Application of SNP (Single Nucleotide Polymorphism) genetic marker related to feed intake in egg producing period in LARGE gene in chicken genetic breeding
By applying the SNP genetic markers FI_chr1_1 and FI_chr1_2 of the LARGE gene in chicken genetic breeding, the problem of difficulty in reducing the feed intake of chickens during the laying period in the existing technology is solved, the effect of efficient feed utilization is achieved, and the cost of raising chickens is reduced.
Patent Information
- Application Number
- CN202510925210.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-04
- Publication Date
- 2025-10-17
AI Technical Summary
Existing technologies make it difficult to effectively reduce the feed intake of chickens during the laying period through genomic selection, resulting in high feed costs, and conventional breeding methods make it difficult to accurately control the feed intake trait.
Using the SNP genetic markers FI_chr1_1 and FI_chr1_2 in the LARGE gene, which are related to feed intake during the laying period, genetic markers associated with feed intake were screened through genome-wide association analysis, and corresponding PCR primers and kits were designed for early selection to reduce feed intake.
The goal is to genetically reduce the amount of feed consumed by chickens during the laying period, improve feed utilization efficiency, obtain chicken breeds that efficiently utilize feed, and reduce chicken production costs.
Smart Images

Figure CN120796490A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of animal genetics and biotechnology, and particularly relates to application of a SNP genetic marker related to feed intake during the laying period in the LARGE gene in chicken genetic breeding. BACKGROUND
[0002] Feed intake during the laying period is related to egg production income, animal welfare, and sustainable development of chicken production. In recent years, the issue of food security caused by human-animal competition for food has reflected a new direction of research on egg chicken genetic breeding, that is, how to reduce feed intake while maintaining existing egg production performance. From the perspective of genetic breeding, reducing feed intake while improving production performance is a sustainable breeding path, because genetic progress is both permanent and cumulative. Based on microsatellite sequence polymorphism and linkage analysis method, a plurality of QTL (quantitative trait loci) linked to feed intake have been published. Due to uneven distribution and limited number of microsatellite markers on the genome, the QTL confidence interval of the feed intake trait obtained by linkage analysis is often large, which is difficult to be used in breeding practice. With the progress of sequencing technology, genome-wide association analysis (GWAS) has opened up a new perspective for analyzing the genetic structure of chicken feed intake during the laying period. Chicken feed intake is a quantitative trait regulated by multiple genes with small effects, and it is difficult to make effective progress in genetics through conventional breeding methods. Only by clarifying the genetic structure of feed intake during the laying period can we improve the accuracy of breeding through genomic selection and obtain new chicken breeds or matching lines that efficiently utilize feed to meet the needs of the egg chicken industry. SUMMARY
[0003] In order to solve the problem of high feed cost in chicken production, the application provides application of a SNP genetic marker related to feed intake during the laying period in the LARGE gene in chicken genetic breeding, which helps to breed chicken breeds that efficiently utilize feed, and reduces feed intake to improve chicken production income.
[0004] The application is implemented by the following technical solutions: The application provides application of a SNP genetic marker related to feed intake during the laying period in the LARGE gene in chicken genetic breeding, wherein the SNP genetic marker related to feed intake during the laying period in the LARGE gene comprises FI_chr1_1 and / or FI_chr1_2. The FI_chr1_1 is numbered as rs312566702, corresponds to the sequence information of chromosome 1 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, is the 1st intron sequence of the LARGE gene, and the base here is G or A. The FI_chr1_2 is numbered as rs316368983, corresponding to the sequence information of chromosome 1 at position 52625267 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, belonging to the sequence upstream of the LARGE gene, and the base here is T or C.
