Molecular marker influencing chicken daily laying time character and genetic typing detection method and application thereof

Through whole-genome association analysis and resequencing, a 959 bp deletion mutation on the chicken reference genome was screened out, and specific primers were designed for genotyping detection, which solved the problem of inaccurate selection of daily egg-laying time of chickens in breeding, and achieved the advancement of daily egg-laying time of chickens and improved stability of egg-laying performance.

CN120796489APending Publication Date: 2025-10-17HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510908166.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-02
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently screen out insertion/deletion molecular markers that affect the daily egg-laying time of chickens, resulting in inaccurate breeding selection and affecting the egg-laying performance and stability of chickens.

Method used

Through genome-wide association analysis and resequencing methods, a 959 bp deletion mutation at 6,211,810 bp - 6,212,768 bp on chromosome 9 of the chicken reference genome Gallus_gallus.GRCg6a was screened out. Specific primers were designed for genotyping detection, and individuals carrying the deletion mutation were eliminated, while those not carrying the deletion mutation were retained.

Benefits of technology

It significantly improves the early egg production time of chickens and the stability of egg production performance, and improves the accuracy and efficiency of breeding selection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796489A_ABST
    Figure CN120796489A_ABST
Patent Text Reader

Abstract

The invention discloses a molecular marker influencing the daily laying time character of chicken and a genetic typing detection method and application of the molecular marker, and belongs to the technical field of molecular marker-assisted selection and animal genetic breeding. According to the invention, the daily laying time character of chicken is firstly subjected to genome-wide association analysis (GWAS), a plurality of obviously associated mutations are found on a chromosome 9 of a chicken reference genome Galusgalus.GRCg6a version, a 959bp deletion mutation exists at 611bp, 810bp, 212bp and 768bp, and the mutation not only obviously affects the daily laying time of chicken, but also has the characteristic of being easier to detect compared with other linked SNP (Single Nucleotide Polymorphism). The invention further provides a genetic typing detection method based on the deletion mutation molecular marker influencing the daily laying time of the chicken, an efficient and accurate molecular marker-assisted selection technology can be established by utilizing the method, and the molecular marker-assisted selection technology is applied to genetic improvement of the laying performance of the chicken, so that the laying performance and the laying stress resistance of the chicken are improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular marker assisted selection and animal genetic breeding technology, and particularly relates to a deletion mutation molecular marker for selecting a chicken daily egg production time trait and application thereof BACKGROUND

[0002] Chicken eggs are rich in various nutrients and are one of the foods commonly used by humans, and therefore, improving the egg production performance and stability of chickens is one of the current breeding focuses.

[0003] The daily egg production time of a chicken is regulated by the circadian rhythm, and environmental changes such as light will usually affect the hormone secretion and expression of the biological clock gene of the chicken, thereby interfering with the circadian rhythm of the chicken and affecting the early or late egg production time. Chickens with stronger stress resistance can maintain the secretion of related hormones, the expression of related genes and the homeostasis of the body, thereby stabilizing the egg production time. Studies have shown that the daily egg production time is significantly correlated with the egg production number and stability, that is, the earlier the average daily egg production time in a period of time, the more the egg production number and the more stable the egg production. In addition, the early or late egg production time not only reflects the egg production performance and stress resistance of the chicken, but also can save labor and energy of the egg picking device, and is also conducive to the production of fresh eggs in a large-scale breeding site.

[0004] Molecular marker assisted selection can greatly improve the selection accuracy and shorten the generation interval. Compared with SNP molecular markers, insertion / deletion type molecular markers are rare and difficult to be located, but the detection method is simpler, the cost is smaller, the equipment requirement is lower, and it is more suitable for large-scale detection in actual breeding work. SUMMARY

[0005] In view of the above research background, the primary purpose of the present application is to provide an insertion / deletion type molecular marker for screening the chicken daily egg production time trait. Based on a high egg production chicken specialized female line, the present application uses whole genome association analysis and resequencing methods to find an insertion / deletion type molecular marker related to the chicken daily egg production time trait, so as to apply the insertion / deletion type molecular marker related to the chicken daily egg production time trait in marker assisted selection.

