Application of cotton GhLUX07 gene in plant verticillium wilt resistance

Abstract

The invention discloses an application of a cotton GhLUX07 gene in verticillium wilt resistance of plants. The nucleotide sequence of the GhLUX07 gene is as shown in SEQ ID NO. 1 or SEQ ID NO. 2, and the amino acid sequence of the GhLUX07 gene is as shown in SEQ ID NO. 3 or SEQ ID NO. 4. After the GhLUX07 gene is silenced in cotton, the verticillium wilt resistance of cotton is reduced, after overexpression in cotton and arabidopsis thaliana, the verticillium wilt resistance of plants is improved, and meanwhile, the fiber quality and yield of overexpressed cotton are also improved, which indicates that the GhLUX07 gene positively regulates and controls the V.dahliae infection process and improves the fiber yield and quality of cotton, so that the GhLUX07 gene has a good application prospect. The GhLUX07 gene can be used for improving the disease resistance of cotton and the quality and yield of cotton fibers, and has a wide application prospect in improvement of cotton molecular breeding crops.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of cotton genetic resistance breeding, and particularly relates to application of a cotton GhLUX07 gene in plant resistance to Verticillium wilt. BACKGROUND

[0002] Cotton (Gossypium spp.) is a plant of the Malvaceae family, the Gossypieae tribe, and the Gossypium genus, and is not only a natural fiber source, but also an important oil crop. Cotton is widely planted in the Yellow River Basin, the Yangtze River Basin, the Liaohe River Basin, South China and the inland areas of Northwest China, and is one of the important economic crops. In recent decades, with the improvement of cotton planting technology and the enhancement of management level in China, the quality and yield of cotton have been continuously increased, and cotton production has made important contributions to the development of national economy and the improvement of people's living standards.

[0003] The main means of cotton breeding include traditional breeding and molecular breeding. Traditional breeding mainly relies on the technical means of hybridization, but has the disadvantage of long breeding cycle. For example, most scholars believe that Verticillium wilt resistance is a quantitative genetic trait, so it is very difficult to obtain a pure and stable offspring. With the rapid development of the cotton industry in recent years, traditional breeding has been unable to meet the needs of industrial production. Molecular breeding has the advantages of short cycle and directional selection, and has become the most widely used breeding method. With the gradual resolution of the cotton genome, combined with modern molecular marker-assisted selection and transgenic technology, cotton breeding is developing steadily.

[0004] In recent years, with the increase of planting costs, the occurrence of extreme weather, environmental degradation and the influence of pests and diseases, the cotton industry is facing severe challenges, and many factors are restricting the development of the cotton industry. In production, shortening the growth period of cotton, breeding early-maturing and concentrated-boll-maturing cotton varieties can effectively improve land utilization; in addition, breeding salt-tolerant and drought-tolerant stress-resistant varieties and high-pest-resistant and disease-resistant germplasm can greatly improve cotton productivity; of course, optimizing fiber quality, a key agronomic trait, is still an important focus of cotton production. However, it is still a great challenge to integrate multiple excellent traits in production and breed "all-in-one" cotton varieties, which suggests that we should take multiple agronomic traits as the evaluation standard of cotton varieties, and also puts forward new requirements for the current cotton breeding work. SUMMARY

[0005] Therefore, one of the purposes of the present application is to provide application of a cotton GhLUX07 gene in plant resistance to Verticillium wilt, wherein the nucleotide sequence of the GhLUX07 gene is shown in SEQ ID NO. 1 or SEQ ID NO. 2, or the amino acid sequence is shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0006] Further, the plant is cotton or Arabidopsis.

[0007] The second object of the present application provides application of the chimeric gene or expression cassette containing the GhLUX07 gene in plant resistance to Verticillium wilt, wherein the nucleotide sequence of the GhLUX07 gene is shown in SEQ ID NO. 1 or SEQ ID NO. 2.

[0008] The third object of the present application provides a method for improving the Verticillium wilt resistance of plants, comprising: connecting the nucleotide sequence of the above-mentioned GhLUX07 gene into a plant expression vector to obtain a recombinant plant expression vector, transforming the recombinant plant expression vector into plants by Agrobacterium tumefaciens transformation method to obtain transgenic plants, and the transgenic plants have stronger Verticillium wilt resistance compared with plants without transgenic.

[0009] The fourth object of the present application provides a method for breeding a plant variety with Verticillium wilt resistance, comprising: constructing a GhLUX07 gene overexpression recombinant plant expression vector; transforming the GhLUX07 gene overexpression plant expression vector into plants to overexpress the GhLUX07 gene in the plants, obtaining transgenic positive plants and screening to obtain a plant variety with improved Verticillium wilt resistance.

[0010] The fifth object of the present application provides application of the above-mentioned cotton GhLUX07 gene in inhibiting the adsorption of L. rostrate spores to plant roots.

[0011] The sixth object of the present application provides application of the above-mentioned cotton GhLUX07 gene in improving the fiber quality and yield of cotton.

[0012] Further, the fiber quality of cotton includes the length, strength and uniformity of the fiber.

