Corn nonsense-mediated mRNA degradation regulatory factor gene and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a corn nonsense mediated mRNA degradation regulatory factor gene and application thereof. The nucleotide sequence of the corn nonsense-mediated mRNA degradation regulatory factor gene is shown as SEQ ID NO.1-2. Through overexpression and editing of the corn nonsense-mediated mRNA degradation regulatory factor gene, it is proved that the corn nonsense-mediated mRNA degradation regulatory factor gene can respond to heat stress, overexpression improves the heat resistance and drought tolerance of plants, and the corn nonsense-mediated mRNA degradation regulatory factor gene can respond to heat stress. The expression level of the target gene is reduced to generate a corn heat-sensitive mutant, and the drought tolerance of the plant is reduced. The knockout of the corn target gene significantly improves the corn plant shape, reduces the plant height and the ear height, has an application value in semi-dwarf and compact corn breeding, and improves the lodging resistance of the corn plant.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a maize nonsense-mediated mRNA degradation regulatory factor gene and application thereof. BACKGROUND

[0002] Maize (Zea mays L.) is one of the most important crops in the world, which not only provides a large amount of energy and nutrients for human beings, but also plays an important role in the livestock industry and bioenergy industry as feed and industrial raw materials. In recent years, with the continuous increase of maize planting density, the improvement of ideal plant type of maize has become one of the focuses of maize genetic breeding research. With the continuous practice and exploration of breeding experts on the ideal plant type of maize, it is pointed out that the compact maize variety has high assimilation, and more energy can form grain yield, which has important value for improving the economic benefit of maize.

[0003] In addition to the influence of maize plant type on yield, global warming and frequent extreme weather (drought) also seriously affect the yield of maize. Heat stress usually refers to that the plant feels a temperature of 10-15℃ or higher than the suitable growth temperature for a period of time, which causes irreversible damage to the growth and development of the plant. Temperature stress changes the fluidity and stability of cell membrane components, affects membrane proteins and triggered downstream reactions, and affects enzyme activity and cell metabolism. In addition, temperature stress also causes changes in protein stability and induces changes in RNA secondary structure. The influence of drought and soil salinization on plants mainly manifests as osmotic stress and ion toxicity. Changes in osmotic potential make it difficult for the root system to absorb water, the stomata close, photosynthesis decreases or stops, etc., causing damage to cell metabolism and structure, reducing root activity and nutrient absorption capacity, and even causing plant death. Therefore, heat stress and drought stress are also major factors affecting maize yield.

[0004] However, the related mechanism of the research on maize plant type and stress is slow. Therefore, it is of great significance to explore excellent genes and apply them to maize breeding for improving the planting density, lodging resistance, heat resistance and drought resistance of maize, and improving the yield level. SUMMARY

[0005] To solve the problems in the prior art, the present application provides a maize nonsense-mediated mRNA degradation regulatory factor gene and application thereof.

[0006] To achieve the above-mentioned purpose, the technical scheme provided by one or more embodiments of the present application is as follows: In a first aspect of the present application, the application of a maize nonsense-mediated mRNA degradation regulatory factor gene or a biological material containing the maize nonsense-mediated mRNA degradation regulatory factor gene in at least one of the following is provided: (a1) application in reducing plant height; (a2) Application in improving heat tolerance of plants; (a3) Application in improving plant drought tolerance; (a4) Application in increasing plant lodging resistance; (a5) Application in plant breeding; The nucleotide sequence of the maize nonsense-mediated mRNA degradation regulatory factor gene (abbreviated as ZmUPF3L) is shown in SEQ ID NO.1-2, wherein the nucleotide sequence of ZmUPF3L1 is shown in SEQ ID NO.1, and the nucleotide sequence of ZmUPF3L2 is shown in SEQ ID NO.2 Among them, in improving the heat resistance and drought resistance of plants, the specific performance is: (b1) inhibiting the accumulation of malondialdehyde in plants under heat stress or drought stress; (b2) Alleviating plant cell membrane ion leakage under heat stress or drought stress; (b3) Alleviate the reduction of chlorophyll content in plants under heat stress or drought stress.

[0007] In some specific embodiments of the present invention, the plants include corn, sorghum, barley, rice, and tobacco.

[0008] In some specific embodiments of the present invention, the application refers to knocking out the maize nonsense-mediated mRNA degradation regulatory factor gene to obtain gene-edited plants, which can reduce plant height and increase plant lodging resistance.

[0009] In some specific embodiments of the present invention, the application refers to overexpressing nonsense-mediated mRNA degradation regulatory factor genes in corn to obtain transgenic plants, thereby improving the heat resistance and drought resistance of the plants.

[0010] The present invention, through phenotypic analysis of corn throughout its growth period, has clarified that knocking out the ZmUPF3L1 or ZmUPF3L2 gene can significantly improve corn plant shape, reduce plant height and ear height, has application value in compact corn breeding, and improves the lodging resistance of corn plants; overexpression of ZmUPF3L1 and ZmUPF3L2 can respond to drought and heat stress, and can be used to improve plant drought and heat tolerance. The present invention, through the construction of ZmUPF3L1 and ZmUPF3L2 gene knockout mutants and resistance testing, has clarified that the ZmUPF3L1 and ZmUPF3L2 genes are involved in plant abiotic stress response. At the same time, plants with overexpression or knockdown of ZmUPF3L1 and ZmUPF3L2 can be further used for hybrid breeding or backcross breeding, promoting corn stress resistance breeding and abiotic stress pathway research.

[0011] In some embodiments of the present invention, the transgenic plant includes a corn plant, a sorghum plant, a rice plant, a barley plant, or a tobacco plant; and the gene-edited plant includes corn and sorghum.

[0012] In some specific embodiments of the present invention, the biological material comprising the maize nonsense-mediated mRNA degradation regulatory factor gene comprises a recombinant vector, a recombinant microorganism or an expression cassette.

[0013] In some specific embodiments of the present invention, the recombinant vector is one or more of a viral vector, a plasmid or an artificial chromosome; the viral vector may include a retroviral vector, and the artificial chromosome may include a bacterial artificial chromosome (BAC) or a bacteriophage P1-derived vector (PAC).

[0014] In some embodiments of the present invention, the recombinant microorganism can be a prokaryotic cell or a eukaryotic cell.

[0015] In some embodiments of the present invention, the recombinant microorganism is any one or more of a bacterial cell, a fungal cell, or a plant cell.

[0016] In some embodiments of the present invention, the bacterial cell is any species of the genus Agrobacterium.

[0017] In some specific embodiments of the present invention, the bacterial cell is Escherichia coli (such as Escherichia coli DH5α), Agrobacterium tumefaciens (such as LB4404), or Agrobacterium rhizogenes.

[0018] In some specific embodiments of the present invention, in the step of improving the heat tolerance of corn, the temperature is 34-45° C.; in the step of improving the drought tolerance of corn, the relative water content of the rhizosphere soil is less than 16%.

[0019] The second aspect of the present invention provides a preparation comprising at least one of the following (c1) to (c4): (c1) a nucleic acid molecule as shown in SEQ ID NO. 1-2; (c2) an expression vector comprising the nucleic acid molecule described in (c1); (c3) a recombinant host comprising (c2); (c4) a promoter or enhancer that increases expression of a maize nonsense-mediated mRNA degradation regulator gene; (c5) Inducers that promote expression of the gene regulating factor of nonsense-mediated mRNA degradation in maize.

[0020] In some embodiments of the present application, the promoter for enhancing the expression of the maize nonsense-mediated mRNA decay regulatory factor gene comprises a stress-inducible promoter RD29A and a constitutive promoter Ubiquitin 1.

[0021] In a third aspect of the present application, a method for reducing the plant height of maize is provided, comprising the step of inhibiting or reducing the expression of the maize nonsense-mediated mRNA decay regulatory factor gene in a receptor maize to obtain maize with a plant height lower than that of the receptor maize, wherein the receptor maize contains the maize nonsense-mediated mRNA decay regulatory factor gene, and the nucleotide sequence of the maize nonsense-mediated mRNA decay regulatory factor gene is shown as SEQ ID NO. 1-2.

