifuge tube. (Alternatively: Instead of filtering the precipitate with a filter syringe, centrifuge the precipitate at 4°C, 15000 x g for 10 min to remove the precipitate.) h) Add 0.1 volume of ETR Solution to the filtered lysate and invert the tube 10 times to mix. Incubate on ice for 10 minutes. (Note: The lysate may appear turbid after the addition of ETR Solution, but will clear upon ice incubation) i) Incubate the lysate at 42°C for 5 minutes. The lysate will again appear turbid. Centrifuge at 4,000 x g for 5 minutes at 25°C. The ETR Solution will form a blue band at the bottom of the tube.

[0036] j) Transfer the supernatant to a new 15 mL tube. Add 0.5 volume of absolute ethanol and invert the tube 6 times to mix. Incubate at room temperature for 1 minute.

[0037] k) Place the HiBind® DNA Midi Binding Column into a 15 mL collection tube. Transfer 3.5 mL of the mixture from step j) to the HiBind® DNA Midi Binding Column. Centrifuge at 4,000 x g for 3 minutes at room temperature. Discard the flow-through.

[0038] l) Repeat step j) until all of the mixture from step k) is bound to the HiBind® DNA Midi Binding Column.

[0039] m) Place the HiBind® DNA Midi Binding Column into the same collection tube. Add 3 mL of HBC Buffer to the HiBind® DNA Midi Binding Column. Centrifuge at 4,000 x g for 3 minutes at room temperature. Discard the flow-through. (Note: The HBC Buffer must be diluted with isopropanol as described in the instructions prior to use) n) Place the HiBind® DNA Midi Binding Column into the same collection tube. Add 3.5 mL of DNA Wash Buffer (diluted with absolute ethanol) to the HiBind® DNA Midi Binding Column. Centrifuge at 4,000 x g for 3 minutes at room temperature. Discard the flow-through. (Note: The concentrated DNA Wash Buffer must be diluted with ethanol as described in the instructions prior to use. If the DNA Wash Buffer is stored in the refrigerator prior to use, remove it from the refrigerator and allow it to come to room temperature) o) Repeat step n) by placing the HiBind® DNA Midi Binding Column into the same collection tube. Add 3.5 mL of DNA Wash Buffer (diluted with absolute ethanol) to the HiBind® DNA Midi Binding Column. Centrifuge at 4,000 x g for 3 minutes at room temperature. Discard the flow-through.

[0040] p) Fit the HiBind® DNA Midi Binding Column into the same collection tube, spin down empty at 4000 x g for 10 min at room temperature to dry the binding column matrix. Further dry the binding column: air dry the alcohol for 5 min at room temperature.

[0041] q) Fit the HiBind® DNA Midi Binding Column into a clean 15 mL centrifuge tube, add 0.5 ml RNase-free sterile H2O onto the binding column matrix (the amount added depends on the expected final product concentration), and let stand for 3 min at room temperature.

[0042] r) Spin down at 4000 x g for 5 min to elute the DNA.

[0043] s) The eluted liquid is added to the column again for a second column pass, and step r) is repeated once.

[0044] t) After the elution is complete, the DNA concentration is determined. The DNA product is stored at -20 °C. (Note: Steps r) - t) are performed aseptically to prevent contamination) (4) Plasmid enzyme digestion after mid-volume plasmid extraction a) Set up the reaction system (20 ul / system) for cutting 2 reactions, 2 tubes, see Table 2.

[0045] Table 2. Plasmid enzyme digestion reaction system for mid-volume extraction b) After mixing, centrifuge at 12000 rpm for 5 min.

[0046] c) 37 °C water bath for 3 h.

[0047] (5) Electrophoresis to identify the Cas9 protein plasmid and verify whether the position of the Cas9 protein plasmid enzyme digestion in step (4) is correct a) Configure the nucleic acid gel (1% agarose gel 50 ml).