[0013] The GhLUX07 gene in the present application reduces the Verticillium wilt resistance of cotton after being silenced in cotton, and the Verticillium wilt resistance of plants is improved after overexpression in cotton and Arabidopsis, and the fiber quality and yield of cotton are also improved after overexpression. It is shown that the GhLUX07 gene positively regulates the V. dahliae infection process and improves the fiber yield and quality of cotton, therefore, the GhLUX07 gene can be applied to improve the disease resistance of crops and the fiber quality and yield of cotton, and has a broad application prospect in crop improvement of cotton molecular breeding. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 To silence GhLUX07 in Gossypium hirsutum 'TM-1' to reduce the resistance of cotton to V. dahliae;

[0015] Figure 2The silencing of GhLUX07 in the upland cotton 'ZZM2' of the application reduces the resistance of cotton to V. dahliae;

[0016] Figure 3 The creation and identification of the GhLUX-OE material of the upland cotton of the application;

[0017] Figure 4 The influence of GhLUX-OE on circadian rhythm and homologous gene expression of the application;

[0018] Figure 5 The enhanced resistance of the cotton GhLUX-OE plant to P. lageruginea of the application;

[0019] Figure 6 The resistance analysis of BM-1 and GhLUX-OE2 plants in the artificial disease nursery of the Verticillium wilt of the application;

[0020] Figure 7 The inhibition of the cotton GhLUX-OE plant to the adsorption of P. lageruginea spores to roots of the application;

[0021] Figure 8 The enhanced resistance of the Arabidopsis GhLUX-OE plant to P. lageruginea of the application;

[0022] Figure 9 The fiber quality of the GhLUX-OE material of the application is higher than that of BM-1. DETAILED DESCRIPTION

[0023] The application will be described in detail below with reference to the embodiments, which are only illustrative and do not limit the scope of the application. The application is not limited to the following embodiments or examples, and any modification and transformation made without departing from the spirit of the application shall be included in the scope of the application. The experimental materials or reagents used in the following examples are commercially available or are preserved in the laboratory of the inventors' research group unless otherwise specified.

[0024] Plant materials:

[0025] Upland cotton (G. hirsutum) Baimian No. 1 (BM-1);

[0026] Upland cotton (G. hirsutum) Texas Marker-1 (TM-1);

[0027] Upland cotton (G. hirsutum) Jimian 11;

[0028] Upland cotton (G. hirsutum) Zhongzhi Cotton No. 2 (ZZM2);

[0029] Arabidopsis (A. thaliana) wild type Col-0;

[0030] Arabidopsis LUX gene mutant lux-4 (Professor Xu Xiaodong's research group of Henan University);

[0031] Strains:

[0032] E. coli DH5a;

[0033] Agrobacterium tumefaciens GV3101;

[0034] V. dahliae V991;

[0035] V. dahliae V991-GFP (donated by Anyang Cotton Research Institute of Chinese Academy of Agricultural Sciences);

[0036] Vectors:

[0037] Virus-mediated gene silencing (VIGS) system vectors are pTRV1, pTRV2 and pTRV2:CLA;

[0038] The vector used for constructing Arabidopsis overexpression plants is pCAMBIA1300;

[0039] The vector used for constructing cotton overexpression plants is WMV066 (Unmirabio Technology Co., Ltd.);

[0040] 1.1 Method

[0041] 1.1.1 Virus-mediated gene silencing (VIGS) experiment

[0042] The CDS sequences of GhLUXA07 and GhLUXD07 genes (SEQ ID NO. 1 and SEQ ID NO. 2) were aligned using DNAMAN software, and a region with high homology (1bp-400bp) was selected as the target fragment (SEQ ID NO. 5) to achieve the purpose of simultaneously targeting and silencing GhLUXA07 and GhLUXD07 (collectively referred to as GhLUX07) genes. The cDNA of Gossypium hirsutum "TM-1" was used as a template, and the primer pair GhLUX07-VIGS-F and GhLUX-VIGS-R was used to amplify the target fragment. The primer sequences are as follows:

[0043] GhLUX07-VIGS-F (5'-3'):

[0044] GTGAGTAAGGTTACCGAATTCATGGGTCAAGAAGTGAAGATGAGTG

[0045] GhLUX-VIGS-R (5'-3'):

[0046] CGTGAGCTCGGTACCGGATCCTCGGGTCAGATCCGGAGC

[0047] Meanwhile, pTRV2 vector was linearized by restriction enzymes EcoRI and BmaHI, and then the targeting fragment was cloned into pTRV2 vector to obtain TRV:GhLUX07 recombinant vector and transform into Agrobacterium GV3101 strain. TRV:GhLUX07, TRV:GhCLA (positive control which can cause albino phenotype), TRV:00 (empty pTRV2 vector, negative control) and pTRV1 Agrobacterium were inoculated into LB liquid medium respectively, and cultured at 28°C with 220 rpm shaking until OD 600 When the value reached 0.7-0.8, the bacteria were collected, resuspended with VIGS infection solution (10 mM MES, 10 mM MgCl2, 200 μM ethylene), and cultured at 25°C with 150 rpm shaking in dark for 2-3 h for standby. TRV:Target, TRV:GhCLA and TRV:00 infection solutions were mixed with pTRV1 infection solution in equal volume, and injected into cotyledons of cotton seedlings (cultured at 23°C, 75% humidity, 12L / 12D photoperiod for about 10 days until cotyledon flattened). After injection, the cotton seedlings were cultured in dark for 24 h. After the positive control plant TRV:GhCLA in VIGS system showed albino phenotype, the roots of TRV:GhLUX07 and TRV:00 plants were taken, and RNA was extracted and reverse transcribed into cDNA. The specific primers for detecting GhLUXA07 and GhLUXD07 (GhLUX07-RT-F: 5'-GGGATGCATCAAGGATTGTA-3'; GhLUX07-RT-R: 5'-TCATTGGGAACCATATCTATTC-3') and the reference gene GhUBQ7 primers (GhUBQ-RT-F: 5'-GAAGGCATTCCACCTGACCAAC-3'; GhUBQ-RT-R: 5'-CTTGACCTTCTTCTTCTTGTGCTTG-3') were used to detect the transcription level of GhLUX07 in the roots of TRV:GhLUX07 and TRV:00 plants by qRT-PCR, to detect the interference efficiency. The decrease of the expression level of the target gene proved that the VIGS experiment was successful, and thus "knockdown" plants (TRV:GhLUX07) were obtained. The plants were further cultured to two-leaf-one-core stage for subsequent inoculation experiment.