[0005] Based on the same inventive concept, the application provides an early selection method for the feed intake trait of a chicken in the laying period, which comprises early selection for the feed intake trait of a chicken in the laying period based on the genotype of the SNP genetic marker FI_chr1_1 and / or FI_chr1_2. The FI_chr1_1 is numbered as rs312566702, corresponding to the sequence information of chromosome 1 at position 52729473 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, belonging to the sequence of the first intron of the LARGE gene, and the base here is G or A. The FI_chr1_2 is numbered as rs316368983, corresponding to the sequence information of chromosome 1 at position 52625267 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, belonging to the sequence upstream of the LARGE gene, and the base here is T or C.
[0006] Further, the early selection method specifically comprises: detecting the genotype of the FI_chr1_1 and / or the FI_chr1_2 in the genome of the chicken to be tested; early selection for the feed intake trait of the chicken to be tested based on the genotype of the FI_chr1_1 and / or the FI_chr1_2; wherein the feed intake in the laying period of an individual with the AA genotype of the FI_chr1_1 is greater than that of an individual with the GA genotype, and the feed intake in the laying period of an individual with the GA genotype is greater than that of an individual with the GG genotype; The feed intake in the laying period of an individual with the TT genotype of the FI_chr1_2 is greater than that of an individual with the TC genotype, and the feed intake in the laying period of an individual with the TC genotype is greater than that of an individual with the CC genotype.
[0007] Further, the detection of the genotype of the FI_chr1_1 and / or the FI_chr1_2 in the genome of the chicken to be tested specifically comprises: detecting the genotype of the FI_chr1_1 and / or the FI_chr1_2 in the genome of the chicken to be tested, wherein the method for detecting the genotype of the FI_chr1_1 in the genome of the chicken to be tested comprises: PCR amplification is performed on the chicken genomic DNA to be tested with P1_FI1f and P1_FI1r as primers; The PCR amplification product is sequenced to obtain the genotype of the chicken chromosome 1 at position 52729473 to be tested; The method for detecting the genotype of the FI_chr1_2 in the chicken genome to be tested comprises: PCR amplification is performed on the chicken genomic DNA to be tested with P1_FI2f and P1_FI2r as primers; The PCR amplification product is sequenced to obtain the genotype of the chicken chromosome 1 at position 52625267 to be tested; The nucleotide sequence of the P1_FI1f is shown in SEQ ID NO. 1, and the nucleotide sequence of the P1_FI1r is shown in SEQ ID NO. 2; the nucleotide sequence of the P1_FI2f is shown in SEQ ID NO. 3, and the nucleotide sequence of the P1_FI2r is shown in SEQ ID NO. 4.
[0008] Preferably, the chicken to be tested includes Dongxiang Green Shell Egg Chicken and / or Bailaihang Chicken.
[0009] Based on the same inventive concept, the present application provides an application of a primer for detecting a SNP genetic marker related to feed intake during the laying period in the LARGE gene in chicken genetic breeding, wherein the primer for detecting the SNP genetic marker related to the feed intake during the laying period in the LARGE gene includes a primer for detecting FI_chr1_1 and / or a primer for detecting FI_chr1_2. The primer for detecting the FI_chr1_1 includes P1_FI1f and P1_FI1r, and the primer for detecting the FI_chr1_2 includes P1_FI2f and P1_FI2r. The nucleotide sequence of the P1_FI1f is shown in SEQ ID NO. 1, and the nucleotide sequence of the P1_FI1r is shown in SEQ ID NO. 2; the nucleotide sequence of the P1_FI2f is shown in SEQ ID NO. 3, and the nucleotide sequence of the P1_FI2r is shown in SEQ ID NO. 4.
[0010] Based on the same inventive concept, the present application provides a kit for detecting a SNP genetic marker related to feed intake during the laying period in the LARGE gene, wherein the kit includes a primer for detecting FI_chr1_1 and / or a primer for detecting FI_chr1_2. The primer for detecting the FI_chr1_1 includes P1_FI1f and P1_FI1r, and the primer for detecting the FI_chr1_2 includes P1_FI2f and P1_FI2r. The nucleotide sequence of the P1_FI1f is shown as SEQ ID NO. 1, the nucleotide sequence of the P1_FI1r is shown as SEQ ID NO. 2; the nucleotide sequence of the P1_FI2f is shown as SEQ ID NO. 3, and the nucleotide sequence of the P1_FI2r is shown as SEQ ID NO. 4.
