PCR (Polymerase Chain Reaction) primer combination for detecting three types of thrips in cotton field and multiple PCR detection method

By designing specific primers and optimizing multiplex PCR reaction conditions, the efficiency and accuracy issues of traditional morphological identification and DNA barcoding technologies in cotton field thrips identification were resolved, enabling rapid and accurate identification of three types of thrips in cotton fields, suitable for large-scale sample screening.

CN120796494APending Publication Date: 2025-10-17ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510939579.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-08
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

Traditional morphological identification of cotton field thrips nymphal stages and identification of closely related species is difficult. DNA barcoding technology has low amplification efficiency and poor specificity in closely related species, and band dispersion is easy to occur when detecting mixed populations. Existing PCR detection has low efficiency and cannot meet the needs of large-scale rapid detection in the field.

Method used

Specific upstream primers Tt123, Fi417, Fo322 and universal downstream primer HCO2198 were designed. DNA was extracted using a modified proteinase K cleavage method, amplified by one-step multiplex PCR, and identified by band size analysis by agarose gel electrophoresis.

Benefits of technology

It enables simultaneous and accurate identification of three types of thrips, improves detection efficiency by 3 times, is suitable for large-scale sample screening, breaks through the limitations of traditional morphological identification, and provides technical support for rapid field detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796494A_ABST
    Figure CN120796494A_ABST
Patent Text Reader

Abstract

The invention provides a PCR (Polymerase Chain Reaction) primer combination and a multiplex PCR detection method for detecting three types of thrips in a cotton field, and relates to a one-step multiplex PCR molecular rapid identification primer and method for three types of common thrips (tobacco thrips, flower thrips and western flower thrips) in the cotton field based on a mitochondrial COI gene. Specific upstream primers are respectively designed for three types of thrips and are combined with universal downstream primers, a one-step multiplex PCR detection system is constructed by optimizing the primer proportion and annealing temperature, a single target strip is amplified by a single template through single-tube reaction for one time, and specific strips of 123 bp (tobacco thrips), 417 bp (flower thrips) and 322 bp (flower thrips) can be synchronously amplified in a mixed sample template. And accurate identification of the three thrips is realized. According to the method, the limitation of traditional morphological identification in nymph stage and sibling species distinguishing is broken through, the detection efficiency is improved by 3 times compared with that of single PCR, and efficient technical support is provided for dynamic monitoring and green prevention and control of cotton field thrip populations.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular detection of agricultural pests, and particularly relates to a PCR primer combination for detecting three species of thrips in cotton fields and a multiplex PCR detection method. BACKGROUND

[0002] Thrips are important pests that harm cotton production, among which Frankliniella intonsa, F. issocia and F. occidentalis are dominant species in cotton fields. Traditional morphological identification has limitations in the nymph stage and in the identification of closely related species, and relies on observation of fine structures such as body surface setae, sensilla and reproductive organ structures, which requires high equipment and personnel experience, is time-consuming, and the morphological characteristics of nymphs are not obvious, making it difficult to distinguish.

[0003] In existing molecular biology identification techniques, although the DNA barcoding technique is commonly used, the universal primer has low amplification efficiency and poor specificity in closely related species, and when mixed populations are detected, there are problems such as band diffusion and non-specific amplification, which require sequencing and sequence alignment analysis, which is time-consuming and costly, and the single PCR detection efficiency is low, which cannot quickly distinguish by product fragment size alone, and cannot meet the needs of rapid screening of mixed populations, and cannot meet the needs of large-scale rapid detection in the field. Therefore, there is an urgent need for an efficient and accurate molecular identification technique to solve the technical bottleneck of identifying closely related species in mixed populations. SUMMARY

[0004] The purpose of the present application is to provide a PCR primer combination for detecting three species of thrips in cotton fields and a multiplex PCR detection method.