[0048] 1.1.2 V. dahliae V991 infection of cotton

[0049] V. dahliae strains were inoculated in PDB liquid medium, and after about 5 days of culture, the culture solution was filtered with four layers of gauze to collect the conidial suspension, which was diluted to 1 x 10 7 conidia / mL with sterile water for use. Then, the roots of cotton were infected by the root dipping method. Cotton seedlings at the two-leaf-one-core stage were carefully removed from the soil, immersed in the prepared conidial suspension for 2 minutes, excess liquid was absorbed with absorbent paper, and then replanted in new nutrient soil. After 14-16 days of infection, subsequent expression analysis, disease index analysis, stem sectioning, and recovery culture were performed.

[0050] 1.1.3 Disease index analysis, stem sectioning, and recovery culture

[0051] The disease incidence of V. dahliae V991 infection in cotton was measured by fungal recovery culture in cotton stem segments, browning area after stem infection, and disease index of cotton plants. The aboveground part of the cotton stem at 2 cm (≥30 plants) was taken for fungal recovery culture test. The stem segments were sterilized with 0.1% HgCl2 for 5 min, washed with sterile water for 5-6 times, and placed in order on PDA plates (containing 50 μg / mL of cefotaxime) in a 25°C incubator for about 5-7 days. Pictures of the culture dishes were taken with a Canon ESO 5D digital camera (Canon, Tokyo, Japan). In addition, cotyledon nodes and 2 cm stem segments below (≥30 plants) of cotton stems were selected for stem sectioning experiments (hand slicing) and observed and photographed under a body microscope (OLYMPUS, Tokyo, Japan). The statistical method of cotton disease index was according to the disease grading standard <GB / T 22101.5-2009>. Cotton plants with normal leaves and healthy plants were defined as:

[0052] Grade 0; cotton true leaves wilted and wilted, and each cotton plant with ≤25% of diseased leaves was defined as grade 1;

[0053] cotton true leaves wilted, each cotton plant with >25% and ≤50% of diseased leaves was defined as grade 2; cotton true leaves wilted, each cotton plant with >50% and ≤70% of diseased leaves was defined as grade 3; cotton leaves almost all fell off, the plant wilted or even died, and each cotton plant with >75% of diseased leaves was defined as grade 4. Disease index = [(∑ grade n x number of diseased plants of the corresponding grade) / (total number of cotton plants x 4)] x 100.

[0054] 1.2 Results

[0055] 1.2.1 Silencing of GhLUX07 gene reduces the resistance of Gossypium hirsutum 'TM-1' to Verticillium wilt

[0056] Virus-mediated gene silencing (VIGS) was used to silence the GhLUX07 gene (i.e., GhLUXA07 and GhLUXD07) in the upland cotton genetic standard line "TM-1". qRT-PCR analysis showed that the transcription level of the GhLUX07 gene in the roots of TRV:GhLUX07 plants was significantly lower than that in the negative control TRV:00, indicating that "knockdown" plants (TRV:GhLUX07) were successfully constructed. Then, seedlings of the knockdown plants and normal plants (control) were infected with V. dahliae for 14 days. Figure 1 (A, symptoms of silenced and control plants 14 days after infection with V. dahliae. B, transcript levels of GhLUX07 in silenced and control plants, GhUBQ7 is an internal reference gene, data are mean ± standard error (n = 3, four plants per biological replicate), Student's t-test, **, p < 0.01. CE, disease index (C), transverse stem section (D), and fungal recovery culture experiment in stem segments (E), Bars = 5 mm (stem section), the culture dish used for recovery culture was 9 cm in diameter, data are mean ± standard error (n = 3; ≥ 30 plants per biological replicate), Student's t-test, *, p < 0.05. **, p < 0.01. dpi: day post The results of the inoculation analysis showed that after silencing the GhLUX07 gene, the expression of the GhLUX07 gene was significantly reduced. The yellow wilt symptoms of TRV:GhLUX07 plants were more severe than those of TRV:00 plants. The disease index of TRV:GhLUX07 plants at 17 dpi and 20 dpi were 34 and 56, respectively, while those of TRV:00 plants were 25 and 50, respectively. The disease index of TRV:GhLUX07 plants was significantly higher than that of TRV:00. Cross-sectioning of the plant stems revealed varying degrees of vascular tissue browning phenotype (caused by V. dahliae infection), but the degree of vascular tissue browning was higher in TRV:GhLUX07 plants, and more V. dahliae V991 cells were recovered in the stem segments. The above results showed that silencing GhLUX07 reduced the resistance of cotton plants to V. dahliae, indicating that GhLUX07 is involved in regulating the resistance response of cotton plants to V. dahliae.