[0022] In a fourth aspect of the present application, a method for improving the heat and drought tolerance of maize is provided, comprising the step of increasing the expression of the maize nonsense-mediated mRNA decay regulatory factor gene in a receptor maize to obtain maize with a plant height lower than that of the receptor maize, wherein the nucleotide sequence of the maize nonsense-mediated mRNA decay regulatory factor gene is shown as SEQ ID NO. 1-2.

[0023] In a fifth aspect of the present application, a method for improving the lodging resistance of maize is provided, comprising the step of inhibiting or reducing the expression of the maize nonsense-mediated mRNA decay regulatory factor gene in a receptor maize, wherein the nucleotide sequence of the maize nonsense-mediated mRNA decay regulatory factor gene is shown as SEQ ID NO. 1-2.

[0024] In some embodiments of the present application, the method for increasing the expression of the maize nonsense-mediated mRNA decay regulatory factor gene in a receptor maize comprises: constructing a vector containing the maize nonsense-mediated mRNA decay regulatory factor gene, and transforming the vector into Agrobacterium; and infecting the cells or explants of the plant with the Agrobacterium.

[0025] In some embodiments of the present application, the method for increasing the expression of the maize nonsense-mediated mRNA decay regulatory factor gene in a receptor maize further comprises the following steps: S1, designing primers to amplify the coding sequence of the maize nonsense-mediated mRNA decay regulatory factor gene; S2, inserting the coding sequence of the maize nonsense-mediated mRNA decay regulatory factor gene into a pCUE plasmid to obtain a recombinant expression plasmid; S3, introducing the recombinant expression plasmid into Agrobacterium, and culturing the Agrobacterium to obtain an Agrobacterium bacterial solution with an OD600 of 0.2-0.5; S4, introducing the Agrobacterium liquid into the plant cells to obtain Agrobacterium infected callus, then carrying out bacteriostatic culture and selection by a selection agent to obtain callus resistant to the selection agent; bud induction, rooting induction and transplanting domestication are carried out to obtain the callus.

[0026] In some embodiments of the present application, the insertion site is Bam HI enzyme cutting site.

[0027] In some embodiments of the present application, the Agrobacterium is selected from any one of EHA105, LBA4404 and GV3101.

[0028] In some embodiments of the present application, the gene of the maize nonsense-mediated mRNA decay regulatory factor in the recipient maize is inhibited or reduced by a nucleic acid molecule that causes the gene to be deleted or inactivated by gene knockdown technology, gene editing technology and / or gene knockout technology.

[0029] Further, it is well known to those skilled in the art to inhibit gene expression, silence or knockout a gene by using gene knockdown technology (including RNA interference technology, Morpholino interference technology, antisense nucleic acid technology and ribozyme technology, etc.), gene editing technology (including zinc finger nuclease gene editing technology, TALEN gene editing technology and CRISPR gene editing technology, etc.) or gene knockout technology (including complete gene knockout and conditional gene knockout). For example, shRNA, siRNA or miRNA targeting the protein PeDWF4-encoding gene can be used to inactivate gene expression or silence the gene at the post-transcriptional level or the translation level. The CRISPR-Cas system containing sgRNA and Cas protein can also be used to knockout the target gene.

[0030] In some embodiments of the present application, the gene of the maize nonsense-mediated mRNA decay regulatory factor in the recipient maize is inhibited or reduced by using the CRISPR-Cas system containing sgRNA and Cas protein to knockout the target gene.

[0031] In some embodiments of the present application, the sgRNAs sequence targeting ZmUPF3L1 is sgRNA1: CCTAAATTTCAAGCACCCAGAGG (SEQ ID NO. 3); sgRNA2: GGATGTTGTTGAGTTTGCTGAGG (SEQ ID NO. 4); the sgRNAs sequence targeting ZmUPF3L2 is sgRNA3: CCTTAATTTCAAGCGCCCCGAGG (SEQ ID NO. 5); sgRNA4: GGATGTTGTTGAGTTCGCTGAGG (SEQ ID NO. 6).

[0032] One or more technical solutions have the following advantages: The present application determines that knocking out the ZmUPF3L1 or ZmUPF3L2 gene of corn significantly improves the plant shape, reduces the plant height and ear height, has application value in compact corn breeding, and improves the lodging resistance of corn plants; through overexpression of the nonsense-mediated mRNA degradation regulatory factor genes ZmUPF3L1 and ZmUPF3L2, it is further proved that ZmUPF3L1 and ZmUPF3L2 can respond to drought and heat stress, and can be used to improve the drought and heat tolerance of plants. The plants with overexpression or knockdown expression of ZmUPF3L1 and ZmUPF3L2 can be further used for hybrid breeding or backcross breeding, promoting corn stress breeding and non-biological stress pathway research, and have good practical application value. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 Figure 1 is a schematic diagram of the heat tolerance detection of the ZmUPF3L1 and ZmUPF3L2 overexpression and gene editing corn plant lines in the embodiments of the present application, wherein A is a schematic diagram of the culture, treatment and sampling time of the corn seedling heat tolerance detection material; B is the ZmUPF3L1 and ZmUPF3L2 overexpression, gene editing line and wild type control corn plant 4 days after the heat stress treatment and normal culture; C and D are the changes of MDA and ion leakage in the leaves of the ZmUPF3L1 and ZmUPF3L2 overexpression and wild type control corn plants during the heat stress treatment; E is the changes of MDA, ion leakage and chlorophyll content in the leaves of the ZmUPF3L1 and ZmUPF3L2 gene editing and wild type control corn plants during the heat stress treatment; OE: overexpression line; KO: gene editing line; WT: wild type line (non-engineering line).

[0034] Figure 2 Figure 2 is a schematic diagram of the drought tolerance detection of the ZmUPF3L1 and ZmUPF3L2 overexpression and gene editing corn plant lines in the embodiments of the present application; wherein A is the phenotype of the ZmUPF3L1 and ZmUPF3L2 overexpression and editing line corn plant under drought stress treatment for 5 days; B is the relative water content of the ZmUPF3L1 and ZmUPF3L2 overexpression and editing line corn plant under drought stress treatment for 5 days; C is the osmotic potential of the ZmUPF3L1 and ZmUPF3L2 overexpression and editing line corn plant under drought stress treatment for 5 days; D is the ear phenotype in the drought pot experiment; E is the yield per plant in the drought pot experiment; F is the comparison of the yield reduction caused by drought; OE: overexpression line; KO: gene editing line; WT: wild type line (non-engineering line).

[0035] Figure 3Figure 1 is a schematic diagram of the whole growth period table row detection of ZmUPF3L1 and ZmUPF3L2 gene edited corn plant lines in the embodiments of the present application; wherein A is the phenotype of ZmUPF3L1 and ZmUPF3L2 edited and control corn plant lines at the seedling stage; B is the plant height determination results of ZmUPF3L1 and ZmUPF3L2 edited and control corn plant lines at the seedling stage; C is the aboveground biomass determination results of ZmUPF3L1 and ZmUPF3L2 edited and control corn plant lines at the seedling stage; D is the phenotype of ZmUPF3L1 and ZmUPF3L2 edited and control corn plant lines at the adult stage; E is the ear position height of ZmUPF3L1 and ZmUPF3L2 edited and control corn plant lines at the adult stage; F is the plant height of ZmUPF3L1 and ZmUPF3L2 edited and control corn plant lines at the adult stage; G is the yield per plant of ZmUPF3L1 and ZmUPF3L2 edited and control corn plant lines at the harvest stage; H is the yield per plant comparison results of ZmUPF3L1 and ZmUPF3L2 edited and control corn plant lines at the harvest stage; OE: overexpression line; KO: gene edited line; WT: wild type line (non-engineered line). DETAILED DESCRIPTION

[0036] It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0037] Materials used in the present application: The corn used is the inbred line Lqt11 (selected by the laboratory), which is an inbred line for laboratory transformation.