[0011] Based on the same inventive concept, the application also provides an application of a kit for detecting a SNP genetic marker related to feed intake during the laying period in a LARGE gene in chicken genetic breeding.
[0012] The one or more technical solutions in the embodiments of the application have at least the following technical effects or advantages: The application of the SNP genetic marker related to feed intake during the laying period in the LARGE gene in chicken genetic breeding, the SNP genetic marker related to feed intake during the laying period in the LARGE gene is FI_chr1_1 and FI_chr1_2, the average feed intake during the laying period of the population with the favorable genotype of FI_chr1_1 and FI_chr1_2 is lower, which is helpful to reduce the feed intake during the laying period from the genetic point of view, and the application of the SNP genetic marker in chicken genetic breeding is helpful to obtain a chicken breed with higher feed utilization efficiency. BRIEF DESCRIPTION OF DRAWINGS
[0013] In order to more clearly illustrate the technical solutions in the embodiments of the application, the following will briefly introduce the drawings needed to be used in the embodiment description. Obviously, the drawings in the following description are some embodiments of the application, and other drawings can also be obtained by those skilled in the art without creative effort on the basis of these drawings.
[0014] Figure 1 Manhattan plot for GWAS analysis of double-week feed intake during the laying period of the resource population in Embodiment 2 of the application; Figure 2 QQ plot for GWAS analysis of feed intake during the laying period of the resource population in Embodiment 2 of the application; Figure 3 Association analysis of the genotype of the FI_chr1_1 genetic marker and feed intake; Figure 4 Association analysis of the genotype of the FI_chr1_2 genetic marker and feed intake. DETAILED DESCRIPTION
[0015] The advantages and various effects of the application will be more clearly presented by the following specific embodiments and examples. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the application, rather than limit the application.
[0016] Throughout the specification, unless otherwise specifically indicated, the terms used herein are to be understood in the manner in which they are commonly used in the art. Thus, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. In case of conflict, the present specification will prevail.
[0017] Unless otherwise specifically indicated, various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be prepared by existing methods.
[0018] The overall idea of the present application is as follows: Feed intake is a quantitative trait controlled by multiple genes with small effects, and is influenced by many factors, including genetic factors, environmental factors, nutritional factors and behavioral performance. If the distribution of genes related to feed intake on the genome and the effect value of the related genetic loci are clarified, low feed intake chicken breeds can be obtained. Based on the polymorphism of microsatellite sequences and linkage analysis methods, different research teams at home and abroad have reported multiple QTLs linked to feed intake. However, due to the uneven distribution and limited number of microsatellite markers on the genome, the QTL confidence interval of laying traits obtained by linkage analysis is often large, which makes it difficult to be used in breeding practice.
[0019] With the reduction of sequencing cost and the development of computing technology, genome-wide association studies (GWAS) have become a powerful tool for analyzing the genetic structure of livestock quantitative traits. Using GWAS method to study the association between base variation and phenotype value can identify genetic markers that affect economic traits, and is particularly suitable for traits that are difficult to measure, late-life traits, limited traits and slaughter traits. If genetic markers of egg laying period feed intake of chicken can be screened by genome-wide association analysis, it will help to quickly obtain genetic progress through molecular marker-assisted breeding or whole genome selection.
[0020] Based on this, the present application integrates the dual trait animal model and GWAS analysis, fully utilizes the advantages of mixed linear model, and screens the genetic markers FI_chr1_1 and FI_chr1_2 associated with feed intake. In the SNP screening method of the present application, the dual trait animal model can be corrected with each other to improve the accuracy of the screening results; GWAS analysis has the advantages of high throughput, high density and high efficiency; mixed linear model has the advantage of solving population stratification. The feed intake of individuals with favorable genotypes of FI_chr1_1 and FI_chr1_2 is lower, which helps to reduce the feed intake during the laying period from a genetic point of view.