[0057] 1.1.2 Silencing GhLUX07 in Upland cotton reduced the resistance of Upland cotton ‘ZZM2’ to V. dahliae

[0058] GhLUX07 was silenced in the cotton resistant variety ZZM2 and the disease incidence of the plants was analyzed after inoculation with V. dahliae V991. Figure 2A, disease symptoms of silenced and control plants 16 days after inoculation with V. dahliae. B, Transcriptional levels of GhLUX07 in silenced and control plants, GhUBQ7 was the internal control gene, data were mean ± SD (n = 3), Student's t-test, * p < 0.05, ** p < 0.01. C-F, Disease index (C), fungal biomass in roots of cotton plants (D), longitudinal section of stem (E) and fungal recovery experiment in stem segments (F), Bars = 5 mm (section of stem), Bars = 1 cm (recovery culture), data were mean ± SD (n = 3; each biological replicate > 30 plants), Student's t-test, * p < 0.05, ** p < 0.01. dpi: day post inoculation. After interfering GhLUX07 gene, the symptoms of yellowing and wilting of TRV:GhLUX07 plants were more serious than those of control TRV:00 plants, the disease index of TRV:GhLUX07 plants was 60 at 16 dpi, which was significantly higher than that of TRV:00 plants (30); the amount of V. dahliae V991 in the roots of TRV:GhLUX07 and control TRV:00 plants was detected, and it was found that the amount of V. dahliae V991 in the roots of TRV:GhLUX07 plants was significantly higher than that of the control. The stems of the same part of the plants were longitudinally sectioned, and it was found that the degree of browning of the vascular tissue of TRV:GhLUX07 plants was significantly increased; the amount of V. dahliae V991 obtained by recovery culture in stem segments was consistent with the trend of disease index. Thus, it is again proved that silencing GhLUX07 can reduce the resistance of cotton plants to V. dahliae.

[0059] Example 2, Effect of overexpression of GhLUX07 gene on plant resistance to Verticillium wilt and cotton fiber

[0060] 2.1.1 Creation of GhLUX overexpression cotton plants

[0061] The cDNA of TM-1 material was diluted to 100 ng / μL as a template, and the CDS sequence of GhLUXA07 was amplified by primers GhLUX-MWV066-F and GhLUX-MWV066-R, the primer sequences were as follows:

[0062] GhLUX-MWV066-F (5'-3'):

[0063] CATTTGGAGAGAACACGGGGGACATGGGTCAAGAAGTGAAGATGA

[0064] GhLUX-MWV066-R (5'-3'):

[0065] CCGTCATGGTCTTTGTAGTCCATTTGGGAACCATATCTATTCC

[0066] The PCR product obtained was the GhLUXA07 CDS sequence with an MWV066 vector linker. The MWV066 vector was double-digested with restriction endonucleases BmaHI and SalI to obtain a linearized vector. The CDS sequence of GhLUXA07 was cloned into the MWV066 vector (with a 3× Flag tag) using a homologous recombination kit (Vazyme, C112-01) to construct a 35S promoter-driven 35S:GhLUXA07-Flag recombinant vector (the structure of the vector backbone is shown in FIG). Figure 3 As shown in A, where AADA: aminoglycoside 3'-adenosyltransferase; 35Spro: 35S promoter; 3×Flag: three tandem Flag tag sequences; F1 / R1 and F2 / R2 (black arrows): positions and directions of PCR primers used to screen positive plants), the recombinant was transformed into Agrobacterium GV3101, with Baimian No. 1 (BM-1) strain as the background variety. The seeds were cultured aseptically, and when the hypocotyls grew to 2-3 cm, the cotton hypocotyls were cut into small segments of about 1 cm under sterile conditions and infected with the recombinant Agrobacterium solution (OD 600 The hypocotyls were transferred to a solid co-culture medium and cultured at 28°C in the dark for 2 days. The hypocotyls were transferred to a screening medium containing aminoglycoside 3′-adenylyltransferase (AADA) and cultured at 28°C in the light for 20 days. The hypocotyls were then transferred to a callus induction medium. The cells were subcultured every 2 weeks until seedlings were formed. After obtaining the overexpression material, specific amplification primers were designed according to the vector sequence: F1 / R1 amplified the sequence of the resistance gene AADA (F1: 5'-CAGGGTGAGGACCACATTCC-3'; R1: 5'-TCCGACATCGATCTCCTGGT-3'), and F2 / R2 amplified the sequence spanning GhLUXA07 and the Flag tag (F2: 5'-CGAGTGGGAGATGGGATT-3'; R2: 5'-CACCGTCATGGTCTTTGTAG-3'). The primer positions and directions were as follows: Figure 3A indicates the marker. Using standard PCR techniques, gDNA from the plants to be tested was used as a template to amplify the target fragment. Following agarose gel electrophoresis, plants that detected two target bands were designated GhLUX-OE-positive. Total protein from these GhLUX-OE-positive plants was extracted and further screened by immunoblotting using a Flag antibody bound to the GhLUXA07-Flag protein. The primary antibody was a mouse anti-Flag monoclonal antibody; the secondary antibody was an HRP-conjugated goat anti-mouse IgG. Plants that detected the GhLUXA07-Flag band were further designated as positive. This yielded T0-generation GhLUX overexpression material that overexpressed the GhLUXA07 gene. Further propagation was then performed to obtain T3-generation GhLUX overexpression material. To avoid the possibility that changes in GhLUXA07 expression in transgenic materials were caused by phase shifts in the expression rhythm, T3 GhLUX plants cultured for 14 days under 12L / 12D conditions were continuously sampled (roots every 4 hours for 48 hours) to detect GhLUXA07 expression during two photoperiods (primers: GhLUX-RT-F: 5'-GGGATGCATCAAGGATTGTA-3'; GhLUX-RT-R: 5'-TCATTGGGAACCATATCTATTC-3'; internal reference gene GhUBQ7: primers: GhUBQ-RT-F: 5'-GAAGGCATTCCACCTGACCAAC-3'; GhUBQ-RT-R: 5'-CTTGACCTTCTTCTTCTTGTGCTTG-3'). GhLUX-OE-positive lines were further identified based on GhLUXA07 expression and used as materials for subsequent studies.