[0006] The technical solution adopted by the present application is as follows: Step 1, breed egg-laying hens of the same breed and the same age, and when reaching the egg production peak period (the 26th week), start recording the daily egg production time data of each egg produced by each egg-laying hen, and obtain a total of 507 chicken phenotype data for 30 days in the peak period; Step 2, extract all blood samples of the recorded individuals, extract DNA of the blood samples, construct a DNA library, and perform whole genome resequencing; Step 3, filter and quality control the sequencing data; Step 4, combined with the daily egg production time phenotype data, using GEMMA software, adding individual kinship matrix, using mixed linear model (LMM) for genome-wide association analysis (GWAS), determine the candidate interval site significantly related to the daily egg production time trait.

[0007] Step 5, scanning the sequencing alignment file in the candidate interval, screening out the insertion / deletion mutation.

[0008] Step 6, genotype the screened insertion / deletion mutation in all sequencing individuals, and calculate the association between genotype and daily egg production time phenotype, find the most closely associated insertion / deletion mutation with the phenotype.

[0009] The present application obtains the insertion / deletion mutation associated with the daily egg production time of chicken by the method of whole genome association analysis and resequencing, a 959 bp deletion mutation of 6,211,810 bp-6,212,768 bp on chromosome 9 of chicken reference genome Gallus_gallus.GRCg6a version 9, which is located to ENSGALG00000053777.1 gene, and the 959 bp deletion mutation significantly affects the daily egg production time of chicken.

[0010] The second object of the present application is to provide a genotyping detection method based on the deletion molecular marker affecting the daily egg production time trait of chicken. The specific steps are as follows: taking the whole genome DNA of the chicken to be tested as the template, using specific primers for amplification, and identifying the amplified product by agarose gel electrophoresis, if only one 1354 bp band appears in the electrophoresis result, the individual does not contain 959 bp deletion mutation; if only one 395 bp band appears in the electrophoresis result, the individual is 959 bp deletion mutation homozygote; if one 1354 bp band and one 395 bp band appear in the electrophoresis result, the individual is 959 bp deletion mutation heterozygote. The specific primers contain forward primer F and reverse primer R, and the nucleic acid sequences are as follows: Forward primer F: AAAATCCCACTCCACATCCTC (SEQ ID NO. 1), Reverse primer R: AGAGAGGAACATCTGAAGAGCTG (SEQ ID NO. 2).

[0011] The third object of the present application is to provide the application of the molecular marker affecting the egg laying time of chickens in genetic breeding. Specifically, a genotyping detection method based on the deletion mutation molecular marker affecting the egg laying time of chickens is used in the genetic breeding of chickens. In the application, the deletion mutation molecular marker affecting the egg laying time of chickens is used to genotype the chickens to be tested, and the individuals carrying the deletion mutation are eliminated, and the individuals not carrying the deletion mutation are retained, so that the egg laying time of the offspring chickens is advanced, and the egg laying performance and stability are improved.

[0012] The present application has the following advantages and effects compared with the prior art: 1. The present application first screens the molecular marker related to the egg laying time of chickens, and then verifies the influence effect of the molecular marker on the egg laying time. It is found that there are multiple significant mutations on chromosome 9 of Gallus_gallus.GRCg6a version 9 of chicken reference genome, and there is a 959 bp deletion mutation at 6,211,810 bp-6,212,768 bp. The mutation significantly delays the egg laying time of chickens, and compared with other linked SNPs, the site of the molecular marker has the characteristics of easy detection.

[0013] 2. The genotyping detection method based on the deletion mutation molecular marker affecting the egg laying time of chickens is used to genotype the chickens to be tested, and the individuals carrying the deletion mutation are eliminated, and the individuals not carrying the deletion mutation are retained, so that the chickens with advanced egg laying time are obtained.