[0038] The sequence of the corn Ubiquitin 1 promoter Pubi can be found in the reference: Christensen AH, Quail PH. Ubiquitin promoter-based vectors for high-level expression of selectable and / or screenable marker genes in monocotyledonous plants. Transgenic Res. Arabidopsis thaliana and analysis of its promoter in transgenic plants. Mol Gen Genet. Glufosinate-ammonium, manufacturer: Macklin Inc; article number: 77182-82-2; G890361.

[0039] 2,4-D, manufacturer: Macklin Inc; article number: 94-75-7; D806768.

[0040] 6-Benzylpurine: manufacturer: Sigma-Aldrich; article number: 1214-39-7; formulation: dissolved in a small amount of 0.2 mol / L HCI and then diluted with distilled water to 1 μmol / mL.

[0041] Cefuroxime, manufacturer: MedChemExpress LLC; article number: 56796-20-4.

[0042] Indole-3-butyric acid, manufacturer: MedChemExpress LLC; article number: 133-32-4.

[0043] Basic medium formulation: MS medium (Murashige & Skoog, 1962) + 5 mg / L thiamine hydrochloride + 100 mg / L proline + 6 g / L agar powder, pH 5.5-5.8.

[0044] Transfection medium formulation: basic medium without agar powder + 1.0 μmol / L 2,4-D + 100 μmol / L acetoin, pH 5.2.

[0045] Induction medium formulation: basic medium + 2.5-5.0 μmol / L 2,4-D.

[0046] Bacteriostatic medium formulation: basic medium + 200 mg / L cefuroxime.

[0047] Selection medium formulation: basic medium + 8-10 mg / mL glufosinate-ammonium.

[0048] Differentiation medium formulation: basic medium + 1-2 μmol / L 6-benzylpurine.

[0049] Rooting medium formula: basic medium + 2.5 μmol / L indole-3-butyric acid.

[0050] All the media were sterilized at 121℃ for 15 min, and the aqueous solutions of acetosyringone, cephalosporin, glufosinate, plant hormones and the like were filtered and sterilized, added to the medium after sterilization (at 50-60℃) and mixed evenly.

[0051] Method used in the examples: DAB (dimethylbenzidine) color development used DAB color reagent kit of Scientific PhygeneR company, and the operation was according to the instruction.

[0052] NBT (Nitrotetrazolium blue chloride) color development used the method introduced by Shanghai Xinfan Biotechnology Co., Ltd. (http: / / www.shxfkj.com / ).

[0053] Malondialdehyde content determination used thiobarbituric acid (TBA) method, see “Determination of Malondialdehyde Content in Plant Tissues” (https: / / www.docin.com / ).

[0054] Cell membrane leakage rate determination used conductivity meter method, referring to the method of Fan et al. (Plant Cell, 1997, 9:2183-2916).

[0055] It should be noted that the terms used here are only for the purpose of describing specific embodiments, and are not intended to limit the exemplary embodiments according to the present application.

[0056] Example 1: Construction of transgenic plants overexpressing ZmUPF3L1 and ZmUPF3L2 genes 1. Construction of vectors overexpressing ZmUPF3L1 and ZmUPF3L2 genes.

[0057] ZmUPF3L1 and ZmUPF3L2 genes were cloned from corn plants or artificially synthesized, expression vectors for plant transformation were constructed, and transgenic plants were produced by transgenic technology; by determining the heat tolerance of the transgenic plants, transgenic plants and their offspring with significantly improved or reduced heat tolerance were screened, and new plant germplasm with application value was created.

[0058] In order to efficiently express the ZmUPF3L1 and ZmUPF3L2 genes in corn, the ZmUPF3L1 and ZmUPF3L2 genes are recombined into a plant expression vector and applied to corn transgenesis to generate corn engineering plants. The present application provides a scheme for constructing a corn ZmUPF3L1 and ZmUPF3L2 gene fusion gene and a plant expression vector, and through corn genetic transformation, engineering plants with altered heat tolerance traits are generated, and corn new germplasm with important utilization value is created.

[0059] The ZmUPF3L1 and ZmUPF3L2 genes are cloned from a high-quality cDNA library of corn inbred line Lqt11. The primers used for cloning ZmUPF3L1 are ZmUPF3L1-fF (GTAGGATTCGAGGTGTCGGC) and ZmUPF3L1-fR (ATGGACAAACTCACGAGCCT), and the amplified fragment is 1546 bp, which contains the complete open reading frame of 1500 bp of the ZmUPF3L1 gene. The primers used for cloning ZmUPF3L2 are ZmUPF3L2-fF (CGACACGAGAGAGATTCGGG) and ZmUPF3L2-fR (ACCACGACTGGCAATACCTG), and the amplified fragment is 1651 bp, which contains the complete open reading frame of 1557 bp of the ZmUPF3L2 gene. The amplified products are sequenced and identified, and the CDS fragment nucleotide sequences of the ZmUPF3L1 and ZmUPF3L2 genes are shown in SEQ ID No. 1 and SEQ ID No. 2.

[0060] In order to efficiently express the ZmUPF3L1 and ZmUPF3L2 genes in corn, the ZmUPF3L1 and ZmUPF3L2 genes are recombined into a plant expression vector and applied to corn transgenesis to generate corn engineering plants. The present application provides a scheme for constructing a corn ZmUPF3L1 and ZmUPF3L2 gene fusion gene and a plant expression vector, and through corn genetic transformation, engineering plants with altered heat tolerance traits are generated, and corn new germplasm with important utilization value is created. PstI restriction site, and the ZmUPF3L1 and ZmUPF3L2 genes with a BamHI restriction site at the 3' end, were cloned by PstI and Bam After double enzyme digestion with HI, the fragment was recovered, which was the inserted fragment. At the same time, the plant expression vector pCUE (the expression vector used pCAMBIA1300-PUbi::MCS- -P35S::eBar (pCUE) as the backbone vector, and the plasmid pCAMBIA1300 was purchased from Cambia Company, with the product number HG-VZC0323. The Lac promoter of pCAMBIA1300 was replaced with the maize Ubiquitin 1 promoter PUbi (sequence see reference: Christensen AH, Quail PH. Ubiquitin promoter-based vectors for high-level expression of selectable and / or screenable marker genes in monocotyledonous plants. Transgenic Res. 1996 May;5(3):213-218) through the HindIII and PstI double enzyme digestion sites, and the plant selection marker gene HygR was replaced with the herbicide glufosinate resistance gene eBar (SEQ ID NO.7) modified with maize preferred codons, i.e. pCUE) was cloned and cloned. Bam The vector fragment was recovered by single enzyme digestion with HI. The insert and vector fragments were mixed and ligated. E. coli were then transformed. Well-isolated clones were selected on screening medium and analyzed by PCR. Plasmids from correctly identified clones were extracted and sequenced. Restriction enzyme digestion results were used to select the correctly recombined plasmids pCUE-ZmUPF3L1 and pCUE-ZmUPF3L2.

[0061] 2. Transformation of vectors overexpressing ZmUPF3L1 and ZmUPF3L2 genes and identification of transgenic plants corn( Zea mays The transgenic recipient material was the inbred line Lqt11, and maize culture cells were transformed using Agrobacterium tumefaciens-mediated method.

[0062] The recombinant plasmids pCUE-ZmUPF3L1 and pCUE-ZmUPF3L2 obtained in Step 1 were introduced into Agrobacterium tumefaciens LBA4404, single colonies were picked and cultured in 2 mL of YEP liquid medium (yeast extract 10 g / L, NaCl 5 g / L, peptone 10 g / L, pH 7.0, sterilized at 121°C for 20 min) containing rifampicin 50 mg / L for 2-3 hours, and then the bacterial solution was transferred to 6 mL of YEP liquid medium containing rifampicin 50 mg / L for overnight culture. The next day, the bacterial solution was added to 50 mL of medium with the same composition and cultured until the OD 600 was 0.6-0.8, centrifuged at 5000 rpm for 5 min at 4°C, and then the bacterial cells were resuspended in the transfection culture medium (basic medium + 1.0 μmol / L 2,4-D + 100 μmol / L acetosyringone) to make the OD 600 of the bacterial solution 0.2-0.5, which was used for genetic transformation of maize.