[0067] 2.1.2 V. dahliae infection of GhLUX-overexpressing cotton

[0068] The seedlings of the obtained GhLUX overexpressing materials were inoculated with V. dahliae. The seedlings of each strain were cultured under 12L / 12D conditions for 21 days and inoculated with V. dahliae V991 spore suspension (1×10 7 conidia / mL) infect plant roots. 15 days after infection, photograph the plant phenotype and analyze for symptoms of Verticillium wilt, such as chlorosis and wilting. For disease index analysis, stem sectioning, and recovery culture methods, refer to 1.1.3.

[0069] 2.1.3 V. dahliae biomass detection

[0070] The cotton roots infected with V. dahliae V991 at different times (3h, 6h and 9h after inoculation) were taken (four plants were mixed in each time point sample), and all the tissues in the sample were ground thoroughly with liquid nitrogen. About 100 mg of powder was taken to extract total gDNA from the roots by using a plant genome extraction kit FastPure Plant DNA Isolation Mini Kit (Vazyme, Nanjing, China), and the methods and steps were referred to the kit instructions. The gDNA contained V. dahliae V991 and cotton gDNA, and GhUBQ7 was used as an internal reference gene. According to the ITS (Internal Transcribed Space) region of V. dahliae, specific primers (ITS1-F: 5'-AAAGTTTTAATGGTTCGCTAAGA-3'; ST-VE1-R: 5'-CTTGGTCATTTAGAGGAAGTAA-3') were designed, and the relative biomass of V991 in cotton was detected by qRT-PCR.

[0071] 2.1.4 Identification of resistance to Verticillium wilt by artificial inoculation

[0072] The resistance of BM-1 and GhLUX overexpression plants to Verticillium wilt was identified by artificial inoculation (NY / T 2952-2016). Each plant was repeated 3 times, with a row length of 6.0 meters and about 25 seedlings left, and a row width of 0.8 meters. Zhongzhi 2 was used as the disease-resistant control, and Jimian 11 was used as the disease-susceptible control. The disease index investigation used a 5-level grading method, as described above. When the disease index of the disease-susceptible control reached about 50, the Verticillium wilt incidence of each line was investigated, and the disease rate and disease index were calculated. The relative disease index was used to evaluate the disease resistance level of each line, i.e. relative disease index = (disease index x 50) / disease index of Jimian 11.

[0073] 2.1.5 Cultivation of Arabidopsis thaliana

[0074] The dry Arabidopsis thaliana seeds were sterilized with 0.1% mercury for 5 minutes, washed with sterile water for 5-6 times, and then single-seeded on 0.6% MS solid medium. After cold treatment at 4°C for 3 days, the seeds were placed in a light incubator with a light cycle of 8h light / 16h darkness, a humidity of 80%, and a temperature of 20°C. After about 3 weeks of continuous cultivation, the Arabidopsis thaliana seedlings were transplanted into nutrient soil and cultured in an Arabidopsis thaliana culture room with a light cycle of 12h light / 12h darkness, a humidity of 80%, and a temperature of 22°C.

[0075] 2.1.6 Construction of GhLUX overexpression and GhLUX / lux plants in Arabidopsis thaliana

[0076] The cDNA of cotton TM-1 was diluted to 100 ng / μL as a template to amplify the CDS sequence of GhLUXA07 with primer pair GhLUX-S1300-F and GhLUX-S1300-R, the primer sequences are as follows:

[0077] GhLUX-S1300-F (5'-3'):

[0078] CGGGGGACTCTTGACGAGCTCATGGGTCAAGAAGTGAAGATGAGTG-

[0079] GhLUX-S1300-R (5'-3'):