[0014] 3. The genotyping detection method based on the molecular marker can be used in chicken breeding selection, that is, the method can be used to establish an efficient and accurate molecular marker assisted selection technology to select chickens with advanced egg laying time, so that the egg laying time of the offspring chickens is advanced, the egg laying performance of the chickens is improved, and the egg laying performance and resistance of the chickens are improved. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 It is a Manhattan plot of whole genome association analysis of the present application on the egg laying time trait; Figure 2 It is a local Manhattan plot of whole genome association analysis of the present application on chromosome 9 of the egg laying time trait; Figure 3 It is a schematic diagram of the 959 bp deletion mutation proposed by the present application: a is a heterozygous individual carrying a 959 bp deletion; b is an individual not carrying a 959 bp deletion; Figure 4 It is the influence of the 959 bp deletion mutation of the mapping population used in the present application on the egg laying time phenotype; Figure 5 The PCR electrophoresis map of the 959 bp deletion different genotype detection proposed in the present application: the M lane in the figure is the Maker DNA molecular weight marker (100 bp - 2000 bp ladder); the 7th, 8th, 9th, 10th, 15th, 16th, 17th, 19th, 21st, 22nd lanes each have one 1354 bp band, which is a homozygous wild type not carrying the deletion; the 18th lane has only one 395 bp band, which is a homozygous mutant carrying the deletion; the 1st, 2nd, 3rd, 4th, 5th, 6th, 11th, 12th, 13th, 14th, 20th lanes each have one 1354 bp band and one 395 bp band, which is a heterozygous type carrying the deletion; Figure 6 The Sanger sequencing verification map of the detection results of different genotypes of the 959 bp deletion proposed in the present application: a is a homozygous wild type individual not carrying the 959 bp deletion; b is a homozygous mutant individual carrying the 959 bp deletion; Figure 7 The effect of the 959 bp deletion mutation of the verification population used in the present application on the daily egg laying time phenotype. DETAILED DESCRIPTION

[0016] In order to make the purpose, technical scheme and advantages of the present application clearer, the technical scheme in the present application will be described clearly and completely below in combination with the drawings in the present application. It should be understood that the specific examples described herein are only used to explain the present application and are not used to limit the present application. The reagents which are described in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods which are not described in detail are all conventional experimental methods and can be known from the prior art. Based on the examples in the present application, all other examples obtained by those of ordinary skill in the art without making creative efforts belong to the scope of protection of the present application.

[0017] Example 1 Phenotype determination 507 high egg laying chickens of the same breed and the same age were raised as specialized female parent lines, and all the chickens were raised in the same conditions in the breeding farm of Hubei Shengdi Agricultural Science and Trade Co., Ltd. From the entry into the egg laying peak period (the 26th week), the phenotype data of the egg laying time of each egg produced by the hens every day were collected, and the collection lasted for 30 days. Each egg laying time phenotype data was converted into a numerical value, that is, the integer "hours" (24-hour system) of the natural time remained unchanged, and the numerical value of "minutes" was converted into the decimal point after the "hours" by "each minute = six hundred and sixty-sixth hours". The average value of the egg laying time of each chicken per day within 30 days was calculated, and the average value was taken as the phenotype data with 24 h as the statistical time. The descriptive statistical results of the daily egg laying time trait of 507 Hy-Line powder high egg laying chickens are shown in Table 1.

[0018] Table 1 Mean Standard deviation Maximum Minimum Coefficient of variation (%) Time in lay (h) 9.19 1.24 13.21 6.10 13.49 Sample collection of Example 2 The blood of 507 Hy-Line brown high-yield laying hens was collected, genomic DNA was extracted from the blood samples, and sent to the Wuhan shadow company for whole genome resequencing, with a sequencing depth of 5G.

[0019] Whole genome association analysis GWAS of daily egg laying time trait of Example 3 1. Preliminary filtering of data The whole genome resequencing data obtained in Example 2 was filtered by GATK, and the following steps were followed to filter out low-quality variants: (1) Remove SNP sites with QD < 2.0, QD (Quality by Depth) represents the ratio of the quality of each variant site to the coverage depth. If QD is less than 2.0, it means that the quality of the variant site is relatively low, and filtering out these sites can reduce false positive results.