[0063] The immature embryos of maize inbred lines were taken 9-12 days after self-pollination, inoculated on induction medium containing 4.1 μmol / L 2,4-D for 2 days, and then transferred to liquid transfection medium containing Agrobacterium LBA4404 (carrying the transformation plasmid, collected in the logarithmic growth phase) for 8-12 min, the supernatant was discarded, and the immature embryos were transferred to induction medium and cultured in the dark at 24°C for 2-3 days. When Agrobacterium colonies appeared around the material, the immature embryos were transferred to antibiotic medium (induction medium + 200 mg / L cefotaxime) for culture, usually for 2-3 weeks, with subculture once in between. The immature embryos produced embryogenic calli at this stage, and then the embryogenic calli with good antibiotic resistance were selected and transferred to selection medium (induction medium + 8 mg / ml glufosinate) for screening, usually for 2-3 generations, one week per generation. The surviving calli were transferred to induction medium for recovery culture for 1-2 generations, and then the well-growing calli were selected and transferred to differentiation medium (induction medium + 0.2 mg / L 6-benzylaminopurine) for growth, and small seedlings were produced after 1-2 weeks. The latter were transferred to rooting medium to induce the roots of the small seedlings. The regenerated plants with well-developed root systems were transplanted into paper cups filled with seedling substrate and placed in a greenhouse for growth under natural light to adapt to the surrounding environment. Then the seedlings were moved to large pots for growth, self-pollination under a bag, and seed harvesting.

[0064] The transgenic plants were determined by herbicide (selective agent) resistance screening and PCR detection, and verified by quantitative RT-PCR (qRT-PCR) method. The specific operation is as follows: first, the leaves of seedlings at 3-4 leaf stage were smeared with 0.125% glufosinate (selective agent) aqueous solution, and the herbicide-sensitive plants were eliminated after 6-7 days. The DNA of the plants with good resistance was extracted for PCR detection. The primers were designed according to the sequences of the screening marker gene and the target genes ZmUPF3L1 and ZmUPF3L2, and PCR detection was carried out respectively. The PCR primers of the selection marker gene eBar are: 35S-Bar-F: TGACGCACAATCCCACTATCC, 35S-Bar-R: AACCCACGTCATGCCAGTTCC; the length of the amplified fragment is 609 bp. The primers used for detecting ZmUPF3L1 and ZmUPF3L2 genes are Pubi-F: GCCCTGCCTTCATACGCTA, and the other is the primer ZmUPF3L1-fbR or ZmUPF3L2-fbR used in the construction of the transformation plasmid, and the amplified fragment contains the promoter fragment and the coding frame, so as to exclude the interference of endogenous genes.

[0065] PCR reaction system: 2xM5 Hiper plus Taq HiFi PCR mix (with blue dye) 5 μL, primer 35S-Bar-F / Pubi-F (10 μM) 0.4 μL, primer 35S-Bar-R / ZmUPF3L1-fbR / ZmUPF3L2-fbR (10 μM) 0.4 μL, DMSO 1 μL, DNA template 100-200 ng, ddH2O supplement.

[0066] PCR reaction conditions: 95°C pre-denaturation for 5 min; 95°C denaturation for 20 s, 60°C annealing for 30 s, 68°C extension for 40 s (eBar) or 60 s (ZmUPF3L1 or ZmUPF3L2), a total of 36 cycles; 68°C extension for 7 min.

[0067] The plants of the progeny of the transformed plants in which the target gene bands are amplified are recognized as transgenic plants, and the Lqt11 plants (recipient material, i.e. negative control) without transgene do not appear the same size bands. The DNA of the leaves of the transgenic plants is extracted for qRT-PCR detection, and the plants with single copy insertion of transgene are selected for self-reproduction to obtain overexpression plants ZmUPF3L1 OE-2, ZmUPF3L1 OE-7, ZmUPF3L2 OE-6 and ZmUPF3L2 OE-15. The progeny thereof are used for heat tolerance detection and trait analysis.

[0068] Example 2 Construction of maize ZmUPF3L1 and ZmUPF3L2 gene editing plants 1. Construction of ZmUPF3L1 and ZmUPF3L2 gene editing vectors In the embodiments of the present application, the sequences of maize ZmUPF3L1 and ZmUPF3L2 were queried from Maize GDB (website: https: / / www.maizegdb.org / ), the target sequence was established by using software CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / cgibin / CRISPR2 / SCORE), which was located in the 5' end exon region, and the corresponding sgRNA was designed. The sgRNAs for ZmUPF3L1 were sgRNA1 (CCTAAATTTCAAGCACCCAGAGG, SEQ ID NO. 3) and sgRNA2 (GGATGTTGTTGAGTTTGCTGAGG, SEQ ID NO. 4). The sgRNAs for ZmUPF3L2 were sgRNA3 (CCTTAATTTCAAGCGCCCCGAGG, SEQ ID NO. 5) and sgRNA4 (GGATGTTGTTGAGTTCGCTGAGG, SEQ ID NO. 6).

[0069] The construction of the gene editing vector was performed according to the operation instruction of the expression vector pG3GB411 (pG3GB411-BWM, MolecularCloud, Cat. No.: MC_0068763).

[0070] The primers for synthesizing and amplifying the sgRNA fragment were synthesized and the amplification reaction was performed by using the plasmid pCBC-MT1T2.2 (MolecularCloud, Cat. No.: MC_0068767) as the template. The primers used for amplifying the ZmUPF3L1 editing vector fragment were as follows: ZmUPF3L1-BsF: ATATTATGGTCTCTGGCGCTAAATTTCAAGCACCCAGGTT; ZmUPF3L1-Fs0: GCTAAATTTCAAGCACCCAGGTTTTAGAGCTAGAAATAGC; ZmUPF3L1-Rs0: AACCAGCAAACTCAACAACATCCGCTTCTTGGTGCC; ZmUPF3L1-BsR: ATTTATTGGTCTCTAAACCAGCAAACTCAACAACATCC).

[0071] The primers used for amplifying the fragment of ZmUPF3L2 editing vector are as follows: ZmUPF3L2-BsF; ATATTATGGTCTCTGGCGCTTAATTTCAAGCGCCCCGGTT; ZmUPF3L2-Fs0: GCTTAATTTCAAGCGCCCCGGTTTTAGAGCTAGAAATAGC; ZmUPF3L2-Rs0: AACCAGCGAACTCAACAACATCCGCTTCTTGGTGCC; ZmUPF3L2-BsR: ATTTATTGGTCTCTAAACCAGCGA ACTCAACAACATCC.

[0072] Reaction system: 10 x KOD plus Buffer 5 μL, 2 mM dNTPs 4 μL, 25 mM MgSO4 4 μL, ZmUPF3L1-BsF / ZmUPF3L2-BsF (20 μM) 1 μL, ZmUPF3L1-BsR / ZmUPF3L2-BsR (20 μM) 1 μL, ZmUPF3L1-Fs0 / ZmUPF3L2-Fs0 (1 μM) 1 μL, ZmUPF3L1-Rs0 / ZmUPF3L2-Rs0 (1 μM) 1 μL, pCBC-MT1T2.2 (10 ng / μl) 1 μL, KOD-Plus-Neo 1 μL, ddH2O 32 μL. PCR reaction: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 15 s, 60 °C annealing for 30 s, 68 °C extension for 30 s, for a total of 36 cycles; 68 °C extension for 7 min. The universal PCR product recovery kit was used to recover the target product. The recovered fragment and the vector plasmid pG3GB411-BWM (Molecular Cloud, Cat. No.: MC_0068763) were respectively digested with Bsa I enzyme, and then connected with T4 DNA Ligase to recombine into a transformation vector. The T-DNA region of pG3GB411-BWM contains an expression frame of sgRNA and a herbicide glufosinate resistance gene eBar.