[0005] In order to achieve the purpose of the present application, in a first aspect, the present application provides a PCR primer combination for detecting three species of thrips in cotton fields and a multiplex PCR detection method, the three species of thrips being Frankliniella intonsa ( Thrips tabaci ), F. issocia ( Frankliniella intonsa ) and F. occidentalis ( Frankliniella occidentalis ); The primer combination comprises: a F. intonsa species-specific upstream primer Tt123, the nucleotide sequence of which is CAGGAGCTATCACAATACTTTTAACT (SEQ ID NO: 1); a F. issocia species-specific upstream primer Fi417, the nucleotide sequence of which is ACTATTGCCCCCATCTCTAATTCTAC (SEQ ID NO: 2); a F. occidentalis species-specific upstream primer Fo322, the nucleotide sequence of which is ATCACTCTGGACCATCAGTAGAT (SEQ ID NO: 3); a universal downstream primer HCO2198, the nucleotide sequence of which is: TAAACTTCAGGGTGACCAAAAAATCA (SEQ ID NO: 4).

[0006] In a second aspect, the present application provides a detection reagent or kit comprising the primer combination.

[0007] In a third aspect, the present application provides use of the primer combination or the detection reagent or kit comprising the primer combination in the detection of thrips by multiplex PCR. The thrips include Frankliniella intonsa, Frankliniella occidentalis and Frankliniella tritonic.

[0008] In a fourth aspect, the present application provides a method for detecting thrips by multiplex PCR, characterized in that the thrips include Frankliniella intonsa, Frankliniella occidentalis and Frankliniella tritonic. The method comprises the following steps: a) sample processing and DNA extraction: collecting thrips samples and extracting thrips DNA as a template; b) using the primer combination to perform one-step multiplex PCR amplification with the DNA extracted in step a) as a template; c) performing agarose gel electrophoresis analysis on the amplified product, and determining the sample type according to the band size: If a 123bp band appears, it is Frankliniella intonsa; If a 417bp band appears, it is Frankliniella occidentalis; If a 322bp band appears, it is Frankliniella tritonic.

[0009] Further, step a) uses a modified proteinase K lysis method to extract DNA, which comprises: placing the thrips in PBS buffer containing a final concentration of 50-70 μg / ml proteinase K, grinding, and then incubating at 60-70℃ for 25-35 minutes, and then deactivating the enzyme at 90-98℃ for 15 minutes.

[0010] Preferably, the thrips are placed in PBS buffer containing a final concentration of 60 μg / ml proteinase K, ground, and then incubated at 65℃ for 30 minutes, and then deactivating the enzyme at 95℃ for 15 minutes.

[0011] Further, the reaction system used in step b) for one-step multiplex PCR amplification is 50 μL, which comprises: 2×TaqPCR Master Mix 25 μL, template DNA 2 μL, upstream primer combination (10 μM) 2 μL, downstream primer (10 μM) 2 μL, and ddH2O to make up to 50 μL. Among them, 2 μL of the upstream primer combination comprises: 10 μM primer Tt123 0.6 μL, 10 μM primer Fi417 0.8 μL and 10 μM primer Fo322 0.6 μL.

[0012] Further, the PCR amplification procedure used in step b) is: 95 DEG C pre-denaturation for 3 minutes; 95 DEG C denaturation for 15 seconds, 58 DEG C annealing for 15 seconds, 72 DEG C extension for 15 seconds, 39 cycles; 72 DEG C final extension for 5 minutes.

[0013] By the above technical solution, the present application has at least the following advantages and beneficial effects: The present application provides a kind of cotton field common thrips species rapid identification method and detection system based on multiplex PCR, by designing species-specific primer and optimizing reaction condition, realize the synchronous accurate identification of three thrips, improve detection efficiency and accuracy.

[0014] (I) high efficiency: single tube reaction can identify three thrips simultaneously, the detection efficiency is improved by 3 times compared with single PCR, suitable for large-scale sample screening; (II) precision: by species-specific primer design and reaction condition optimization, single template amplification produces single target band, three bands appear simultaneously in mixed sample template, and there is no band in negative control, avoiding the problem of non-specific amplification of universal primer and cross reaction of close species; (III) applicability: suitable for micro sample detection (such as single nymph or residue), breaking through the limitation of traditional morphological identification in nymph stage and close species identification, providing technical support for field rapid detection and population dynamics monitoring. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 The figure shows the COI gene-specific primer design site of the cotton field common thrips species in the preferred embodiment of the present application. Tt: tobacco thrips; Fi: flower thrips; Fo: western flower thrips.