[0020] (2) Remove SNP sites with FS > 60.0, FS (Fisher Strand) is an index that measures whether the distribution of variant sites on the positive and negative strands in the sequencing data is balanced. If the FS value is greater than 60.0, it indicates that the distribution of the variant site on the positive or negative strand is significantly biased, and therefore needs to be filtered out.

[0021] (3) Remove SNP sites with MQ < 40.0, MQ (Mapping Quality) represents the mapping quality. If MQ is less than 40.0, it means that the mapping quality of the variant site is not high, and filtering out these low-quality variants can help improve the accuracy of subsequent analysis.

[0022] (4) Remove SNP sites with MQRankSum < -12.5, MQRankSum is an index that measures the difference in mapping quality on both sides of the variant site. If MQRankSum is less than -12.5, it means that there is a significant difference in mapping quality on both sides of the variant site, and these sites need to be filtered out.

[0023] (5) Remove SNP sites with ReadPosRankSum < -8.0, ReadPosRankSum is an index that measures the distribution of variant sites in sequencing reads. If ReadPosRankSum is less than -8.0, it indicates that the frequency of the variant site on one end of the sequencing read is too high, and these sites need to be filtered out.

[0024] 2. Data quality control, using PLINK v1.9 to control the quality of the data, removing SNP sites with a genotype missing rate greater than 5% (-- geno 0.05).

[0025] 3. Genome data filling, using Beagle to fill the genome data after quality control, the purpose of filling is to use known genotype information to infer missing genotypes. By filling, the integrity of the data can be increased, and the accuracy of subsequent analysis can be improved.

[0026] 4. Further quality control, using PLINK v1.9 to further control the quality of the data after filling, control conditions include the following: remove SNP sites with a Minor Allele Frequency (MAF) less than 1%. Remove SNP sites that do not meet the Hardy-Weinberg Equilibrium balance (HWE) (remove SNP sites with a P value less than 1 x 10 -6 This parameter is used to detect whether the genotype frequency of each site meets the Hardy-Weinberg balance law. This means that if the observed genotype frequency of a SNP is significantly different from the expected genotype frequency calculated according to the allele frequency (P value less than 0.000001), then this SNP site will be considered not to meet HWE and will be excluded in subsequent analysis.

[0027] 5. LD pruning Then use PLINK v1.9 to prune sites with strong LD. PLINK will calculate the r² (linkage disequilibrium coefficient) between all SNP pairs in each window according to the specified window size and step size, each window includes 50 SNP sites, and the window moves every 5 SNP sites, detects the difference between the combined frequency of any two SNPs in the window and the frequency of random combination, and ensures that the r 2 greater than 0.2 between any two SNPs in the window, if the r 2 greater than 0.2 between the two SNPs, it is considered that they have strong linkage disequilibrium (LD), through the above process to detect the whole genome, until all SNPs are evaluated, which can reduce the problem of multiple collinearity caused by LD, after all the above steps, finally 343843 single nucleotide polymorphism (SNP) sites are retained for subsequent analysis.

[0028] 6. Result analysis (1) Analysis method The GWAS analysis was performed using the mixed linear model (LMM) in the GEMMA software. The LMM can consider the genetic relationship between individuals, and by adding the genetic relationship matrix, it can control the effects of population structure and genetic relationship on the analysis results of egg laying time. This effectively reduces false positive results and improves the accuracy of GWAS analysis.

[0029] The genome-wide significant threshold line was determined using the Bonferroni method. Bonferroni correction is a conservative multiple comparison correction method. The significance level is 0.05, and by dividing it by the number of sites tested, 343843, the genome-wide significant threshold line is 0.05 / 343843 = 1.45 x 10 -7 In the results of the GWAS analysis, the genotype frequency P value of each SNP was examined. If the P value is less than the genome-wide significant threshold line 1.45 x 10 -7 , then the SNP is considered to be significantly associated with egg laying time at the genome-wide level. Alternatively, SNPs with P values below this threshold are considered to be significantly associated with egg laying time.