[0021] The application of the SNP genetic marker related to feed intake during the laying period in the LARGE gene in chicken genetic breeding will be described in detail below in combination with examples and experimental data.
[0022] Example 1 Resource population construction and feed intake data during the laying period The feed intake data during the laying period were collected from the laying hen resource population of Jiangsu Poultry Science Institute. The population construction information is detailed in the literature published by the research team (Guo J et al. Analysis of genetic parameters of egg yolk quality in laying hens using random regression model [J]. Journal of Nanjing Agricultural University, 2016, 39(1): 145-149.). Briefly, Dongxiang green shell laying hens and Bailaihang chickens were used as parents to obtain F1 and F2 generations through reciprocal cross. The test chickens were single-caged and raised in traditional A-type cages, with air blower and wet curtain cooling, mechanical feeding and manure cleaning. The feed came from COFCO, and the composition of the laying hen feed included 16.5% crude protein and 11 511 kJ / kg feed metabolizable energy. The laying hens were allowed to freely feed during the laying period, and water was supplied by nipple waterers. Routine immunization was performed according to the immunization program developed by Jiangsu Poultry Institute. The feed intake data of F2 generation test chickens were collected from 57 to 60 weeks of age. During the experiment, the feed consumption was measured once a week, and the body weight data were measured every four weeks.
[0023] After preliminary screening of pedigree records and production data, removing obvious errors and repeated data, removing outliers, and arranging them into table form, the data were cleaned. After data cleaning, the resource population feed intake dataset remained 7142 records of 1786 chickens. Then, WOMBAT software was used to analyze the feed intake (co) variance components and genetic parameters.
[0024] Example 2 GWAS analysis of feed intake during the laying period Blood samples of about 2 ml were collected from the wing vein of the test chickens using a disposable syringe, placed in an EDTA anticoagulant tube, and stored at -70 ℃. Genomic DNA was extracted from the blood samples, detected by 0.8% agarose electrophoresis and ultraviolet spectrophotometry, and then the DNA samples were diluted to 50±5 ng / μl for gene chip typing after passing the detection.
[0025] Genotyping was performed using the chicken high-density gene chip Affymetrix® Axiom® 600K Chicken Genotyping Array of Affymetrix. The data quality control was performed according to the chip instruction, mainly including: quality control before typing using APT software; using PLINK for quality control, removing SNP markers with detection rate lower than 0.97, removing SNP markers deviating from Hardy-Weinberg equilibrium; screening SNPs by analyzing metrics.R, SNP_filter.R and SNP, CR, FLD information; using BEAGLE for genotype filling. After quality control, 435867 SNPs and 1512 samples were used for subsequent analysis.
[0026] Before whole genome association analysis, multi-dimensional principal component analysis was performed to eliminate false positives. The first five principal components were added to the genetic model as covariate parameters, and the house effect and 60-week body weight were added to the model as fixed effects. Using Gemma software, the two-trait model was used to analyze the double-week feed intake during the laying period, and the significant test P value of each SNP marker was obtained. The matrix expression of the linear model is,
[0027] Where y represents the sample feed intake phenotype value vector; W represents the covariance matrix; a is the intercept vector; x is the genotype vector of the marker; u is the random effect vector; and e is the residual.
[0028] The independent test estimate of each SNP site was calculated using the R script "simpleM" method, and 59308 independent markers were obtained. After Bonferroni correction, the genome significant threshold value was 8.43x10 -7 , and the genome recommended threshold value was 1.69x10 -5 . Through GWAS analysis, genetic markers FI_chr1_1 and FI_chr1_2 associated with feed intake during the laying period were obtained (Table 1). It can be seen that there are genome significant level markers on chicken chromosome 1. In addition, genome significant level markers are also detected on chromosomes 24 and 27. Figure 1 The GWAS analysis QQ plot is attached Figure 2 to further verify the GWAS analysis results.