[0016] Figure 2 The figure shows the PCR amplification agarose electrophoresis detection diagram of the thrips species identification specific primer in the preferred embodiment of the present application. Tt: tobacco thrips template; Fi: flower thrips template; Fo: western flower thrips template; Tt123: tobacco thrips-specific upstream primer; Fi417: flower thrips-specific upstream primer; Fo322: western flower thrips-specific upstream primer.

[0017] Figure 3 The figure shows the PCR amplification agarose electrophoresis detection diagram of the 1:1:1 ratio mixed thrips sample and mixed thrips sample in the preferred embodiment of the present application. 1~4: DNA template is western flower thrips, flower thrips, tobacco thrips, 1:1:1 ratio of three thrips mixed sample; 5: negative control (template is ultrapure water).

[0018] Figure 4The annealing temperature optimization agarose electrophoresis detection chart of one-step multiplex specific primer combination PCR amplification for cotton field common thrips species identification in the preferred embodiment of the present application. 1~6: 55℃, 56℃, 57℃, 58℃, 59℃, 60℃; 7: negative control (template is ultrapure water).

[0019] Figure 5 The PCR amplification agarose electrophoresis detection chart of one-step multiplex specific detection system for single species and mixed species for cotton field common thrips species identification in the preferred embodiment of the present application. 1~4: western flower thrips, flower thrips, tobacco thrips, three species mixed samples; 5: negative control (template is ultrapure water) Figure 6 The detection sensitivity results of the multiplex PCR reaction system for different dilution multiples of DNA templates in the preferred embodiment of the present application.

[0020] Figure 7 The detection results of the multiplex PCR reaction system for different thrips species combinations in the preferred embodiment of the present application. DETAILED DESCRIPTION

[0021] The present application adopts the following technical solutions: The present application provides a kind of multiplex PCR rapid identification method for common thrips species in cotton field, comprising the following steps: a) primer design: based on tobacco thrips, flower thrips, western flower thrips COI gene interspecific high variation region design specific upstream primer (Tt123, Fi417, Fo322), combined with universal downstream primer HCO2198.

[0022] b) sample processing and DNA extraction: collect cotton thrips samples, extract thrips DNA using improved protease K lysis method, the specific steps are as follows: place the thrips in PBS buffer containing final concentration of 60 μg / ml protease K, grind and incubate at 65℃ for 30 minutes, 95℃ high temperature enzyme inactivation for 15 minutes, and obtain DNA template.

[0023] c) multiplex PCR reaction system construction: The total volume of reaction system is 50 μL, including 2×Taq PCR Master Mix 25 μL, DNA template 2 μL, upstream primer combination (total 2 μL, Tt123, Fi417, Fo322 are mixed in volume ratio of 3:4:3, and the concentration of each primer is Tt123 (10 μM) 0.6 μL, Fi417 (10 μM) 0.8 μL and Fo322 (10 μM) 0.6 μL, downstream primer HCO2198 (10 μM) 2 μL, and the remaining volume is supplemented with ddH2O.

[0024] d) PCR amplification procedure: pre-denaturation at 95℃ for 3 minutes; then 39 cycles of 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, and 72℃ extension for 15 seconds; and finally 72℃ terminal extension for 5 minutes.

[0025] e) Result detection and analysis: the amplification products were subjected to 1.0% agarose gel electrophoresis at 120V for 35 minutes, and the bands were observed under a UV detector. The species of the thrips were determined according to the band size: 123 bp band for Frankliniella intonsa, 417 bp band for F. occidentalis, and 322 bp band for F. issidra. If multiple bands mentioned above appeared at the same time, it was a mixed sample.

[0026] The following examples are used to illustrate the present application, but are not used to limit the scope of the present application. If not specifically indicated, the technical means used in the examples are the conventional means known to those skilled in the art, and the raw materials used are commercially available.