[0030] At the same time, a suggested threshold line of 1 / 343843 = 2.91 x 10 -6 was given for screening potential association signals. In the results of the GWAS analysis, the P value of each SNP was examined. If the P value of a SNP is less than this threshold 2.91 x 10 -6 , then the SNP is considered to be significantly associated with egg laying time. This threshold is higher than the genome-wide significant threshold, so the number of SNPs screened will be larger.

[0031] (2) Analysis results As shown in Figure 1 , the GWAS analysis results are located on chromosome 1 and chromosome 9. There may be genes or gene regions associated with egg laying time on these two chromosomes. That is, the association signals found on chromosome 1 and chromosome 9 may be related to the regulation of egg laying time.

[0032] Example 4 Location of deletion mutations 1. Chromosome location Of the two chromosomes located, the peak of chromosome 9 is more obvious, and the associated SNPs are more concentrated, and are concentrated in the interval of 5.4 - 7.0 Mb (as shown in Figure 2 ).

[0033] 2. Structural variation detection The lumpy software was used to detect structural variations within the interval 5.4 - 7.0 Mb, and according to the results vcf file, the insertion / deletion type variations were screened out.

[0034] 3. Genotyping and phenotype association The bam files after the original sequencing data alignment were analyzed and viewed using IGV software to observe the distribution of each insertion / deletion variant in different individuals, so as to perform genotyping on all insertion / deletion variants and determine the genotype of each individual at these variant sites.

[0035] Compare the daily egg production patterns between individuals with different genotypes for each variant. For example, compare the daily egg production patterns between individuals with a deletion mutation and those without the mutation.

[0036] 5. Key variant results Through the above analysis, it was found that the 959 bp deletion mutation (e.g. Figure 3 The individuals with the same egg-laying time ( Figure 4 ).

[0037] The above-mentioned deletion mutation is a 959 bp deletion mutation from 6,211,810 bp to 6,212,768 bp on chromosome 9 of the chicken reference genome Gallus_gallus.GRCg6a version, which is located in the long non-coding RNA gene ENSGALG00000053777.1. The deletion mutation significantly delays the daily egg production time of chickens.

[0038] Example 5 Detection and Verification of Molecular Markers 1) Design primers using the upstream and downstream reference genome sequences of the 959 bp deletion mutation. The designed primer DNA sequences are as follows: Forward primer F: AAAATCCCACTCCACATCCTC (SEQ ID NO. 1), Reverse primer R: AGAGAGGAACATCTGAAGAGCTG (SEQ ID NO. 2).

[0039] 2) PCR amplification PCR amplification was performed using the above primers in DNA from the individual sample. The PCR reaction system was as follows: 4.0 μl of DNA template, 12 μl of double-distilled water, 20 μl of Master Mix, 2 μl of upstream primer, and 2 μl of downstream primer. The PCR reaction conditions were: initial denaturation at 95°C for 5 min; 14 cycles of denaturation at 94°C for 15 s, annealing at 68°C for 15 s, and extension at 72°C for 90 s, with the annealing temperature decreasing by 1°C each cycle; 25 cycles of denaturation at 94°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 90 s to stabilize amplification; and a final extension at 72°C for 5 min to ensure complete synthesis of all DNA strands.

[0040] 3) Agarose gel electrophoresis detection like Figure 5 As shown, the 22 groups of products after PCR amplification were finally detected by agarose gel electrophoresis. After agarose gel electrophoresis, if only a 1354 bp band appeared in the electrophoresis result, the DNA of the sample individual did not contain the 959 bp deletion mutation; if only a 395 bp band appeared in the electrophoresis result, the DNA of the sample individual was homozygous for the 959 bp deletion mutation; if a 1354 bp band and a 395 bp band appeared in the electrophoresis result, the DNA of the sample individual was heterozygous for the 959 bp deletion mutation.