[0048] b) Weigh 0.5 g of agarose and add 1 x TAE 50 ml c) Microwave heating at high heat for 2 min, add nucleic acid dye, 5 ul (nucleic acid dye: agarose gel is 1:10000).

[0049] d) Place the comb, pour the agarose gel into the gel preparation tank, avoiding air bubbles.

[0050] e) After the agarose gel solidifies, place it at room temperature for 20 min, carefully remove the comb, and keep the sample application hole intact.

[0051] f) Place the gel and inner tank into the electrophoresis tank, add 1 x TAE electrophoresis liquid to cover the gel by 2 mm g) Loading: Load the product from step (4) into the wells, the loading order is as follows: marker: 5ul, uncut 12ul, cut sample 20ul (loading interval one well); 110v; 30min.

[0052] h) When the DNA fragments are completely separated, transfer the gel to the UV light and cut the desired DNA fragments as quickly as possible. (When cutting the gel, pay attention to cut off the excess gel, and the DNA should not be exposed to the UV light for more than 30s) i) Put it in a 1.5ml EP tube and store it at 4°C. The next day, do gel recovery.

[0053] (6) Gel recovery a) Use 1% agarose gel electrophoresis to separate the DNA fragments, any type or grade of agarose can be used. We strongly recommend that you use fresh TAE Buffer as the electrophoresis buffer. Do not reuse the electrophoresis buffer, as it will reduce the yield due to the increase in pH. Fresh TBE Buffer can also be used, but only a lower yield can be obtained.

[0054] b) When the desired DNA fragments are completely separated, transfer the gel to the UV light and cut the desired DNA fragments as quickly as possible.

[0055] c) Transfer the gel piece containing the desired fragment to a 1.5mL centrifuge tube (the centrifuge tube has been weighed). Weigh the gel piece to obtain its weight. Approximately determine its volume. Assuming its density is 1g / mL (the density of almost all DNA gels can be approximated as 1g / mL), then the volume of the gel piece can be obtained as follows: the weight of the gel piece is 0.2g, then its volume is 0.2mL. Add an equal volume of XP2 Binding Buffer, warm it in a 50-60°C water bath for 7min or until the gel is completely melted, mix the mixture every 2-3min.

[0056] d) Take a HiBind® DNA Mini Binding Column and place it in a 2mL collection tube (the collection tube needs to be prepared in advance).

[0057] e) Transfer the DNA / melted gel solution obtained in step 3 to the HiBind® DNA Mini Binding Column. Centrifuge at room temperature at 10,000 x g for 1min. Discard the filtrate in the collection tube, and place the column back in the 2mL collection tube.

[0058] f) If the volume of the DNA / gel melt exceeds 700 μl, only 700 μl can be transferred to the HiBind® DNA Mini Binding Column at a time, and the remainder can be repeated through Step 5 until all of the solution has passed through the HiBind® DNA Mini Binding Column. Each HiBind® DNA Mini Binding Column has a limit of 25 μg of DNA binding capacity. If a large yield is expected, the sample can be divided among an appropriate number of HiBind® DNA Mini Binding Columns.

[0059] g) Discard the filtrate in the collection tube and place the HiBind® DNA Mini Binding Column back into the collection tube. Transfer 300 μl of XP2 Binding Buffer to the column, centrifuge at maximum speed (13,000 x g) for 1 min at room temperature, and discard the filtrate. h) Place the HiBind® DNA Mini Binding Column back into the collection tube. Transfer 700 μl of SPW Buffer (diluted with absolute ethanol) to the HiBind® DNA Mini Binding Column. Centrifuge at 10,000 x g for 1 min at room temperature, and discard the filtrate. i) Repeat Step h) and place the HiBind® DNA Mini Binding Column back into the collection tube. Transfer 700 μl of SPW Buffer (diluted with absolute ethanol) to the HiBind® DNA Mini Binding Column. Centrifuge at 10,000 x g for 1 min at room temperature, and discard the filtrate.

[0060] j) Place the HiBind® DNA Mini Binding Column back into the collection tube. Centrifuge at 13,000 x g for 2 min at room temperature to spin off any residual liquid from the HiBind® DNA Mini Binding Column matrix.