[0027] Example 1: Design and screening of three thrips-specific upstream primers By comparing the COI gene sequences of three thrips (Frankliniella intonsa, F. occidentalis, and F. issidra) through DNAMAN 9 software, Figure 1 , 9 specific upstream primers were designed (Table 1) targeting F. intonsa, F. occidentalis, and F. issidra, respectively, in the high-variation region of the interspecific base difference set, ensuring that the primer Tm value was between 55-65℃, avoiding primer dimer and hairpin structure, and the designed primers were verified for species specificity and optimized through pre-experiments.

[0028] Table 1: Screening list of three thrips-specific upstream primers

[0029] Figure 2 The results showed that 123 bp specific bands could be amplified with F. intonsa DNA as the template and Tt123 and the universal downstream primer HCO2198 as primers; 417 bp specific bands could be amplified with F. occidentalis DNA as the template and Fi417 and the universal downstream primer HCO2198 as primers; and 322 bp specific bands could be amplified with F. issidra DNA as the template and Fo322 and the universal downstream primer HCO2198 as primers. In summary, compared with other primers, Tt123, Fi417, and Fo322 are specific upstream primers for F. intonsa, F. occidentalis, and F. issidra, respectively.

[0030] Example 2: Construction and amplification of multiplex PCR reaction system The initial multiplex PCR reaction system (total volume 50 μL) was designed, and three thrips-specific upstream primers were mixed in a volume ratio of 1:1:1 (total addition amount 2 μL, each primer concentration Fo322 (10 μM) 0.67 μL, Fi417 (10 μM) 0.67 μL, and Tt123 (10 μM) 0.66 μL), combined with 2 μL of downstream primer HCO2198 (total volume 2 μL), matched with 2×Taq PCR Master Mix 25 μL, template DNA 2 μL (single thrips or three thrips 1:1:1 mixed sample DNA), and ddH2O to 50 μL. The amplification program was set as: pre-denaturation 95℃ 3 min, 39 cycles (denaturation 95℃ 15 s, annealing 55℃ 15 s, extension 72℃ 15 s), and final extension 72℃ 5 min. The initial system amplification results showed that: Figure 3 ): the western flower thrips template: 322 bp band was clear without impurity band; the flower thrips template: no target 417 bp band was observed; the tobacco thrips template: 123 bp band was weak with diffuse background; the mixed template verification: when the three kinds of DNA were mixed in equal proportion as the template, only 322 bp and 123 bp bands were visible, and the 417 bp band was missing. It was indicated that there was amplification competition inhibition in the initial system.

[0031] Based on the actual amplification results of the initial system, the primer ratio and annealing temperature gradient were optimized: the ratio of the upstream combined primers Tt123, Fo322, and Fi417 was adjusted to compensate for the low-efficiency primer concentration, and adjusted to Tt123: Fi417: Fo322=3:4:3, and the annealing temperature was gradient optimized (55℃, 56℃, 57℃, 58℃, 59℃, 60℃), the template was three thrips 1:1:1 mixed sample DNA (2 μL), and other reaction parameters and conditions were unchanged. The results showed that: Figure 4 ): when the volume ratio of each upstream primer was Tt123: Fi417: Fo322=3:4:3 and the annealing temperature was 58℃, the amplification efficiency and specificity of the three primers reached the best balance, the specificity of the three primers in the mixed template was the best, and the non-specific band was the weakest, and the brightness of the three target bands was balanced.

[0032] Example 3 Detection of multiplex PCR reaction system results The single or 1:1:1 mixed sample of the thrips DNA template is subjected to the detection reaction according to the above-mentioned optimal reaction system and amplification procedure. 4 μL of the amplification product is subjected to 1.0% agarose gel electrophoresis at a constant voltage of 120 V for 35 minutes, and observed under an ultraviolet detector. The results show that the single sample appears a corresponding size band (322 bp for WFT, 417 bp for FT and 123 bp for MT), the mixed sample appears three bands at the same time, and the negative control (ultra-pure water as the template) has no band, proving that the system has good specificity and reliability, and can accurately identify the three thrips species Figure 5 .

[0033] In summary, the present application realizes the rapid and accurate identification of common thrips in cotton fields through specific primer design and multiplex PCR system optimization, and has important application value.