[0073] Connection system: pG3GB411-BWM (~100 ng / μL) 2 μL, PCR fragment (~25 ng / μL) 2 μL, 10 x T4 DNA Ligase Buffer 1.5 μL, T4 DNA Ligase 1 μL, BsaI 1 μL, 10×BSA 1.5 μL, ddH2O 6 μL.

[0074] Connection reaction conditions: 37 ℃ 5 h, 50 ℃ 5 min, 80 ℃ 10 min. The recombinant plasmid was used to transform the E. coli competent cells, and the clones containing the recombinants were selected. The correct plasmid was transformed into Agrobacterium tumefaciens LBA4404 for genetic transformation of maize. Sma I + Kpn I The recombinant plasmid was identified by double enzyme digestion to determine the correctness and integrity, and the correct plasmid was transformed into Agrobacterium tumefaciens LBA4404 for genetic transformation of maize.

[0075] 2. Obtain ZmUPF3L1 or / and ZmUPF3L2 gene editing plants.

[0076] The maize inbred line plant was taken to the fruit ear in aseptic conditions 9-15 days after self-pollination, and the about 1.0-1.5 mm size of young embryo was inoculated on the induction medium for culture, or the culture was directly used for genetic transformation after 2 days of culture, or the crisp and light yellow embryogenic callus was obtained after about 14 days of culture, and the latter was subcultured every 10-15 days. The embryogenic callus can be used as a receptor tissue for genetic transformation. In genetic transformation, the young embryo or embryogenic callus cultured for 2 days was transferred into a transfection medium containing Agrobacterium (carrying a transformation plasmid), and after 8-12 min of standing, the liquid attached to the young embryo or callus was absorbed with filter paper, and then transferred to the induction medium for dark culture at 26 ℃ for 2-3 days. When the Agrobacterium colonies appeared around the material, the young embryo or callus block was transferred to the antibiotic medium for culture, generally for 2-3 weeks, and subcultured once in between. Then the embryogenic callus with good antibiotic inhibition was selected and transferred to the selection medium for screening, generally for 2-3 generations, and 1 week for each generation. In order to remove the MR gene (morphogenesis induction gene) provided by the pG3GB411-BWM plasmid in the maize transformed cells, the callus was dried to induce site-specific recombination. That is, the callus was transferred to sterile filter paper and dried at 26 ℃ for 2-3 days, and then the callus was transferred to the induction medium for recovery culture for 1-2 generations. The callus with good recovery was selected and transferred to the differentiation medium to grow under the condition of 16 h (light) / 8 h (dark), and small seedlings were generated after 1-2 weeks of differentiation. The latter was transferred to the rooting medium to induce the roots of the small seedlings. The regenerated plants with developed root system were transplanted into paper cups filled with seedling substrate and placed in a greenhouse to grow under natural light to adapt to the surrounding environment. After one week, the seedlings were moved to large pots, and when they grew to 10 cm high, they were planted in a greenhouse or moved to a field to grow.

[0077] The transgenic plants that survived transplanting were first smeared with a 0.125% aqueous solution of glufosinate (selective agent) on the leaves of the seedlings, and 6-8 days after smearing, the plants sensitive to herbicides were eliminated. The plants with better resistance were extracted for leaf DNA for PCR detection. Primers were designed according to the sequences of the selection marker gene and the target genes ZmUPF3L1 and ZmUPF3L2 for PCR detection. The PCR primers of the selection marker gene eBar were 35S-eBar-F (TGACGCACAATCCCACTATCC) and 35S-eBar-R (AACCCACGTCATGCCAGTTCC), and the length of the amplified fragment was 609 bp. In addition, in the detection of gene edited plants, the Cas9 gene (which has been optimized with maize preferred codons) was also detected, and the PCR detection primers were Cas-711-F (GGCCGCGATATGTATGTGGA) and Cas-711-R (GCCATTGGCCAGAGTGATCT), and the length of the amplified fragment was 711 bp.

[0078] Reaction system: 2xM5 Hiper plus Taq HiFi PCR mix (with blue dye) 5 μL, Primer F (10 μM) 0.4 μL, Primer R (10 μM) 0.4 μL, DMSO 1 μL, DNA Template 100-200 ng, ddH2O to supplement.

[0079] PCR reaction conditions: 95°C pre-denaturation for 5 min; 95°C denaturation for 20 s, 60°C annealing for 30 s, 68°C extension for 40 s, a total of 36 cycles; 68°C extension for 7 min. These PCR positive plants were preliminarily determined to be transgenic plants. Then the leaf DNA of the latter was extracted for qRT-PCR detection to determine the number of transgenic copies, and the transgenic plants with single or 2-copy insertions were self-crossed for propagation.

[0080] T1 transgenic plants were selected for target site PCR amplification to detect editing events. The specific steps involved extracting genomic DNA, amplifying the target site and flanking sequences, and comparing the sequencing results of the amplified fragment with those of the wild-type (transformed recipient) plant to determine whether editing had occurred and the type of editing. Primers used to amplify the genome editing target site region were: ZmUPF3L1 / ZmUPF3L2-cF (ATCAATAGCGAGCGATCCCC, located in the gene promoter region) and ZmUPF3L1 / ZmUPF3L2-cR (AAGCAGGTGCGATAGCTGTT, located in the first intron region of the gene). PCR reaction conditions included initial denaturation at 95°C for 5 minutes, followed by 36 cycles of denaturation at 95°C for 20 seconds, annealing at 60°C for 30 seconds, and extension at 68°C for 40 seconds, followed by extension at 68°C for 7 minutes. The amplified product (the genome editing target site and its surrounding sequences) was sent to the company for sequencing to identify editing events. In some transgenic plants, ZmUPF3L1 or ZmUPF3L2 exhibited different types of editing, including ZmUPF3L1 KO-6#, ZmUPF3L1 KO-8#, ZmUPF3L2 KO-9#, and ZmUPF3L1-KO-11#. These editing mutations caused frameshift mutations and premature terminations, altering protein sequence and structure. Most of these deletions were caused by base deletions near the gRNA site. ZmUPF3L1-KO-6# and ZmUPF3L2-KO-9# plants, respectively, exhibited 2 and 4 base deletions following the gRNA (corresponding to the first exon of the gene), causing frameshift mutations and premature terminations, altering protein sequence and structure. Furthermore, homozygosity was achieved at the editing site in the T1 generation. This effectively resulted in maize lines with edited ZmUPF3L1 or ZmUPF3L2 genes.

[0081] Experimental Example 1: Heat tolerance testing of ZmUPF3L1 and ZmUPF3L2 overexpressing plants and gene-edited plants Leaf RNA was extracted, and the expression levels of ZmUPF3L1 and ZmUPF3L2 genes were measured by qRT-PCR. Relative quantification was performed using the maize Ubiquitin 1 gene as an internal standard. In the overexpression lines, the expression levels of ZmUPF3L1 and ZmUPF3L2 genes were 2.1-5.53 times higher than those in the control plants, indicating that the transgene was expressed at high levels in these lines.

[0082] The heat tolerance detection of transgenic overexpression plants and gene editing plants was carried out in stages, and the corn lethal experiment used 45°C heat shock treatment. Under normal growth conditions, the 3-leaf transgenic plants, 3-leaf gene editing plants and receptor inbred line (non-transgenic control) plants had no obvious differences in phenotype, and the biomass of the plants was determined, and it was found that the ZmUPF3L1 or ZmUPF3L2 gene overexpression plants grew normally, and the ZmUPF3L1 or ZmUPF3L2 gene editing plants grew slowly. When the plants grew to 10-14 leaf stage, the gene editing plants and the receptor inbred line plants showed differences in phenotype, and grew weakly.

[0083] The transgenic lines with consistent growth at the seedling stage were selected for stress resistance determination, and the ion leakage rate and malondialdehyde content of corn leaves were determined after 45°C treatment for different times. The seeds were derived from ZmUPF3L1 or ZmUPF3L2 gene overexpression plants, ZmUPF3L1 or ZmUPF3L2 gene editing plants and wild type plants.