[0061] k) Place the HiBind® DNA Mini Binding Column in a clean 1.5 mL centrifuge tube. Add 30 μl (depending on the expected final product concentration) of H2O (pre-warm the H2O to 50-60 °C) to the matrix of the HiBind® DNA Mini Binding Column, and incubate at room temperature for 5 min. Centrifuge at 13,000 x g for 1 min to elute the DNA. The first elution can elute 80% of the bound DNA. The recovered liquid can be transferred to the column for a second pass. If a second elution is performed, the residual DNA can be eluted, but at a lower concentration.

[0062] (7) CIITA-sgRNA and Cas9 protein plasmid vector connection a) Connection system construction (operation on ice), see Table 3.

[0063] Table 3. sgRNA and Cas9 protein plasmid vector connection reaction system b) After mixing, control the temperature of the PCR instrument, 16°C connection overnight to form a plasmid vector, and the plasmid map is shown in Figure 1 , the plasmid structure contains different sgRNA sequences, Cas9 protein sequences, mCherry fluorescent protein sequences, puromycin resistance sequences, and ampicillin resistance sequences. Different sgRNA sequences: used to guide the specific recognition and cutting of Cas9 protein to target DNA sequences. Cas9 protein sequence: encodes Cas9 nuclease for gene editing. mCherry fluorescent protein sequence: used to label and screen successfully transfected cells. Puromycin resistance sequence: used to screen cells expressing mCherry fluorescent protein. Ampicillin resistance sequence: used to screen colonies containing the plasmid in E. coli.

[0064] Three, transfect Hek 293A cells with CIITA-sgRNA and Cas 9 protein containing plasmids in step two (1) Inoculate cells Inoculate cells one day before transfection, with an initial inoculation density of 6 x 10 5 per well of 293A cells in a 6-well plate, and transfect when the confluence reaches 80%.

[0065] (2) Prepare DNA-PEI nucleic acid-transfection reagent complex a) For each well of cells, dilute 1 μg of target DNA in 100 μL of serum-free medium (Opti-MEM with a volume-to-mass ratio of 100:1) to form a DNA dilution solution. Serum-free diluent is recommended to use Opti-MEM b) Immediately add 3 μL of PEI 40000 transfection reagent (transfection reagent volume to plasmid mass ratio of 3:1) to 100 μL of DNA dilution solution and mix gently.

[0066] c) Incubate at room temperature for 15 min to form a DNA-PEI cationic nucleic acid transfection reagent complex.

[0067] (3) Transfect cells No need to change the liquid, no need to blow evenly, directly add DNA-PEI nucleic acid-PE1 complex drop by drop into the cells, shake the culture plate, mix gently, 37°C, 5% CO2 incubator, change the liquid after 6 hours, observe the fluorescence after 48 hours. The transfection effect of cells was observed by fluorescence microscope, as shown in Figure 2 The cells after 48 hours of transfection showed obvious red fluorescence, indicating that the plasmid containing CIITA-sgRNA and Cas9 protein had successfully entered the cells and expressed the corresponding fluorescent protein. This result confirmed that under the experimental conditions, the transfection method could effectively introduce the plasmid containing CIITA-sgRNA and Cas9 protein into the cells and realize gene expression.

[0068] Four, screening out mCherry positive Hek 293A cells in step three by flow sorting technology After 48 hours of transfection, 10,000 positive cells were sorted, and then DNA was extracted for sequencing analysis of gene editing efficiency.

[0069] Flow sorting operation: After cell digestion and centrifugation, resuspend with 200ul sterile PSB, pass 200ul cell suspension through a 40um cell screen into a 1.5ml EP tube or flow tube, mix gently and then machine, the receiving liquid is 500ul fresh culture medium.