[0034] Example 4 Sensitivity and specificity of the multiplex PCR reaction system We determined the sensitivity of the constructed multiplex PCR reaction system. The above-mentioned 1:1:1 mixed thrips DNA template was diluted by different times, and subjected to detection according to the above-mentioned multiplex PCR system, and the results are shown in Figure 6 . The DNA template diluted by 16 times can still clearly amplify the three thrips specific fragments, realizing the detection of the three thrips. When diluted by 18 times or more, the amplified band starts to be unclear, and the detection efficiency is reduced. The above results prove that the constructed multiplex PCR reaction system has high sensitivity.

[0035] The specificity of the multiplex PCR reaction system was further detected. We extracted DNA from mixed samples of different thrips species, and applied the multiplex PCR reaction system for detection. The thrips species information of the mixed sample is shown in Table 2, and the detection results are shown in Table 2 and Figure 7 . The results show that in the 3~5 thrips mixed samples, the constructed multiplex PCR reaction system can accurately identify whether the sample contains tobacco thrips, flower thrips and western flower thrips, and identify the species, proving that the constructed multiplex PCR reaction system has good specificity.

[0036] Table 2 Thrips species combination and results of specificity detection of the multiplex PCR reaction system

[0037] Although the present application has been described in detail in the foregoing description with general principles and specific embodiments, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of protection claimed by the present application.

Claims

1. A PCR primer combination for detecting three types of thrips in cotton fields, characterized in that: The three thrips are Thrips tabaci ( Thrips tabaci )、Flower thrips( Frankliniella intonsa ) and western flower thrips ( Frankliniella occidentalis ); The primer combination includes: The nucleotide sequence of the upstream primer Tt123 specific for Thrips tabaci was: CAGGAGCTATCACAATACTTTTAACT; The flower thrips-specific upstream primer Fi417 had the following nucleotide sequence: ACTATTGCCCCCATCTCTAATTCTAC; The nucleotide sequence of the western flower thrips-specific upstream primer Fo322 is: ATCACTCTGGACCATCAGTAGAT; The nucleotide sequence of the universal downstream primer HCO2198 is: TAAACTTCAGGGTGACCAAAAAATCA.

2. A detection reagent or kit containing the primer combination according to claim 1.

3. Use of the primer combination of claim 1 or the detection reagent or kit of claim 2 in multiplex PCR detection of thrips; The thrips include tobacco thrips, flower thrips and western flower thrips.

4. A multiplex PCR detection method for thrips, characterized in that: The thrips include Thrips tabaci, Thrips occidentalis and Thrips occidentalis; The following steps are involved: a) Sample processing and DNA extraction: thrips samples were collected and thrips DNA was extracted as a template; b) using the DNA extracted in step a) as a template and performing one-step multiplex PCR amplification using the primer combination of claim 1; c) Analyze the amplified products by agarose gel electrophoresis and determine the sample type based on the band size: If a 123 bp band appears, it is Thrips tabaci; If a 417 bp band appears, it is flower thrips; If a 322 bp band appears, it is western flower thrips.

5. The method according to claim 4, characterized in that Step a) DNA is extracted using a modified proteinase K lysis method, comprising: placing the thrips in a PBS buffer containing a final concentration of 50-70 μg / ml proteinase K, grinding, incubating at 60-70° C. for 25-35 minutes, and then inactivating the enzyme at 90-98° C. for 15 minutes.

6. The method according to claim 4, characterized in that Step b) Perform one-step multiplex PCR amplification using a 50 μL reaction system containing: 25 μL of 2× Taq PCR Master Mix, 2 μL of template DNA, 2 μL of 10 μM upstream primer combination, 2 μL of 10 μM downstream primer, and add ddH2O to make up to 50 μL. The 2 μL upstream primer combination contains: 10 μM primer Tt123 0.6 μL, 10 μM primer Fi417 0.8 μL, and 10 μM primer Fo322 0.6 μL.

7. The method according to claim 4, characterized in that The PCR amplification program used in step b) is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, and extension at 72°C for 15 seconds, for 39 cycles; and final extension at 72°C for 5 minutes.