[0084] In the heat tolerance detection of corn seedlings, the seeds were sown in the substrate of vermiculite (4.5 cm thick), and after germination, the seedlings were grown to two-leaf-one-heart stage under the growth environment (temperature 25°C (day) / 20°C (night), light 16 / 8 hours (day / night), light intensity 3000 lx). Quantitative watering was performed every day during germination to ensure normal germination. One day before heat treatment, watering was stopped, and the incubator temperature was raised to 45°C in advance to ensure consistent treatment conditions. The treatment temperature was 45°C, the relative humidity was 60-65%, and the light intensity was 3000 lx. Under light conditions, the plants were treated at 45°C for 0, 6 h, 12 h and 24 h, respectively, and then recovered for 24 h. Leaf conditions were observed at different time points, and samples were taken for physiological index determination. The treatment schematic is shown in Figure 1 A.

[0085] The results are shown in Figure 1As shown in FIG. 6, the ZmUPF3L1 or ZmUPF3L2 gene overexpression plants showed significantly higher heat tolerance than the wild type plants. Although wilting symptoms appeared at the leaf tip during the heat treatment period, the wilting degree was lower than that of the WT plants. If the plants were transferred to normal growth conditions for 24 h after 24 h of heat stress treatment, the upper end of the WT plant leaves showed severe wilting symptoms, while the overexpression lines showed little difference, only the leaf tip wilted, showing more heat tolerance than the wild type plants; the ZmUPF3L1 or ZmUPF3L2 gene edited plants showed significantly lower heat tolerance than the wild type plants, and the leaf tip wilted for a shorter time during the heat treatment, and the wilting degree was significantly more severe than that of the wild type plants at 12 h of heat treatment. If the plants were transferred to normal growth conditions for 24 h after heat stress treatment, the plant leaves of the edited lines ZmUPF3L1-KO-6# and ZmUPF3L2-KO-9# plants showed severe wilting symptoms, and the ZmUPF3L2-KO-9# leaf wilting was more severe, and the leaf edge also showed obvious water loss symptoms.

[0086] Heat stress can lead to the production of reactive oxygen species (ROS) in plant tissues. It is generally believed that ROS, such as hydrogen peroxide (H2O2), can play an important signaling role in stress response, but controlling ROS levels is crucial to ensure proper signaling and reduce heat stress damage. To verify the heat tolerance of the overexpression plants, the leaves treated at 45°C for 0, 6, and 8 h under light conditions were used for DAB (dimethylbenzidine) and NBT (nitro blue tetrazolium) staining. The results showed that there was no significant difference in H2O2 and superoxide anion (O 2- ) staining and H2O2 accumulation in the leaves of the gene overexpression corn plants, gene edited plants, and wild type plants under normal growth conditions; after heat stress treatment, the H2O2 and O 2- ) staining was darker, and the ROS concentration increased significantly with the extension of the heat stress time. In comparison, the change in the overexpression plant leaves was smaller, and the gene edited corn was significantly darker than the wild type, showing higher cell oxidative damage than the wild type. Knocking out ZmUPF3L1 or ZmUPF3L2 can cause a significant increase in ROS levels in corn cells under heat stress, thereby reducing the heat tolerance of corn plants.

[0087] The accumulation of malondialdehyde (MDA) is generally considered an important indicator of membrane lipid peroxidation. Heat stress often causes MDA accumulation in plant cells, severely damaging cell membranes. Under high temperature stress, plant chlorophyll content (measured using the spectrophotometric method known as the Arnon method (1949), see Li Dexiao et al., Chinese Agricultural Science Bulletin, 2005, DOI: 10.3969 / j.issn.1000-6850.-2005.06.044) often decreases, leading to a decrease in photosynthetic efficiency, slowed or stopped plant growth, or severely inhibited reproductive growth. This significantly reduces or even completely eliminates crop yields. The results of this example show that under normal growth conditions, there was no significant difference in the malondialdehyde content and cell membrane ion leakage rate of the overexpression strain, gene-edited strain, and recipient inbred line. However, as the heat stress time prolonged, the malondialdehyde content and cell membrane ion leakage rate increased significantly, among which the increase in the overexpression strain was smaller, and the chlorophyll content decreased less ( Figure 1 C, 1D). After 6 or 12 hours of heat stress treatment, MDA content in ZmUPF3L1 KO-6#, ZmUPF3L1-KO-8#, ZmUPF3L2- KO-9#, and ZmUPF3L2- KO-11# plants increased significantly, with highly significant differences compared to wild-type plants treated under the same conditions. After 24 hours of recovery from heat stress, MDA content decreased in all accessions. These results suggest that knockout of ZmUPF3L1 and ZmUPF3L2 enhances membrane lipid peroxidation during heat stress, weakens cell membrane stability, and supports heat-induced cellular oxidative damage. ZmUPF3L1 and ZmUPF3L2 are involved in regulating heat tolerance in maize plants. This suggests that the ZmUPF3L1 and ZmUPF3L2 genes play an important role in maize heat tolerance, and their functional loss leads to reduced heat tolerance.

[0088] Under high temperature stress, the photosynthetic efficiency of plants decreases, and the growth slows down or stops. The Arnon method (1949) was used to determine the chlorophyll content of corn leaves of different strains. Under normal growth conditions, the chlorophyll b content of the gene editing material and the overexpression strain was significantly different from that of the wild type, regardless of the editing strain of ZmUPF3L1 and ZmUPF3L2. After 6 h of heat stress treatment, the chlorophyll b content of ZmUPF3L1 or ZmUPF3L2-edited material decreased significantly, and was significantly different from that of the wild type under the same treatment conditions. After 24 h of recovery after treatment, the chlorophyll b content in all materials recovered. These results show that ZmUPF3L1 or ZmUPF3L2 gene knockout corn plants will lose more chlorophyll b under heat stress, which is associated with reduced heat tolerance. However, the change in chlorophyll a content in overexpression corn plants before and after heat treatment was relatively small, although significant differences between the gene editing plants and the wild type control appeared at 6 h of heat treatment and 24 h after heat treatment, and the content of the editing plants increased to some extent during the recovery period, but according to the change trend, it seems to be related to the heat tolerance of the plants. Figure 1 ).

[0089] The above results show that overexpression of ZmUPF3L1 and ZmUPF3L2 genes can improve the heat tolerance of corn at the seedling stage.

[0090] Under normal growth conditions, no obvious phenotype difference was observed between ZmUPF3L1 and ZmUPF3L2 overexpression plants and wild type plants at seedling stage. When the plants grew to 12-16 leaf stage, phenotype difference was observed between overexpression plants and wild type plants, the former grew stronger. In order to confirm this phenomenon, corns were sowed in greenhouse, overexpression lines and control (WT) were planted in different areas, with 3 repeats. When the plants grew to 9-11 leaf stage or 14-16 leaf stage, they were given high temperature treatment for 7 days, then returned to normal growth conditions until ear maturation, and the same line plants were pollinated and seeded. During high temperature treatment, natural light was used, light time was 14 h / d, temperature was 20-24℃ from 22 o'clock to 6 o'clock of next day, temperature rose from 20-24℃ to about 37℃ from 6-8 o'clock in the morning, maintained at 38-39℃ between 9-17 o'clock, maintained at 36-37℃ between 17-19 o'clock, and decreased to 22-24℃ between 19-22 o'clock. During high temperature treatment, leaves of wild type plants slightly wilted between 11-17 o'clock, leaves started to turn yellow after 4 days of treatment, and new leaves grew slowly; overexpression plants were less harmed, leaves started to turn yellow after 6 days of treatment, and new leaves grew slowly. High temperature treatment caused poor development of male and female ears, and significantly increased the proportion of sterile pollen. Changes of cell membrane ion leakage rate, malondialdehyde content, chlorophyll content and photosynthesis intensity of corn leaves were measured after 3 days and 5 days of high temperature treatment, and it was found that cell membrane ion leakage rate and malondialdehyde content of leaves of ZmUPF3L1 or ZmUPF3L2 overexpression plants were significantly lower than those of wild type plants treated in the same way, while chlorophyll content and photosynthesis intensity were higher than those of wild type plants treated in the same way. These results further proved that plants overexpressing ZmUPF3L1 or ZmUPF3L2 gene had significantly improved heat tolerance. Comparison of grain yield of single corn plant after heat stress treatment at maturation stage showed that overexpression plants increased by 8-18% compared with wild type plants. The above results showed that overexpression of ZmUPF3L1 or ZmUPF3L2 could improve the heat tolerance of corn plants and increase the grain yield of corns experiencing heat stress environment.