[0029] Table 1 SNP genetic markers associated with chicken feed intake during the laying period
[0030] Wherein: the marker chromosome physical position refers to the chicken whole genome (bGalGal1.mat.broiler.GRCg7b).
[0031] Example 3 Detection and verification of genetic markers The SNP genetic markers are applied to the candidate gene association analysis of the Dongxiang green shell egg chicken-White Leghorn chicken resource population. The specific operation steps are as follows: 1) PCR primer: download the DNA template sequence information from the NCBI website, design PCR amplification primers by primer premier 6.0 software, and the primer information is shown in Table 2. The PCR primers are synthesized by Sheng Wu Bioengineering (Shanghai) Co., Ltd.
[0032] Table 2 Amplification primers for detecting genetic markers of egg laying period feed intake of chickens
[0033] 2) Genomic DNA extraction: 1512 blood samples were extracted by CTAB method, and the genomic DNA was detected by ultraviolet spectrophotometer and agarose electrophoresis, and then PCR amplification was carried out after passing the detection.
[0034] 3) PCR amplification process: ① Reaction system: 10 μl system includes 50 ng of identification material DNA template, 10 ng of forward and reverse primers, 5 μL of 2×power Taq MasterMix, and the remaining volume is supplemented with ultrapure water.
[0035] ② Reaction program: first 94℃ denaturation for 30s, 53.2℃ annealing for 30s, 72℃ extension for 30s, a total of 5 cycles; then 94℃ denaturation for 30s, 53.2℃ annealing for 30s, 72℃ extension for 30s, a total of 30 cycles; 72℃ extension for 5 min, 4℃ preservation.
[0036] 4) The amplification product is sent to a sequencing company for sequence polymorphism detection. The nucleotide sequence of the amplification fragment is as follows: FI_chr1_1 ATCCAAGTCTATCAGTGTCTCTTGGTATATAATATTGTATTCCTTTGTTACGTTAGTACTGCAGAACCTGTTCTGATCTGTCACTAAGATGGGTATGAAACC[A / G]CAGTATGCAAAACTGAAGTATCAGCAATCTGCCCATTTACTTTGTATCCTCTTTTCCTGCTTCCTTCCATGAAACAGTGGTTGTTTACTTCTCGGCATATTAACATTTGTCAAGTGGTGCTAAATATTTTGCTTTCATTTAGAACTGAGTTTCATTCAAGATATTCTTGTTGTGGCCTATAGTTGGTGTGAATACTGGAGTTAATGCCCTGATTTTAAGAATCTTTGATTTCTTTTTAATTTTCTTCTTACTGGCAAGGTACAAATTACAGATGTGTGATGTTTTGCTGTAGTTCCACAGCTCAGGAGTAGCTTTGTGGTGCAGACAAGAATTTGTACTC TAGAG ATGGCTTCACCGA FI_chr1_2 TCTTCTTGCTCTTGCTGACAATTCTGTCTTCCAATGAACTCTAATACTAGTAAGCTGTGCTTTCTTTAATGAGGTCTTTGAATCAAAGACAGGGAATGCTCATAAGAAATGCTTTTCACTCAGTATTTGGGTGACCTTCTGGGAATGTAAGATTGAGCTCTAGTGCTGCAGTATGTGCTCCAGGTCTCTCAGTAGTTATCACAGTGTCATGAAATCTGGTGCTTCACTTCTTTCTATGGTTCCCGGAGCCTTGTGACTATTTGGGAATTGCAATTTGCACTAAAAGAAACCAATTCAGTTAACATCAGAACTAATAATGACTGTTTTTCTACTTATTTACATTCTACATATGCCCTCTTTCCTCCTACACCTATTCAGCTTCTCCTCTGCATATCCCAACTCTTTCCCATGGTCCCTAGCTTCAGAGCTGTAATTGTGTGCTCTATAACATCTGTGGTTAGTTCAGCCCATGCTGAGAGCTCATGTGCTTATCTGGAAGCTATTCCTTCAGTGGCAATATTAATTCAAGGCTTTC[C / T]TTTTTACTCTGCTGCCAATTTTTGTGAAACTTGTCAGACCTTTGTAACTCTTCTGCCCTTTTGCTGACTCCAGTAGGATCAGCCAACTTGTTCAAGAAGGTCAGACAGGAAAAG GGATTGATGGACACAGGTT In the above sequence, the mutation site marked with [ ] is shown, and the alleles are shown in brackets. The primer sequences are shown with underlined sequences at the beginning and end of the sequence.