[0070] Five, PCR and Sanger sequencing to detect the knockout efficiency of different CIITA-sgRNAs in Hek 293A cells in step four (1) Extract DNA from positive expression cells a) According to the required sample quantity, configure appropriate amount of 1x lysis buffer, and prepare the lysis buffer according to the ratio of Proteinase K:1x Mouse tissue Lysis Buffer 1:50.

[0071] b) Take 20ul 1x lysis buffer and add it to the cells, vortex and shake, then incubate in a 55°C water bath for 20min.

[0072] c) After incubation, place the sample in a 95°C or boiling water bath for 5min to inactivate Proteinase K.

[0073] d) After vortexing the lysis product thoroughly, centrifuge at 12000rpm for 5min, and take the supernatant for PCR reaction. The supernatant can also be transferred to another sterile EP tube and stored at -20°C for at least 3 months.

[0074] (2) PCR a) After the 2x Taq Plus Master Mix (Dye Plus) was completely thawed, it was mixed well upside down. The following reaction system was prepared on ice, see Table 4.

[0075] Table 4. PCR premix reaction system b) The recommended PCR reaction condition settings are shown in Table 5.

[0076] Table 5. PCR reaction conditions c) The amplified product was directly subjected to agarose gel electrophoresis detection without adding DNA Loading Buffer.

[0077] d) The electrophoretic target band was subjected to Sanger detection to knock out efficiency, and Synthego was used for analysis. The knockout efficiency of different sequences in Hek293A cells was obtained, and CIITA-sgRNA sequences with high editing efficiency were screened. The CIITA-sgRNA of different sequences had different knockout efficiencies for the CIITA gene, and the detailed results are shown in Table 6. When the sequence of sgRNA was SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7, the average value of the two knockout efficiencies was higher, and the average value of the two knockout efficiencies of SEQ ID NO: 1 was the highest. Therefore, SEQ ID NO: 1 was preferred for subsequent experimental research in this embodiment.

[0078] The sgRNA of SEQ ID NO: 1 was subjected to off-target analysis, as shown in Table 7. Figure 3 Among the top 10 off-target sites of CIITA-sgRNA (SEQ ID NO: 1), the easy off-target site was 3 or 4 mismatch off-target, and there was no exon off-target site. It was proved that the CIITA-sgRNA (SEQ ID NO: 1) provided in this embodiment not only had high editing efficiency, but also had low off-target risk (no exon off-target site).

[0079] Table 6. Knockout efficiency of different CIITA-sgRNAs in Hek293A cells Six, prepare CIITA-sgRNA (SEQ ID NO: 1) and SpCas9 protein into RNP complex, and then electrotransfer the RNP complex to the hiPSC cells to obtain CIITA gene knockout based low immunogenic iPSC cells, and verify the knockout efficiency of CIITA-sgRNA (SEQ ID NO: 1) in the hiPSC cells. In this embodiment, the iPSC cells are 2x10 4 -3x10 4 , Cas9 protein 30-50pmol, CIITA-sgRNA 50-100pmol, preferably hiPSC cells 2x10 4 , SpCas9 protein 40mol, CIITA-sgRNA 70pmol, and then follow the subsequent preparation process.

[0080] (1) CIITA-sgRNA (SEQ ID NO: 1) and SpCas9 protein are prepared into an RNP complex, and the RNP complex is electrotransferred to the hiPSC cells, and the steps are as follows: First, mix the SpCas9 protein (40pmol), CIITA-sgRNA (70pmol), and P3 buffer (2.94 μl, P3 buffer purchased from Lonza P3 primary cell transfection kit) uniformly, incubate at 37°C for 10 min, and obtain the RNP complex.