[0091] To understand the effect of ZmUPF3L1 and ZmUPF3L2 genes on heat tolerance of adult maize plants, the maize was sowed in the greenhouse, and the gene edited lines and wild type (WT) were planted in different zones, with 3 replicates. The plants were grown under normal growth conditions to 9-11 leaf stage or 13-15 leaf stage, and then were given high temperature treatment for 7 days, and then were grown to ear maturity under normal growth conditions. The plants of the same line were pollinated and seeded. During the high temperature treatment, the natural light was used, with light time of 14 h / day, and the temperature was 20-24°C between 22 and next 6 o'clock, rising from 20-24°C to 37°C between 6-8 o'clock in the morning, maintaining at 38-39°C between 9-17 o'clock in the day, maintaining at 36-37°C between 17-19 o'clock in the evening, and dropping to 22-24°C between 19-22 o'clock. During the high temperature treatment, the gene edited plants were obviously damaged; the leaves of the wild type plants were slightly wilted between 11-17 o'clock, and the leaves started to turn yellow after 3 days of treatment, and the new leaves grew slowly. The high temperature treatment affected the subsequent growth and development of the plants, and the tassel development became poor, and the proportion of sterile pollen increased significantly. Among them, the gene edited plants were severely damaged, about half of the pollen was sterile, and the ear was small. Comparing the grain yield per plant, the average yield per plant of the two gene edited lines was reduced by 33% and 38% compared with the wild type plants. That is, the gene edited lines showed significantly reduced heat tolerance.

[0092] Test Example 2 Drought tolerance detection of ZmUPF3L1 and ZmUPF3L2 overexpression plants The T2 generation transgenic plants with stable heredity and transgenic receptor materials with positive PCR were selected for trait analysis and target gene expression detection. Under normal cultivation conditions, the plant morphological characteristics of the 6 transgenic overexpression lines were not obviously different from the wild type control material, and no phenomenon of slow plant growth was found. The leaf RNA was extracted, the expression intensity of ZmUPF3L1 and ZmUPF3L2 genes was detected by qRT-PCR, and the maize Ubiquitin 1 gene was used as an internal standard gene for relative quantification. In these overexpression lines, the expression intensity of ZmUPF3L1 and ZmUPF3L2 genes was 2.1-5.53 times that of the control plants, that is, the transgene could be expressed at a high level in these lines.

[0093] The drought tolerance of transgenic overexpression corn was detected in stages, and the corn seedling stage was a lethal experiment. Under normal growth conditions, the biomass of transgenic plants and recipient inbred lines (non-transgenic controls) at the 3-leaf stage was determined, and the growth rate of ZmUPF3L1 or ZmUPF3L2 gene overexpression plants was similar to that of the recipient inbred line. The specific steps are as follows: seeds from self-crossing were uniformly sown in the seedling substrate (4.5 cm thick), and after watering, the seedlings were placed in suitable growth conditions (temperature 25℃ (day) / 20℃ (night), light 16 / 8 hours (day / night), light intensity 8000 lx) to grow to the three-leaf stage. Select transgenic lines with consistent growth for drought resistance determination, i.e. stop watering after watering the plants once, and let the substrate water content continue to decrease, and observe the changes in the wilting degree of the plants. Drought treatment was set up with 6 replicates, and each replicate had 5 plants. During the drought treatment, the pot positions were randomly exchanged to ensure that the plants received consistent light and ventilation conditions. Samples were taken on days 0, 1, 3, 5, 7 and 3 days after resuming normal watering, and physiological indicators such as leaf relative water content, cell membrane ion leakage rate and malondialdehyde content were determined.

[0094] The results of the determination are shown in Table 1. Figure 2 As shown in Table 1, ZmUPF3L1 or ZmUPF3L2 gene overexpression plants showed significantly higher drought tolerance than wild type plants, and although leaf wilting symptoms appeared during the drought treatment period, the wilting degree was lower than that of WT plants. When treated for 7 days, most of the control plants were severely damaged, but the overexpression plants could still maintain basic life conditions, showing more drought resistance than wild type plants. Figure 2 After 10 days of treatment, the ZmUPF3L1 or ZmUPF3L2 gene overexpression plants could recover quickly, and the plant survival rate was much higher than that of wild type plants. ZmUPF3L1 and ZmUPF3L2 gene edited plants were more severely damaged than overexpression and control lines, with specific manifestations of early wilting, severe wilting and a high proportion of plants that could not recover after resuming watering. Leaf relative water content and solute potential are two indicative indicators of plant damage and resistance under drought stress. Measurement of corn lines at different times of drought stress showed that ZmUPF3L1 and ZmUPF3L2 overexpression plants had a higher relative water content, while edited plants had a lower relative water content than control plants and overexpression plants, indicating a higher degree of leaf wilting and cell damage. Under normal conditions, the solute potential of leaves of different plants did not differ much. Under drought stress conditions, all lines showed the same downward trend, which was a response of corn plants to drought stress. The decrease in solute potential of corn leaves under drought stress is beneficial to maintaining water absorption and leaf water retention in corn plants. Under the same stress conditions, overexpression, gene editing and wild type control lines were compared, and it was found that the difference reached a significant level on the 3rd day of drought stress.Figure 2 C). It is illustrated that overexpression lines accumulate more solutes under moderate drought stress, resulting in more water uptake by cells to maintain cell turgor pressure and plant morphology, while gene editing lines show drought sensitivity.

[0095] Under normal growth conditions, ZmUPF3L1 and ZmUPF3L2 overexpression plants and wild type plants do not show obvious phenotypic differences at the seedling stage. When the plants grow to 12-16 leaf stage, overexpression plants grow more robust. In order to determine this phenomenon, corn will be sown in large flower pots, set 6 times, placed in natural conditions (May-July, Jimo, Qingdao) growth. When the plants grow to 9-11 leaf stage under normal watering conditions, give 7 days of drought treatment, and then restore to normal growth conditions to grow to ear maturity, the same strain of plants open pollination seed. During the drought treatment, the natural light is maintained. In the early stage of drought treatment, the leaves of wild type plants are slightly wilted at 11-17 o'clock, and the leaves start to turn yellow after 3 days of treatment, and the new leaves grow slowly; overexpression plants are less affected, and the leaves start to turn yellow and dry after 5 days of treatment, and the new leaves grow slowly. Drought treatment causes uneven development of male and female ears, and the interval between male and female increases significantly. The changes of cell membrane ion leakage rate, malondialdehyde content, chlorophyll content and photosynthesis intensity of corn leaves treated for 3 days and 5 days were measured, respectively, and it was found that the cell membrane ion leakage rate and malondialdehyde content of the leaves of ZmUPF3L1 or ZmUPF3L2 overexpression plants were significantly lower than those of the same treatment wild type plants, and the relative water content, chlorophyll content and photosynthesis intensity were higher than those of the same treatment wild type control, while the gene editing plants showed the opposite trend to overexpression. It is concluded that the plants overexpressing ZmUPF3L1 or ZmUPF3L2 genes have significantly improved drought resistance under drought stress treatment. After the ear matures, the grain yield per plant of overexpression plants is 6-21% higher than that of wild type plants. The above results show that overexpression of ZmUPF3L1 or ZmUPF3L2 can improve the drought resistance of corn plants and increase the yield of plants under drought stress.