[0037] 5) Association analysis: The genotypes of the subjects were obtained using the plink software, and the 57-58 week-old egg production period was subjected to single factor variance analysis.
[0038] The results of the association analysis of genetic marker FI_chr1_1 and feed intake are shown in Table 1. Figure 3 The average feed intake during the laying period was 1446.63±108.84 (AA genotype), 1440.10±105.64 (GA genotype), and 1424.17±112.99 (GG genotype), respectively.
[0039] The results of the association analysis of genetic marker FI_chr1_2 and feed intake are shown in Table 2. Figure 4The average feed intake of the laying period was 1448.03±107.87 (TT genotype), 1440.43±105.68 (TC genotype) and 1422.49±113.25 (CC genotype) in turn.
[0040] In conclusion, GG is the favorable genotype of genetic marker FI_chr1_1, and CC is the favorable genotype of genetic marker FI_chr1_2.
[0041] Finally, it should be noted that the terms "comprising", "comprising" or any other variant thereof are intended to cover non-exclusive inclusions, so that processes, methods, articles or devices that include a series of elements not only include those elements, but also other elements not explicitly listed, or inherent to such processes, methods, articles or devices.
[0042] Although preferred embodiments of the application have been described, those skilled in the art will be able to make additional modifications and variations to these embodiments without departing from the spirit and scope of the application. Therefore, the appended claims are intended to encompass all such modifications and variations as falling within the scope of the present application.
[0043] Obviously, many modifications and variations of the present application are possible in light of the above teachings. It is, therefore, to be understood that within the scope of the appended claims and their equivalents, the application can be practiced otherwise than as specifically described.
Claims
1. Application of a SNP genetic marker in the LARGE gene related to feed intake during egg-laying period in chicken genetic breeding, characterized in that: The SNP genetic markers in the LARGE gene that are associated with feed intake during laying period include FI_chr1_1 and / or FI_chr1_2; The FI_chr1_1 number is rs312566702, corresponding to the 52729473th position of chromosome 1 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, belonging to the first intron sequence of the LARGE gene, where the base is G or A; The FI_chr1_2 number is rs316368983, corresponding to the 52625267th position of chromosome 1 in the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, belonging to the upstream sequence of the LARGE gene, where the base is T or C.
2. A method for early selection of feed intake traits of chickens during egg production, characterized in that: The early selection method comprises performing early selection on the feed intake trait of chickens during the laying period based on the genotype of the SNP genetic markers FI_chr1_1 and / or FI_chr1_2; The FI_chr1_1 number is rs312566702, corresponding to the 52729473th position of chromosome 1 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, belonging to the first intron sequence of the LARGE gene, where the base is G or A; The FI_chr1_2 number is rs316368983, corresponding to the 52625267th position of chromosome 1 in the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, belonging to the upstream sequence of the LARGE gene, where the base is T or C.