[0081] The hiPSC cells are digested, counted, and the electrotransferred sample is prepared, and the operation is as follows: a) Take the cells (1 well in a 6-well plate) out of the CO2 cell incubator, observe the cell confluence under a microscope, and record it; b) When the cell confluence observed under the microscope is 80%, first use a pipette to discard the supernatant, then wash once with 3ml of DPBS, and discard; c) Add 0.7ml of accutase digestion solution (STEMCELL Technologies), then incubate in a 37°C, 5% CO2 cell incubator for 10 min; d) Add 2.3ml of complete medium containing Y27632 (working concentration 10μM), gently blow the cells into single cells with a gun head, and then transfer them all to a 15ml centrifuge tube. Take 20ul of the cell suspension for counting; e) According to the counting result, take the required amount of cells (2x10 4 hiPSC cells) into a new 1.5ml centrifuge tube, centrifuge at 200g at room temperature for 5 min; f) After centrifugation, try to suck the supernatant as much as possible, add 15 μl of prepared P3 buffer, mix well, then add into the transfection component (transfection component is RNP complex), gently blow and mix with the gun head, and then add into the corresponding electroporation cup to avoid air bubbles; (2) The electroporation steps are as follows: a) Place the electroporation cup containing the sample in (1) f into the corresponding position of the Nucleofector X Unit electroporator, select the CA-137 electroporation program, then click "Start", and after the end, transfer the electroporation cup to the biological safety cabinet, add 80 μl of warm electroporation special medium (see Table 7, add DNase I, 20 U / time in advance when the electroporation material contains plasmid) into each electroporation cup, mix gently, and then place in a 37℃, 5% CO2 cell incubator for 10 min; Table 7. Electroporation special medium b) Take out the 24-well plate coated with LN521 from the incubator, suck off the liquid, add 400 μl of warm electroporation special medium, and then transfer the cell suspension after incubation into the well plate, cross mix, and then place the cells back into a 37℃, 5% CO2 cell incubator for culture, to obtain CIITA gene knockout-based low immunogenicity iPSC cells (CIITA KO hiPSC cells).

[0082] c) After 2 days of culture, extract the cell genomic DNA, and detect the knockout efficiency of CIITA-sgRNA (SEQ ID NO: 1) in the hiPSC cells by Sanger sequencing, and the knockout efficiency result is shown in Figure 4 , and the knockout efficiency is 86.6%. It is shown that using RNP-mediated gene editing technology, directly introducing Cas9 protein and sgRNA into cells in the form of RNP complex can not only obtain high editing efficiency, but also significantly reduce off-target effects and reduce potential toxicity to cells.

[0083] (3) Pick the above CIITA KO hiPSC cells for monoclonal construction a) Plate 1000 CIITA KO hiPSC cells in one well of a 6-well plate, and culture in TeSR-E8 complete medium containing 1x CloneR, and replace with fresh medium after 4 days b) After 10 days of culture, monoclonal picking can be performed (operation under a microscope): prepare a 96-well plate containing 1x CloneR TeSR-E8 complete culture medium in advance.

[0084] c) After culturing the selected cells for 8 days, DNA can be extracted and amplified by PCR. The samples can be sent for sequencing to detect whether they are monoclonal. Figure 5 The cells formed independent cell clusters with irregular round shapes and clear edges. Their morphological characteristics were consistent with the typical characteristics of monoclonal cells. KO -hiPSC cells, take the 9th CIITA KO - hiPSC cells) were subjected to base mutation analysis, and the results were as follows Figure 6 As shown, clone CL44-9 is a base-2 mutation, and the efficiency of base-2 mutation is 100%, indicating that the selected CIITA KO hiPSC cells have exactly the same genotype, which eliminates mixed clones, confirms that the clone is a single clone, and achieves double knockout of the CIITA allele (double knockout means that both alleles corresponding to a chromosome are knocked out).

[0085] Base-2 mutation: The deletion of two additional bases at a specific target site in the DNA sequence causes a frameshift mutation in the base sequence after that position.

[0086] Application Examples In this application example, the low immunogenic iPSC cells (CIITA) based on the knockout of CIITA gene provided in the embodiment KO -hiPSC cells), can be used to prepare products that suppress immune rejection reactions.

[0087] Experimental example Through the following experiments, the CIITA provided in the embodiment KO -The functionality of hiPSC cells was verified.