[0080] GCTCACCATGTCGACTCTAGATCATTGGGAACCATATCTATTCCC

[0081] The obtained PCR product is the CDS sequence of GhLUXA07 with pCambia1300 vector adapter; meanwhile, the pCambia1300 vector is double-digested with restriction enzymes SacI and XbaI to obtain a linearized vector; the CDS sequence of GhLUXA07 is cloned into the pCambia1300 vector by using a homologous recombination kit (Vazyme, C112-01), and the Agrobacterium GV3101 is transformed into a competent state to obtain the Agrobacterium 35S:GhLUXA07 strain. The strain is inoculated into YEP liquid medium, cultured at 28°C, 220 rpm for 24 h, and the bacterial cells are collected and adjusted to OD 600 = 0.6 with Arabidopsis inflorescence infection liquid (1 / 2MS medium, 3% sucrose) and activated in the dark for 2 h, and then 0.02% surfactant Silwet L-77 is added and shaken well for standby. The inflorescence of wild-type Arabidopsis (Col-0) is infected with the Agrobacterium 35S:GhLUXA07 bacterial liquid obtained above, and the T0 generation GhLUX overexpression plants are obtained after seed harvesting; the inflorescence of Arabidopsis lux mutant plants is infected with the Agrobacterium 35S:GhLUXA07 bacterial liquid obtained above, and the T0 generation Arabidopsis plants are obtained after seed harvesting.

[0082] 2.1.7 V. dahliae infection experiment of Arabidopsis

[0083] The Arabidopsis seedlings are grown for about 3 weeks under the conditions of 20°C, 80% humidity, and 12L / 12D light, and 30 mL of V. dahliae V991 strain conidium suspension (1 x 10 7 conidia / mL) is poured along the roots of Arabidopsis seedlings in the culture box (4 Arabidopsis seedlings are planted in each box), so that the V. dahliae infects the roots of Arabidopsis seedlings.

[0084] 2.1.8 Analysis of Arabidopsis Disease Index

[0085] The Arabidopsis disease index is calculated using the same statistical method as cotton, with disease classification based on disease severity. Normal, healthy leaves are designated as Grade 0; chlorotic and wilting true leaves with ≤25% of diseased leaves per plant are designated as Grade 1; chlorotic and wilting true leaves with >25% but ≤50% of diseased leaves per plant are designated as Grade 2; chlorotic and wilting true leaves with >50% but ≤70% of diseased leaves per plant are designated as Grade 3; and nearly complete leaf loss, wilting, or even death of a plant with >75% of diseased leaves per plant are designated as Grade 4. Disease index = [(∑Grade n × Number of diseased plants of the corresponding grade) / (Total number of plants × 4)] × 100.

[0086] 2.1.9 Cotton fiber quality index testing

[0087] Seeds of BM-1 and GhLUX-OE were sown in a test field at the Jinming Campus of Henan University (114°18'E, 34°49'N). Mature cotton fibers were harvested after cotton boll opening. A 30g sample of mature, dry cotton fiber was tested at the Cotton Quality Supervision and Inspection Center of the Ministry of Agriculture and Rural Affairs (under the supervision of the Cotton Research Institute of the Chinese Academy of Agricultural Sciences). Eight HVI (Hydraulic Inertia Virility) indicators were tested: average length of the upper half, uniformity index, specific breaking strength, micronaire value, elongation, reflectivity, yellowness, and spinning uniformity index. Testing was conducted in accordance with GB / T 398-2008.

[0088] 2.2 Results

[0089] 2.2.1 Creation of GhLUX-OE Upland Cotton Material

[0090] The constructed 35S promoter-driven 35S:GhLUXA07-Flag recombinant vector was used in cotton genetic transformation technology to create a stable GhLUXA07 overexpression (GhLUX-OE) material in the susceptible variety "BM-1" as the background. PCR amplification of the resistance gene AADA sequence and the sequence spanning the GhLUXA07 and Flag tags revealed the following results: Figure 3 As shown in B (where M: 2kplus nucleic acid marker; 1-4: 4 GhLUX-OE transgenic lines), two target bands can be detected in plants 1-4 of the T0 generation of the GhLUX-OE material; total protein of the GhLUX-OE plants was extracted, and the results of immunoblotting were as follows: Figure 3CAs shown in Fig. 2, about 50 KDa GhLUXA07-Flag band could be detected in all 2-4 lines, and the expression level of GhLUXA07-Flag was the highest in line 4. Therefore, lines 3 and 4 were expanded and renamed as GhLUX-OE1 (line 3) and GhLUX-OE2 (line 4).

[0091] After obtaining T3 generation of GhLUX-OE1 and GhLUX-OE2 plants, the plants were sampled continuously (every 4 h for 48 h) under LD condition, and the expression was detected. The results are shown in Fig. 3. Figure 4 As shown in Fig. 3, compared with the transformation background material "BM-1", GhLUXA07 was continuously highly expressed in GhLUX-OE1 and GhLUX-OE2 plants, and was not rhythmic.

[0092] Thus, stably inherited GhLUX overexpression materials, GhLUX-OE1 and GhLUX-OE2 lines, were successfully obtained, which could be used for further experimental research.

[0093] 2.2.2 Cotton GhLUX overexpression enhanced plants resistance to V. dahliae

[0094] The seedlings of the above two GhLUX overexpression materials (GhLUX-OE1 and GhLUX-OE2) were inoculated with V. dahliae, and the yellowing and wilting symptoms of the plants were analyzed. The results showed that the yellowing and wilting of GhLUX-OE1 and GhLUX-OE2 seedlings were significantly lower than those of the control plants "BM-1" ( Figure 5 A), and the disease index, vascular tissue browning degree of stem (longitudinal section), and V. dahliae amount recovered from the stem segments of GhLUX-OE1 and GhLUX-OE2 plants were also significantly lower than those of the control plants ( Figure 5 B-D).