[0041] 4) Verification by Sanger sequencing To verify that the agarose gel results of the PCR products were consistent with the expected genotypes, the 22 groups of products after PCR amplification were verified by Sanger sequencing using reverse primer R. Figure 5 The Sanger sequencing results of DNA from individuals without the 959 bp deletion mutation were Figure 6 a; Figure 5 The Sanger sequencing results of the DNA of the sample individual with the homozygous 959 bp deletion mutation were Figure 6 b, and there will be an 18 bp insertion at the deletion site.

[0042] The results showed that the agarose gel electrophoresis detection results were consistent with the sequencing results, that is, the agarose gel electrophoresis results of the present invention were reliable and could meet the molecular detection requirements for the 959 bp deletion mutation.

[0043] 5) Verify the relationship between deletion and egg-laying time The corresponding relationship between egg laying time and genotype of all 22 samples tested is as follows: Figure 7 As shown in Figure 3, wild-type individuals without the 959bp deletion mutation lay eggs significantly earlier than individuals with the 959bp deletion. This means that the detection method of the present invention can identify individuals with later egg-laying times.

[0044] The present invention identified a 959 bp deletion mutation molecular marker related to the daily egg-laying time trait. Therefore, by selecting individuals that do not carry the 959 bp deletion and eliminating individuals that carry the 959 bp deletion in chickens, the egg-laying time of chickens can be effectively advanced and the egg-laying performance and stability of chickens can be improved.

[0045] Based on the above results, the mutation sites of the present invention and the corresponding PCR-gel electrophoresis genotyping method can be used as potential genetic markers and molecular detection methods to improve the egg-laying performance and stability of chickens in the field of genetic breeding.

[0046] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations, simplifications, etc. made without departing from the spirit and principles of the present application should be equivalent replacement manners and should be included in the protection scope of the present application.

Claims

1. A molecular marker that affects the daily egg production time of chickens, characterized in that: The SNP molecular marker is a 959bp deletion mutation from 6,211,810 bp to 6,212,768 bp on chromosome 9 of the chicken reference genome Gallus_gallus.GRCg6a version, and is located in the long non-coding RNA gene ENSGALG00000053777.

1. The deletion mutation significantly delays the daily egg production time of chickens.

2. A primer set for amplifying the molecular marker affecting the daily egg production time of chickens according to claim 1, characterized in that: The primer set includes an upstream primer as shown in SEQ ID NO.1 and a downstream primer as shown in SEQ ID NO.

2.

3. A kit, characterized in that Comprising the primer set according to claim 2.

4. Use of the SNP molecular marker according to claim 1, the primer set according to claim 2, or the kit according to claim 3 in chicken breeding to identify chickens with different egg-laying times and obtain chickens with earlier daily egg-laying time.

5. A genotyping detection method based on molecular markers affecting the daily egg production time of chickens, characterized in that: The following steps are involved: (1) obtaining whole genomic DNA of a chicken to be tested, and using it as a template, performing PCR amplification using the primer set of claim 2 or the kit of claim 3 to obtain an amplified product; (2) The amplified product was subjected to agarose gel electrophoresis and identified. If only one 1354 bp band appeared in the electrophoresis results, the individual did not contain the 959 bp deletion; If only one 395 bp band appears in the electrophoresis results, the individual has a 959 bp homozygous deletion; If the electrophoresis results show a 1354 bp band and a 395 bp band, the individual has a 959 bp heterozygous deletion; (3) Individuals with only one band and a product length of 1354 bp in the electrophoresis results were retained, and individuals with a product length of 395 bp in the electrophoresis results were eliminated.

6. The detection method according to claim 5, characterized in that In step (1), the PCR reaction system is: a 40 ul reaction system, including 4.0 ul of DNA template, 12 ul of double-distilled water, 20 ul of Master Mix, 2 ul of upstream primer, and 2 ul of downstream primer; The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 5 min; 14 cycles of denaturation at 94°C for 15 s, annealing at 68°C for 15 s, and extension at 72°C for 90 s, with the annealing temperature decreasing by 1°C each cycle; 25 cycles of denaturation at 94°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 90 s; and a final extension at 72°C for 5 min.