[0088] First experimental example AP staining (alkaline phosphatase staining) detection of CIITA provided in the example KO - Pluripotency of hiPSCs (1) WT-hiPSC cells and CIITA provided in the examples were used to KO After hiPSC cells were cultured to a confluence of 60%, the culture medium was discarded and the cells were washed twice with PBS for 5 seconds each time; (2) Fix the cells with 4% neutral formaldehyde fixative at room temperature for 15 minutes; (3) After fixation, rinse with PBS buffer three times, 5 minutes each time; (4) Use AP staining reagent for staining. The staining results are as follows Figure 7 Shown: WT-hiPSC cells and CIITA KO-hiPSC cells are all blue-violet, which indicates that there is high AP enzyme activity in the cells. AP activity is an important marker of pluripotent stem cells, and the results show that the pluripotency homeostasis of hiPSCs can be effectively maintained during gene editing by the preparation method provided by the application, and the CIITA KO -hiPSC cells can express high levels of alkaline phosphatase and have pluripotency.

[0089] WT-hiPSC cells: refer to hiPSC cells without gene editing; CIITA KO -hiPSC cells: refer to cells in which the CIITA gene of hiPSC cells is knocked out.

[0090] Second experimental example RT-PCR (reverse transcription polymerase chain reaction) detection of CIITA KO -hiPSC cell pluripotency gene expression (1) The TRIzol method was used to extract WT-hiPSC cells and CIITA KO -hiPSC cells total RNA; (2) The extracted RNA was reverse transcribed into cDNA; (3) PCR amplification was performed, and SOX2, OCT4, NANOG, LIN28A primers and ACTB were used as internal references.

[0091] (4) The PCR products were analyzed by agarose gel electrophoresis, and WT-hiPSC cells and CIITA KO The RT-PCR results of the pluripotency genes of the hiPSC cells are shown in the figure, and the SOX2, OCT4, NANOG and LIN28A pluripotency genes in the WT-hiPSC cells and CIITA KO There are clear bands in the hiPSC cell lines, and compared with the ACTB band, their expression is normal. The results show that the preparation method provided by the application can effectively maintain the stability of the transcription level of hiPSC cells during gene editing, and the experiment proves that the CIITA KO -hiPSC cell lines can express pluripotency markers SOX2, OCT4, NANOG and LIN28A at the transcription level, and have pluripotency.

[0092] WT-hiPSC cells: refer to hiPSC cells without gene editing; CIITA KO -hiPSC cells: refer to cells in which the CIITA gene of hiPSC cells is knocked out.

[0093] Third experimental example immunofluorescence detection of CIITA provided in the embodiment KO -Pluripotency protein expression of hiPSC cells (1) First, CIITA provided in the embodiment KO -hiPSC cells were cultured to a confluence of 60%, the culture medium was discarded, and the cells were washed twice with PBS; (2) Cell fixation was performed using 4% neutral formaldehyde fixing solution, and fixed at room temperature for 15 minutes; (3) After fixation, PBS buffer was used for rinsing 3 times, each time for 5 minutes; (4) Permeabilization was performed using Triton™ X-100, and permeabilized at room temperature for 15 minutes; (5) Blocking was performed using 5% goat serum, and blocked at room temperature for 30 minutes; (6) Incubation of primary antibodies specific for pluripotency markers, namely anti-SOX2, anti-OCT4 and anti-NANOG antibodies, was performed respectively, and incubated overnight at 4°C; (7) Incubation of secondary antibodies with fluorescent labels was performed, followed by nuclear staining using DAPI; (8) Finally, the slides were mounted using anti-fade mounting medium, and observed and photographed under a fluorescence microscope. CIITA KO The immunofluorescence results of pluripotency proteins of hiPSC cells are shown in Figure 9 The fluorescent signals of SOX2, OCT4 and NANOG proteins can be clearly observed in the cells. These fluorescent signals are mainly concentrated in the nuclear region, and highly coincide with the position of DAPI-stained nuclei, indicating that these pluripotency proteins have a high expression level in the nucleus. This further confirms that CIITA KO -hiPSC cells have good pluripotency, indicating that CIITA KO -hiPSC cells also maintain pluripotency at the protein expression level.