[0095] In addition, the resistance of GhLUX overexpression (GhLUX-OE2) material was identified by using a V. dahliae artificial plot. With Zhuanzhi 2 (resistant) as the disease-resistant control and Jicun 11 (susceptible) as the disease-susceptible control, the incidence of V. dahliae in each variety was investigated. The results showed that Figure 6(A, the phenotypes of A, BM-1 and GhLUX-OE2 in adult stage, scale = 10 cm. B-C, the statistics of plant disease incidence (B) and disease index (C); Jimian11: susceptible control; ZZM2: resistant control. The data are the average values of three biological replicates ± standard errors, and the statistical analysis method is one-way ANOVA, and the treatments with the same letter represent no significant difference, and the different letters represent significant difference between treatments, p < 0.05) shows that the Verticillium wilt symptoms of GhLUX-OE2 plants are lighter than those of BM-1, and there is no obvious chlorosis in the leaves Figure 6 A); the disease incidence is lower than that of BM-1 and Jimian11 Figure 6 B); and the relative disease index is also significantly lower than that of Jimian11, and there is no significant difference with Zhongzhimian No.2 Figure 6 C), indicating that the Verticillium wilt resistance of GhLUX-OE2 plants is higher than that of BM-1, and reaches the resistant reaction type. The results of disease resistance phenotype analysis in seedling stage and adult stage show that GhLUX overexpression can enhance the resistance of cotton plants to V. dahliae.

[0096] V. dahliae invades cotton from the roots, first adsorbing on the surface of root cells, germinating and invading the inside of root cells under suitable conditions. In this study, the GFP-labeled V. dahliae V991-GFP strain was used to explore the effect of GhLUX overexpression on the adsorption process of V. dahliae spores to the root surface. The roots of GhLUX-OE1, GhLUX-OE2 and BM-1 plants were infected with V. dahliae V991-GFP strain conidial suspension (1×10 7 conidia / mL), and the adsorption of spores on the root surface was observed by laser confocal microscope 12h after inoculation, and the pictures were taken by laser confocal microscope. From Figure 7 A (red shows the cell outline after PI staining, and green shows V. dahliae V991-GFP spores. The spores adsorbed on the root surface are indicated by white arrows; the right side is a local enlarged image in the box of the left picture. Bars = 100 μm.) The results show that the number of V991-GFP spores adsorbed on the root surface of GhLUX-OE1 and GhLUX-OE2 plants is less than that of BM-1; further detection of V. dahliae V991 biomass in roots shows that the amount of V. dahliae V991 in the roots of GhLUX-OE1 and GhLUX-OE2 plants is also significantly less than that of control plants BM-1 Figure 7B, Data are means ± standard errors of three technical replicates (n = 3), statistical analysis method is Student’s t-test, **, p < 0.01). The above shows that overexpression of cotton GhLUX can inhibit the adsorption process of V. dahliae spores to roots.

[0097] In summary, overexpression of cotton GhLUX can significantly enhance the resistance of plants to Verticillium wilt and inhibit the adsorption of V. dahliae spores to roots at the early stage of infection.

[0098] 3.3.8 Heterologous expression of GhLUX enhances resistance of Arabidopsis to V. dahliae

[0099] To further confirm the positive regulation of GhLUX on Verticillium wilt resistance, cotton GhLUXA07 was transformed into Arabidopsis plants to create a series of GhLUXA07 different expression lines, and these materials were treated with V. dahliae V991 to analyze their resistance to Verticillium wilt. The constructed p35S:GhLUXA07 vector was transformed into Arabidopsis WT (Col-0) plants to obtain GhLUXA07 overexpression lines p35S:GhLUXA07-OE5 and p35S:GhLUXA07-OE8, which were then transformed into lux-4 mutant plants to obtain the complemented line p35S:GhLUXA07 / lux-4. Analysis of the disease symptoms of plants after inoculation found that Arabidopsis lux-4 mutant was sensitive to V. dahliae, while the disease index of p35S:GhLUXA07 / lux-4 plants was significantly lower than that of lux-4 mutant; similarly, as shown in Fig. 3B, the disease index of p35S:GhLUXA07-OE5 and p35S:GhLUXA07-OE8 was also significantly lower than that of lux-4 mutant, which indicated that GhLUX could complement the function of Arabidopsis lux and improve the resistance of Arabidopsis to V. dahliae. Figure 8 (Wherein, A, the phenotype of Arabidopsis GhLUX different expression lines after inoculation, that is, Arabidopsis materials of Col-0, lux-4, p35S:GhLUXA07 / lux-4 and p35S:GhLUXA07 / OE were inoculated, and the main stem was cut and photographed after 2 weeks of inoculation. B, GhLUXA07 expression, the internal reference gene is AtACTIN2, data are means ± standard deviation of three biological replicates. C, Disease index, data are means ± standard deviation of three biological replicates; N≥60 for each biological replicate. Statistical analysis method is one-way ANOVA, the same letter indicates no significant difference between treatments, and different letters indicate significant difference between treatments, p < 0.05.) As shown in Fig. 3B, the disease index of p35S:GhLUXA07-OE5 and p35S:GhLUXA07-OE8 was also significantly lower than that of lux-4 mutant, which indicated that GhLUX could complement the function of Arabidopsis lux and improve the resistance of Arabidopsis to V. dahliae.