[0096] The above results show that increasing the expression level of ZmUPF3L1 or ZmUPF3L2 gene in corn significantly improves the drought resistance of corn plants, and makes corn have stronger drought resistance in water-deficient environment.

[0097] Test Example 3 Determination of plant height and stem length of ZmUPF3L1 and ZmUPF3L2 edited plants The genetically stable T2 generation gene editing plants and transgenic receptor materials prepared in Example 2 were selected for trait analysis and target gene expression detection. Under normal cultivation conditions, the plant morphological characteristics of the two gene editing lines were not significantly different from the wild type control material, but the height of the plants was significantly lower than that of the control material (P<0.05). Figure 3). The RNA of leaves was extracted, and the expression intensity of ZmUPF3L1 and ZmUPF3L2 genes was detected by qRT-PCR, and the relative quantification was carried out with the Ubiquitin 1 gene as an internal standard gene. In these gene editing lines, the transcription of ZmUPF3L1 and ZmUPF3L2 was not detected, proving that the knockout of the target gene was successfully achieved by gene editing.

[0098] The detection of the plant height and stem length of the edited corn plants was carried out in stages, in which the corn seedling stage was at the five-leaf stage. Under normal growth conditions, the plant height and leaf number of the 5-leaf stage gene editing plants and the receptor inbred line (non-transgenic control) plants were determined, and it was found that the growth period of the ZmUPF3L1 or ZmUPF3L2 gene editing plants was similar to that of the receptor inbred line, but the overall plant height was significantly lower than that of the receptor inbred line (P < 0.05). Figure 3 Figure 3 The plant height of the gene editing line was reduced by 15%-21% (P < 0.05) relative to the wild type control, and the aboveground dry weight also had different degrees of reduction, but the development period and leaf number did not show significant differences. The slow relative growth of the aboveground part in the seedling stage is helpful for the development of the root system and the utilization of soil water and fertilizer, and has significant meaning for preventing plant overgrowth and even lodging. The specific steps are as follows: the seeds of self-crossing and seed setting were uniformly sown in the seedling substrate (4.5 cm thick), and then germinated after watering, and the seedlings were placed in the suitable growth environment (temperature 25℃ (day) / 20℃ (night), light 16 / 8 hours (day / night), light intensity 8000lx) to grow to the five-leaf stage. The gene editing lines with relatively consistent growth were selected for plant height determination. The experiment was set with 6 repetitions, and each repetition had 5 plants. The flowerpot positions were randomly exchanged during the plant growth to ensure that the plants received consistent light and ventilation conditions. The flowering period was at the silking leaf stage.

[0099] Under normal field growth conditions, the plants were grown under natural conditions (May-July, Jimo, Qingdao), and the plant height, ear height, internode length, and leaf number of the gene editing plants and the receptor inbred line (non-transgenic control) plants were determined. The ear shape and yield were determined at the harvest period. In order to determine the dwarfing phenomenon of the edited plants and its possible effects, corn was sown in the field (May-July, Jimo, Qingdao), and 3 repetitions were set for growth and morphological comparison. When the plants grew normally to the silking stage, the plant height, ear height, internode length, and leaf number were counted, and then the plants continued to grow until the ear matured, and the same strain plants were pollinated and seeded, and the ear shape and yield were determined at the harvest period. The determination results of the plant height, ear height, internode length, and leaf number showed that the edited plants had a significant effect on the stem length of the plants, especially the stem length below the ear. The determination results are as follows: Figure 3 ​As shown, under normal growth conditions, the growth period of ZmUPF3L1 and ZmUPF3L2 gene edited plants and wild type plants is similar to that of the receptor inbred line, but the overall plant height is significantly lower than that of the receptor inbred line, the plant height of the edited strain is 20%-30.28% of the control material, and the ear height is reduced by 15%-21.2% Figure 3 ), and the resistance to lodging under strong wind and heavy rain is significantly higher than that of the control plants. Specifically, the stem length below the ear is shortened by 15-20% compared with the control plants, forming a compact, semi-dwarf plant type. Under field planting conditions, lodging caused by strong wind or heavy rain is significantly resistant. After the ear matures, the single plant grain yield of the edited plants is not significantly different from that of the wild type Figure 3 ). The above results show that ZmUPF3L1 or ZmUPF3L2 gene editing can reduce the plant height, ear height and internode length of corn plants, form a compact, semi-dwarf plant type, and has application value in compact corn and lodging-resistant corn breeding.

[0100] The above results show that knocking out the ZmUPF3L1 or ZmUPF3L2 gene of corn significantly improves the plant shape, reduces the plant height and ear height, has application value in semi-dwarf and compact corn breeding, and improves the lodging resistance of corn plants.

[0101] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. Use of a maize nonsense-mediated mRNA degradation regulatory factor gene or a biological material comprising a maize nonsense-mediated mRNA degradation regulatory factor gene in at least one of the following: (a1) Application in reducing plant strain height; (a2) Application in improving heat tolerance of plants; (a3) Application in improving plant drought tolerance; (a4) Application in increasing plant lodging resistance; (a5) Application in plant breeding; The nucleotide sequence of the maize nonsense-mediated mRNA degradation regulatory factor gene is shown in SEQ ID NO. 1-2.

2. The use according to claim 1, characterized in that The plants include corn, sorghum, barley, and rice.

3. The use according to claim 1, characterized in that The application refers to obtaining transgenic plants by overexpressing or editing frameshift genes in corn to change the plant height, heat resistance, drought resistance and lodging resistance.

4. The use according to claim 1, wherein The biological material containing the maize nonsense-mediated mRNA degradation regulatory factor gene includes a recombinant vector, a recombinant microorganism or an expression cassette.

5. The use according to claim 1, characterized in that In the method of improving the heat resistance of corn, the temperature is 34-45° C.; in the method of improving the drought resistance of corn, the relative water content of the rhizosphere soil is less than 16%.

6. A preparation, characterized in that Including at least one of the following (c1)-(c5): (c1) a nucleic acid molecule as shown in SEQ ID NO. 1-2; (c2) an expression vector comprising the nucleic acid molecule described in (b1); (c3) a recombinant host comprising (b2); (c4) a promoter or enhancer that increases expression of a maize nonsense-mediated mRNA degradation regulator gene; (c5) Inducers that promote expression of the gene regulating factor of nonsense-mediated mRNA degradation in maize.

7. A method for reducing corn plant height, characterized in that: The method comprises the steps of inhibiting or reducing the expression of a maize nonsense-mediated mRNA degradation regulatory factor gene in a recipient maize to obtain maize having a plant height lower than that of the recipient maize. The recipient maize contains the maize nonsense-mediated mRNA degradation regulatory factor gene, and the nucleotide sequence of the maize nonsense-mediated mRNA degradation regulatory factor gene is shown in SEQ ID NO.1-2.

8. A method for improving heat resistance and drought resistance of corn, characterized in that: The method comprises the steps of increasing the expression of a maize nonsense-mediated mRNA degradation regulatory factor gene in a recipient maize to obtain a maize plant height lower than that of the recipient maize. The recipient maize contains the maize nonsense-mediated mRNA degradation regulatory factor gene, and the nucleotide sequence of the maize nonsense-mediated mRNA degradation regulatory factor gene is shown in SEQ ID NO.1-2.

9. A method for improving corn lodging resistance, characterized in that: The method comprises inhibiting or reducing the expression of a maize nonsense-mediated mRNA degradation regulatory factor gene in a recipient maize, wherein the recipient maize contains the maize nonsense-mediated mRNA degradation regulatory factor gene, and the nucleotide sequence of the maize nonsense-mediated mRNA degradation regulatory factor gene is shown in SEQ ID NO.1-2.

10. The method according to any one of claims 8 to 9, characterized in that The method comprises: constructing a vector containing a maize nonsense-mediated mRNA degradation regulatory factor gene, transforming the vector into Agrobacterium; and infecting plant cells or explants with the Agrobacterium.

Images