[0094] This experiment proves that CIITA KO -hiPSC cells can express pluripotency markers SOX2, OCT4 and NANOG at the protein level, and have pluripotency.

[0095] The specific embodiments of the present application are described above. It should be understood that the present application is not limited to the above specific embodiments, and those skilled in the art can make various changes or modifications within the scope of the claims, which do not affect the essential content of the present application. In the case of no conflict, the embodiments of the present application and the features in the embodiments can be arbitrarily combined.

Claims

1. A specific sgRNA for targeted knockout of the CIITA gene, characterized in that: The sgRNA binds to exon 2 and exon 3 of the CIITA gene. The desired sgRNA sequence is designed based on the PAM sequence, i.e., the 20 bases preceding NGG. The gene sequence of the sgRNA is selected from at least one of the following sequences: SEQ ID NO: 1: CAGCTCACAGTGTGCCACCA; SEQ ID NO: 2:ATGGAGTGTGGGGCCCCTAGA; SEQ ID NO: 3: GCCCCTAGAAGGTGGCTACC; SEQ ID NO: 4: CTTCTATGACCAGATGGACC; SEQ ID NO: 5: AGGCTGTTGTGTGACATGGA; SEQ ID NO: 6: AGGTGATGAAGAGACCAGGG; SEQ ID NOv7: TAGGGGCCCCAACTCCATGG; SEQ ID NO: 8: CATAGAAGTGGTAGAGGCAC; SEQ ID NO: 9: GGTCCATCTGGTCATAGAAG; SEQ ID NO: 10: CTTCTCCAGCCAGGTCCATC.

2. The specific sgRNA for targeted knockout of the CIITA gene according to claim 1, characterized in that The gene sequence of the sgRNA is selected from at least one of the following sequences: SEQ ID NO: 1: CAGCTCACAGTGTGCCACCA; SEQ ID NO: 3: GCCCCTAGAAGGTGGCTACC; SEQ ID NO: 5: AGGCTGTTGTGTGACATGGA; SEQ ID NO: 7: TAGGGGCCCCAACTCCATGG.

3. The specific sgRNA for targeted knockout of the CIITA gene according to claim 2, characterized in that The gene sequence of the sgRNA is SEQ ID NO: 1: CAGCTCACAGTGTGCCACCA.

4. A method for constructing low-immunogenic iPSC cells based on CIITA gene knockout, characterized in that: The following steps are involved: S1. Design an sgRNA sequence, wherein the sgRNA sequence includes the specific sgRNA for targeted knockout of the CIITA gene according to any one of claims 1 to 3, and the sgRNA sequence is referred to as CIITA-sgRNA; S2. Prepare an RNP complex, wherein the RNP complex consists of Cas9 protein and the CIITA-sgRNA described in step S1; S3. Directly introduce the RNP complex in step S2 into iPSC cells to knock out the CIITA gene, thereby obtaining low immunogenic iPSC cells based on CIITA gene knockout.

5. The method for preparing low-immunogenic iPSC cells based on CIITA gene knockout according to claim 4, characterized in that: In step S3, electrotransfection is performed using an electroporator.

6. The method for preparing low-immunogenic iPSC cells based on CIITA gene knockout according to claim 5, characterized in that: The electroporation parameters are as follows: iPSC cells 1×10 4 -3×10 4 , Cas9 protein 30-50 pmol, CIITA-sgRNA 50-100 pmol.

7. A low immunogenic iPSC cell based on CIITA gene knockout, characterized in that: The low-immunogenicity iPSC cells are prepared according to the method for preparing low-immunogenicity iPSC cells based on CIITA gene knockout according to any one of claims 4 to 6.

8. Use of the low immunogenic iPSC cells based on CIITA gene knockout according to claim 7 in the preparation of products for suppressing immune rejection reactions.

Images