[0100] 3.3.9 GhLUX overexpression improves cotton fiber quality

[0101] In this study, we focused on some traits related to cotton fiber development and detected the fiber quality indexes of GhLUX overexpression (GhLUX-OE1 and GhLUX-OE2) plants, and the results are shown in Figure 9 (A, fiber phenotype, scale = 1 cm. B-E, average length of upper half of fiber (B), strength (C), micronaire (D), and spinning uniformity index (E) of BM-1 and GhLUX-OE materials in 2022. Data are means ± standard deviation of three replicates (n = 3), and statistical analysis method is Student’s t-test, **, p < 0.01, ***, p < 0.001) showed that the average length of upper half of fiber, fiber strength (toughness), and spinning uniformity index of GhLUX-OE1 and GhLUX-OE2 plants in 2022 and 2023 were significantly higher than those of BM-1 Figure 9 B-C), and the specific values are shown in Table 1. The improvement of these indexes indicates that the fiber quality of GhLUX overexpression plants is improved. Overall, the increase in disease resistance caused by GhLUX overexpression does not greatly weaken the fiber quality, but significantly improves the length, strength, and uniformity of the fiber.

[0102]

[0103] 3.3.11 GhLUX overexpression improves cotton fiber yield

[0104] The above results show that overexpression of GhLUX does not reduce fiber quality, so does it have any effect on fiber yield? To explore the effect of GhLUX overexpression on plant resistance and fiber yield, we counted the cotton fiber yield-related indexes of GhLUX overexpression and BM-1 plants in normal cotton fields and artificial disease plots of Verticillium wilt. The results showed that in normal cotton fields, compared with the background variety BM-1, the theoretical lint yield and seed cotton yield of GhLUX-OE1 and GhLUX-OE2 plants were significantly improved, and the boll weight was also significantly increased; the lint percentage did not change significantly; the theoretical yield was calculated at a planting density of 20,000 plants / hm 2 The yield values in 2022 and 2023 were improved (Table 2); in the artificial disease plot of Verticillium wilt, the (pre-frost) seed cotton yield of GhLUX-OE2 plants was higher than that of BM-1 (Table 3). The above results show that GhLUX overexpression not only improves plant resistance, but also improves fiber yield.

[0105] Table 2 Comparison of yield and yield traits of BM-1 and GhLUX-OE plants in normal cotton fields

[0106]

[0107] a, boll yield in the middle of the plant; b, ratio of lint and seed cotton; c, average single boll weight; d, 100-seed weight; e, 20,000 plants / hm 2 Theoretical yield = 20,000 x single boll weight x boll number x seed content; Data are mean ± standard deviation (n = 3); Statistical analysis was Student's t-test:

[0108] ***, p < 0.001.

[0109] Table 3. Comparison of yield of BM-1 and GhLUX-OE plants in the field

[0110]

[0111] a, pre-moisture flower (seed cotton) yield per plant, the yield of 6 plants randomly collected was calculated; b, row spacing = 0.8 m, plant spacing = 0.24 m, planting density = 10,000 / (row spacing x plant spacing), yield = seed cotton yield per plant x planting density.

[0112] The conventional techniques and schemes not described in detail in the above examples are well known in the art, and thus will not be described in detail herein. The above examples and / or experimental examples describe the preferred embodiments of the present application in detail, however, the present application is not limited to the specific details in the above embodiments, and within the technical concept of the present application, various simple modifications can be made to the technical scheme of the present application, and these simple modifications all belong to the protection scope of the present application.

Claims

1. Application of cotton GhLUX07 gene in plant resistance to Verticillium wilt, wherein the nucleotide sequence of the GhLUX07 gene is shown in SEQ ID NO.1 or SEQ ID NO.2, or the amino acid sequence is shown in SEQ ID NO.3 or SEQ ID NO.

4.

2. The use according to claim 1, characterized in that The plant is cotton or Arabidopsis thaliana.

3. Use of a chimeric gene or expression cassette containing the GhLUX07 gene in plant resistance to Verticillium wilt, wherein the nucleotide sequence of the GhLUX07 gene is shown in SEQ ID NO.1 or SEQ ID NO.

2.

4. A method for improving plant resistance to Verticillium wilt, characterized in that: include: The nucleotide sequence of the GhLUX07 gene according to claim 1 is connected to a plant expression vector to obtain a recombinant plant expression vector, and the recombinant plant expression vector is transformed into a plant by Agrobacterium tumefaciens transformation to obtain a transgenic plant. Compared with non-transgenic plants, the transgenic plant has a stronger resistance to Verticillium wilt.

5. A method for cultivating plant varieties resistant to Verticillium wilt, characterized in that: include: Construct the GhLUX07 gene overexpression recombinant plant expression vector according to claim 1; transform the GhLUX07 gene overexpression plant expression vector into plants to overexpress the GhLUX07 gene in the plants, obtain transgenic positive plants and screen to obtain plant varieties with improved resistance to Verticillium wilt.

6. Use of the cotton GhLUX07 gene according to claim 1 in inhibiting the adsorption of Verticillium dahliae spores to plant roots.

7. Use of the cotton GhLUX07 gene according to claim 1 in improving cotton fiber quality and yield.

8. The use according to claim 7, characterized in that The cotton fiber qualities include the length, strength and uniformity of the fibers.

Images