3. The early selection method for feed intake traits of chickens during laying period according to claim 2, characterized in that: The early selection method specifically includes: Detecting the genotype of the FI_chr1_1 and / or the FI_chr1_2 in the chicken genome to be tested; Performing early selection on the feed intake trait during laying period of the tested chicken based on the genotype of the FI_chr1_1 and / or the FI_chr1_2; Among them, the feed intake of the AA genotype individual of FI_chr1_1 during the laying period is greater than the feed intake of the GA genotype individual during the laying period, and the feed intake of the GA genotype individual during the laying period is greater than the feed intake of the GG genotype individual during the laying period; The feed intake of the TT genotype individual of the FI_chr1_2 during the laying period is greater than that of the TC genotype individual during the laying period, and the feed intake of the TC genotype individual during the laying period is greater than that of the CC genotype individual during the laying period.
4. The early selection method for feed intake traits of chickens during laying period according to claim 3, characterized in that: The detecting the genotype of the FI_chr1_1 and / or the FI_chr1_2 in the chicken genome to be tested specifically comprises: Detecting the genotype of the FI_chr1_1 and / or the FI_chr1_2 in the chicken genome to be tested, wherein the method for detecting the genotype of the FI_chr1_1 in the chicken genome to be tested comprises: The chicken genomic DNA to be tested was amplified by PCR using P1_FI1f and P1_FI1r as primers; The PCR amplification product was sequenced to obtain the genotype of position 52729473 of the tested chicken chromosome 1; The method for detecting the genotype of the FI_chr1_2 in the chicken genome to be tested comprises: The chicken genomic DNA to be tested was amplified by PCR using P1_FI2f and P1_FI2r as primers; The PCR amplification product was sequenced to obtain the genotype of position 52625267 of the tested chicken chromosome 1; Among them, the nucleotide sequence of the P1_FI1f is shown as SEQ ID NO.1, and the nucleotide sequence of the P1_FI1r is shown as SEQ ID NO.2; the nucleotide sequence of the P1_FI2f is shown as SEQ ID NO.3, and the nucleotide sequence of the P1_FI2r is shown as SEQ ID NO.
4.
5. The early selection method for feed intake traits of chickens during laying period according to claim 2, characterized in that: The breeds of chickens to be tested include Dongxiang green-shell laying hens and / or white Leghorn chickens.
6. Use of primers for detecting SNP genetic markers in the LARGE gene related to feed intake during egg-laying period in chicken genetic breeding, characterized in that: The primers for detecting the SNP genetic marker related to feed intake during laying period in the LARGE gene include primers for detecting FI_chr1_1 and / or primers for detecting FI_chr1_2; The primers for detecting FI_chr1_1 include P1_FI1f and P1_FI1r, and the primers for detecting FI_chr1_2 include P1_FI2f and P1_FI2r; The nucleotide sequence of the P1_FI1f is shown as SEQ ID NO.1, and the nucleotide sequence of the P1_FI1r is shown as SEQ ID NO.2; the nucleotide sequence of the P1_FI2f is shown as SEQ ID NO.3, and the nucleotide sequence of the P1_FI2r is shown as SEQ ID NO.
4.
7. A kit for detecting SNP genetic markers in the LARGE gene that are associated with feed intake during egg production, characterized in that: The kit includes a primer for detecting FI_chr1_1 and / or a primer for detecting FI_chr1_2; The primers for detecting FI_chr1_1 include P1_FI1f and P1_FI1r, and the primers for detecting FI_chr1_2 include P1_FI2f and P1_FI2r; The nucleotide sequence of the P1_FI1f is shown as SEQ ID NO.1, and the nucleotide sequence of the P1_FI1r is shown as SEQ ID NO.2; the nucleotide sequence of the P1_FI2f is shown as SEQ ID NO.3, and the nucleotide sequence of the P1_FI2r is shown as SEQ ID NO.
4.
8. Use of the kit for detecting SNP genetic markers in the LARGE gene related to feed intake during laying period as claimed in claim 7 in chicken genetic breeding.